Homologs in group_1983

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14610 FBDBKF_14610 100.0 Morganella morganii S1 pepT peptidase T
EHELCC_15415 EHELCC_15415 100.0 Morganella morganii S2 pepT peptidase T
LHKJJB_15895 LHKJJB_15895 100.0 Morganella morganii S3 pepT peptidase T
HKOGLL_15015 HKOGLL_15015 100.0 Morganella morganii S5 pepT peptidase T
F4V73_RS07405 F4V73_RS07405 95.6 Morganella psychrotolerans pepT peptidase T
PMI_RS04330 PMI_RS04330 85.6 Proteus mirabilis HI4320 pepT peptidase T

Distribution of the homologs in the orthogroup group_1983

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1983

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B1JI59 0.0 694 77 0 410 3 pepT Peptidase T Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FH54 0.0 694 77 0 410 3 pepT Peptidase T Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q669P7 0.0 694 77 0 410 3 pepT Peptidase T Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLP0 0.0 694 77 0 410 3 pepT Peptidase T Yersinia pestis (strain Pestoides F)
Q1CI51 0.0 694 77 0 410 3 pepT Peptidase T Yersinia pestis bv. Antiqua (strain Nepal516)
A9R0M2 0.0 694 77 0 410 3 pepT Peptidase T Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFR0 0.0 694 77 0 410 3 pepT Peptidase T Yersinia pestis
B2K719 0.0 694 77 0 410 3 pepT Peptidase T Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6R3 0.0 694 77 0 410 3 pepT Peptidase T Yersinia pestis bv. Antiqua (strain Antiqua)
C6DFW1 0.0 681 75 0 409 3 pepT Peptidase T Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D4E3 0.0 673 75 0 409 3 pepT Peptidase T Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C5BFN3 0.0 660 74 0 405 3 pepT Peptidase T Edwardsiella ictaluri (strain 93-146)
A8GDC2 0.0 660 74 0 405 3 pepT Peptidase T Serratia proteamaculans (strain 568)
B5XSP2 0.0 652 73 0 405 3 pepT Peptidase T Klebsiella pneumoniae (strain 342)
A8AHU0 0.0 642 73 0 405 3 pepT Peptidase T Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A7ZKR7 0.0 642 72 0 405 3 pepT Peptidase T Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3Z2Z2 0.0 642 72 0 405 3 pepT Peptidase T Shigella sonnei (strain Ss046)
Q32EY5 0.0 642 72 0 405 3 pepT Peptidase T Shigella dysenteriae serotype 1 (strain Sd197)
Q1RD26 0.0 642 72 0 405 3 pepT Peptidase T Escherichia coli (strain UTI89 / UPEC)
B7N3N7 0.0 642 72 0 405 3 pepT Peptidase T Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P65803 0.0 642 72 0 405 3 pepT Peptidase T Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AA21 0.0 642 72 0 405 3 pepT Peptidase T Escherichia coli O1:K1 / APEC
B7MTQ8 0.0 642 72 0 405 3 pepT Peptidase T Escherichia coli O81 (strain ED1a)
P65804 0.0 642 72 0 405 3 pepT Peptidase T Escherichia coli O157:H7
B7MJB5 0.0 642 72 0 405 3 pepT Peptidase T Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UQ36 0.0 642 72 0 405 3 pepT Peptidase T Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P29745 0.0 641 72 0 405 1 pepT Peptidase T Escherichia coli (strain K12)
B1XA37 0.0 641 72 0 405 3 pepT Peptidase T Escherichia coli (strain K12 / DH10B)
C4ZS67 0.0 641 72 0 405 3 pepT Peptidase T Escherichia coli (strain K12 / MC4100 / BW2952)
B6I9K6 0.0 641 72 0 405 3 pepT Peptidase T Escherichia coli (strain SE11)
Q0TIU6 0.0 640 72 0 405 3 pepT Peptidase T Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q83RR6 0.0 640 72 0 405 3 pepT Peptidase T Shigella flexneri
Q0T5R1 0.0 640 72 0 405 3 pepT Peptidase T Shigella flexneri serotype 5b (strain 8401)
B1IUE0 0.0 640 72 0 405 3 pepT Peptidase T Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZ82 0.0 640 72 0 405 3 pepT Peptidase T Escherichia coli O9:H4 (strain HS)
Q31ZK3 0.0 639 72 0 405 3 pepT Peptidase T Shigella boydii serotype 4 (strain Sb227)
B2TZ80 0.0 639 72 0 405 3 pepT Peptidase T Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LQ18 0.0 636 72 0 405 3 pepT Peptidase T Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P26311 0.0 635 72 0 405 1 pepT Peptidase T Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4T3R6 0.0 635 72 0 405 3 pepT Peptidase T Salmonella newport (strain SL254)
B4TFK5 0.0 635 72 0 405 3 pepT Peptidase T Salmonella heidelberg (strain SL476)
