Homologs in group_3706
2 homologs were identified in 2 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product | |
|---|---|---|---|---|---|
| EHELCC_15730 | EHELCC_15730 | 100.0 | Morganella morganii S2 | - | hypothetical protein |
| LHKJJB_15580 | LHKJJB_15580 | 100.0 | Morganella morganii S3 | - | hypothetical protein |
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|
| Source | Morganella morganii S4 |
|---|---|
| Locus tag | NLDBIP_16260 |
| Feature type | CDS |
| Gene | - |
| Product | hypothetical protein |
| Location | 115077 - 115208 (strand: 1) |
| Length | 132 (nucleotides) / 43 (amino acids) |
| In genomic island | - |
| Accession | ZDB_532 |
|---|---|
| Length | 116685 nucleotides |
| Topology | linear |
| Plasmid | False |
| Orthogroup | group_3706 | |
|---|---|---|
| Orthogroup size | 3 | |
| N. genomes | 3 |
MTIDTVVMIAHVLHVSVNELLSDYLASEYSDVMLLMNHRNTDR
TGGGGCTCACACAACAGCAGATATCCCGTTATGAGTCAGGTCAATCATTAATGACCATAGATACTGTCGTTATGATTGCTCATGTGCTTCATGTTTCTGTAAACGAGTTACTGAGTGATTACCTTGCCTCAGAGTACAGTGACGTTATGCTTTTAATGAACCATCGTAATACCGATAGATAGCCGCGCCGGACATCCACCAGCGCGGCTTTGTTTTATTCCTCTGCTGCTTC