B4TTK0 0.0 634 72 0 405 3 pepT Peptidase T Salmonella schwarzengrund (strain CVM19633)
B5QXA9 0.0 634 72 0 405 3 pepT Peptidase T Salmonella enteritidis PT4 (strain P125109)
B5F8C6 0.0 634 72 0 405 3 pepT Peptidase T Salmonella agona (strain SL483)
B5FK77 0.0 634 72 0 405 3 pepT Peptidase T Salmonella dublin (strain CT_02021853)
B5BAE8 0.0 633 72 0 405 3 pepT Peptidase T Salmonella paratyphi A (strain AKU_12601)
Q5PMK2 0.0 633 72 0 405 3 pepT Peptidase T Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RB75 0.0 633 72 0 405 3 pepT Peptidase T Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q57QC7 0.0 633 72 0 405 3 pepT Peptidase T Salmonella choleraesuis (strain SC-B67)
A9MG86 0.0 633 72 0 405 3 pepT Peptidase T Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
C0Q764 0.0 630 72 0 405 3 pepT Peptidase T Salmonella paratyphi C (strain RKS4594)
Q8Z7H6 0.0 629 72 0 405 3 pepT Peptidase T Salmonella typhi
Q87GX2 0.0 519 61 2 406 3 pepT Peptidase T Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MDF5 0.0 512 59 2 406 3 pepT Peptidase T Vibrio vulnificus (strain YJ016)
Q6LR24 1.18e-178 506 60 2 406 3 pepT Peptidase T Photobacterium profundum (strain SS9)
B7VSC8 2.68e-178 506 59 2 411 3 pepT Peptidase T Vibrio atlanticus (strain LGP32)
C3LUK2 4.7e-177 502 59 2 411 3 pepT Peptidase T Vibrio cholerae serotype O1 (strain M66-2)
A5EYJ8 4.7e-177 502 59 2 411 3 pepT Peptidase T Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B6ER23 5.17e-177 502 58 3 414 3 pepT Peptidase T Aliivibrio salmonicida (strain LFI1238)
Q5E0X3 1.51e-175 498 59 2 410 3 pepT Peptidase T Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9KMY6 2.99e-175 498 59 2 411 3 pepT Peptidase T Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A8H6S3 6.98e-166 474 57 5 406 3 pepT Peptidase T Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q9CP05 2.71e-164 470 56 0 401 3 pepT Peptidase T Pasteurella multocida (strain Pm70)
B0TPD4 5.1e-164 469 56 5 406 3 pepT Peptidase T Shewanella halifaxensis (strain HAW-EB4)
Q5KZ39 3.6e-161 462 56 4 406 3 pepT Peptidase T Geobacillus kaustophilus (strain HTA426)
A4SPD7 5.73e-160 459 55 5 408 3 pepT Peptidase T Aeromonas salmonicida (strain A449)
A4INW9 1.49e-159 458 55 3 403 3 pepT Peptidase T Geobacillus thermodenitrificans (strain NG80-2)
B8CWQ0 8.7e-159 456 55 3 407 3 pepT Peptidase T Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q97LS8 1.13e-158 456 55 4 411 3 pepT Peptidase T Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q4QK58 2.37e-158 455 55 2 406 3 pepT Peptidase T Haemophilus influenzae (strain 86-028NP)
P45172 4.97e-158 454 55 2 406 3 pepT Peptidase T Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C5DAS5 5.71e-158 454 54 3 404 3 pepT Peptidase T Geobacillus sp. (strain WCH70)
A5UEI5 8.58e-158 454 55 2 406 3 pepT Peptidase T Haemophilus influenzae (strain PittGG)
B1KHS7 2.28e-157 452 54 4 403 3 pepT Peptidase T Shewanella woodyi (strain ATCC 51908 / MS32)
Q65D74 8.83e-157 451 54 3 404 3 pepT Peptidase T Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q64WS4 1.08e-156 451 54 3 404 3 pepT Peptidase T Bacteroides fragilis (strain YCH46)
Q5LFT7 1.08e-156 451 54 3 404 3 pepT Peptidase T Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
P55179 1.32e-156 451 56 3 403 3 pepT Peptidase T Bacillus subtilis (strain 168)
A0KIP7 1.58e-156 450 55 5 408 3 pepT Peptidase T Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8R922 3.41e-156 449 54 4 408 3 pepT Peptidase T Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A5UBV7 5.14e-156 449 55 2 406 3 pepT Peptidase T Haemophilus influenzae (strain PittEE)
A7ZAB2 1.23e-155 448 55 3 404 3 pepT Peptidase T Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A8FIY2 1.63e-155 448 53 3 404 3 pepT Peptidase T Bacillus pumilus (strain SAFR-032)
Q89YZ7 5.74e-155 446 54 3 404 3 pepT Peptidase T Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A0Q3I1 1.62e-154 445 53 4 409 3 pepT Peptidase T Clostridium novyi (strain NT)
Q5WK52 2.13e-153 442 54 5 412 3 pepT Peptidase T Shouchella clausii (strain KSM-K16)
Q92AM8 1.74e-152 440 53 3 404 3 pepT Peptidase T Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A7GR91 1.74e-152 440 54 3 403 3 pepT Peptidase T Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
C1FSB0 3.8e-152 439 52 3 407 3 pepT Peptidase T Clostridium botulinum (strain Kyoto / Type A2)
A0AJN4 3.85e-152 439 54 4 408 3 pepT Peptidase T Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
C3L049 3.88e-152 439 52 3 407 3 pepT Peptidase T Clostridium botulinum (strain 657 / Type Ba4)
A5HYY2 5.33e-152 439 52 3 407 3 pepT Peptidase T Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FPG2 5.33e-152 439 52 3 407 3 pepT Peptidase T Clostridium botulinum (strain ATCC 19397 / Type A)
A8G0I7 7.24e-152 438 54 6 406 3 pepT Peptidase T Shewanella sediminis (strain HAW-EB3)
B1KV00 1.36e-151 437 51 3 407 3 pepT Peptidase T Clostridium botulinum (strain Loch Maree / Type A3)
B1IEF5 3.3e-151 437 51 3 407 3 pepT Peptidase T Clostridium botulinum (strain Okra / Type B1)
A7GAK0 5.33e-151 436 51 3 407 3 pepT Peptidase T Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
C1KW79 8.73e-151 436 54 4 408 3 pepT Peptidase T Listeria monocytogenes serotype 4b (strain CLIP80459)
Q71YN8 1.2e-150 435 54 4 408 3 pepT Peptidase T Listeria monocytogenes serotype 4b (strain F2365)
B8DDX7 2.8e-150 434 53 4 408 3 pepT Peptidase T Listeria monocytogenes serotype 4a (strain HCC23)
Q8Y6B1 5.76e-150 434 54 4 408 3 pepT Peptidase T Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q24VU3 1.46e-149 432 54 4 407 3 pepT Peptidase T Desulfitobacterium hafniense (strain Y51)
Q0TV42 2.88e-149 432 52 3 406 3 pepT Peptidase T Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SWT9 3.82e-149 431 53 3 406 3 pepT Peptidase T Clostridium perfringens (strain SM101 / Type A)
A6L8T2 9.55e-149 431 52 5 404 3 pepT Peptidase T Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B8G1J0 1.89e-148 430 53 4 407 3 pepT Peptidase T Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A8ML45 2.35e-148 429 52 4 407 3 pepT Peptidase T Alkaliphilus oremlandii (strain OhILAs)
B7HDL9 4.19e-148 429 53 3 401 3 pepT Peptidase T Bacillus cereus (strain B4264)
B7ITJ6 6.41e-148 428 53 3 401 3 pepT Peptidase T Bacillus cereus (strain G9842)
Q8XPD8 9.97e-148 428 52 3 406 3 pepT Peptidase T Clostridium perfringens (strain 13 / Type A)
B9IV41 1.21e-147 428 53 3 401 3 pepT Peptidase T Bacillus cereus (strain Q1)
B7HKU6 1.36e-147 427 53 3 401 3 pepT Peptidase T Bacillus cereus (strain AH187)
B1YFS8 1.42e-147 427 53 3 408 3 pepT Peptidase T Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q636T5 1.59e-147 427 53 3 401 3 pepT Peptidase T Bacillus cereus (strain ZK / E33L)
Q81A48 1.7e-147 427 53 3 401 3 pepT Peptidase T Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B1HZ48 4.18e-147 426 52 3 403 3 pepT Peptidase T Lysinibacillus sphaericus (strain C3-41)
Q732Y5 6.13e-147 426 53 3 401 3 pepT Peptidase T Bacillus cereus (strain ATCC 10987 / NRS 248)
C1ENW4 7.46e-147 426 52 3 402 3 pepT Peptidase T Bacillus cereus (strain 03BB102)
A0RHB6 7.46e-147 426 52 3 402 3 pepT Peptidase T Bacillus thuringiensis (strain Al Hakam)
A9VR36 8.05e-147 426 53 3 401 3 pepT Peptidase T Bacillus mycoides (strain KBAB4)
Q6HF68 2.1e-146 424 52 3 401 3 pepT Peptidase T Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7JJ20 3.91e-146 424 52 3 402 3 pepT Peptidase T Bacillus cereus (strain AH820)
Q81WU4 7.44e-146 423 52 3 402 1 pepT Peptidase T Bacillus anthracis
C3L855 7.44e-146 423 52 3 402 3 pepT Peptidase T Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P5E3 7.44e-146 423 52 3 402 3 pepT Peptidase T Bacillus anthracis (strain A0248)
C0ZDI3 1.81e-143 417 52 3 403 3 pepT Peptidase T Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
C4L0I9 3.03e-143 417 52 4 402 3 pepT Peptidase T Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q8CXN0 1.14e-142 415 50 4 405 3 pepT Peptidase T Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A9KT72 2.71e-140 409 50 4 410 3 pepT Peptidase T Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q6GIP8 7.81e-140 408 50 4 406 3 pepT Peptidase T Staphylococcus aureus (strain MRSA252)
P65806 5.99e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain N315)
P65805 5.99e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQU7 5.99e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain JH9)
A6TZM2 5.99e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain JH1)
A7WZN6 5.99e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NXM6 9.27e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain MW2)
A8Z018 9.27e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain USA300 / TCH1516)
Q6GB87 9.27e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain MSSA476)
A6QF52 9.27e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain Newman)
Q5HHS7 9.27e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain COL)
Q2G064 9.27e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIP8 9.27e-139 405 50 4 403 3 pepT Peptidase T Staphylococcus aureus (strain USA300)
B9EAD7 3.73e-138 404 50 4 402 3 pepT Peptidase T Macrococcus caseolyticus (strain JCSC5402)
Q4L4G8 8.29e-138 403 51 3 401 3 pepT Peptidase T Staphylococcus haemolyticus (strain JCSC1435)
Q2YSI6 1.11e-137 402 49 4 403 3 pepT Peptidase T Staphylococcus aureus (strain bovine RF122 / ET3-1)
B9DK09 1.24e-137 402 49 3 405 3 pepT Peptidase T Staphylococcus carnosus (strain TM300)
P58794 2.12e-137 402 50 4 404 3 pepT Peptidase T Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8CWX9 6.04e-136 398 51 5 402 3 pepT Peptidase T Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B9DU35 2.29e-135 396 49 5 404 3 pepT Peptidase T Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q8E4E2 1.68e-132 389 50 6 403 3 pepT Peptidase T Streptococcus agalactiae serotype III (strain NEM316)
C0MGM6 4.88e-132 388 48 5 404 3 pepT Peptidase T Streptococcus equi subsp. zooepidemicus (strain H70)
C0M8H1 4.88e-132 388 48 5 404 3 pepT Peptidase T Streptococcus equi subsp. equi (strain 4047)
Q5M465 5.15e-132 388 51 5 402 3 pepT Peptidase T Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LZL2 5.15e-132 388 51 5 402 3 pepT Peptidase T Streptococcus thermophilus (strain CNRZ 1066)
Q03KI4 8.05e-132 387 51 5 402 3 pepT Peptidase T Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q8DYT4 2.08e-131 386 50 6 403 3 pepT Peptidase T Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q49VU2 8.2e-131 385 49 3 400 3 pepT Peptidase T Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q3K0C3 1.17e-130 384 49 6 403 3 pepT Peptidase T Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q38X92 4.49e-130 383 47 6 410 3 pepT Peptidase T Latilactobacillus sakei subsp. sakei (strain 23K)
A2RF89 1.12e-129 382 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J7C3 1.12e-129 382 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q835J5 1.71e-129 382 50 6 408 3 pepT Peptidase T Enterococcus faecalis (strain ATCC 700802 / V583)
Q1JHK2 1.78e-129 381 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q48U99 2.39e-129 381 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q8P1H9 2.5e-129 381 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q1JMF5 2.58e-129 381 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JCH7 2.58e-129 381 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DD01 4.49e-129 380 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DD00 4.49e-129 380 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B5XKT3 6.37e-129 380 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M49 (strain NZ131)
B2GC19 7.85e-129 380 49 5 405 3 pepT Peptidase T Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q8CPZ6 8.85e-129 380 48 4 405 3 pepT Peptidase T Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQY6 8.85e-129 380 48 4 405 3 pepT Peptidase T Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9A0F4 1.33e-128 379 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M1
Q5XCU7 2.06e-128 379 49 5 400 3 pepT Peptidase T Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1WTV4 8.98e-128 377 48 7 410 3 pepT Peptidase T Ligilactobacillus salivarius (strain UCC118)
Q97R31 3.47e-126 373 49 4 399 3 pepT Peptidase T Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A3CNH0 3.91e-126 373 50 4 399 3 pepT Peptidase T Streptococcus sanguinis (strain SK36)
C1C6Y4 1.19e-125 372 49 4 399 3 pepT Peptidase T Streptococcus pneumoniae (strain 70585)
A8AXT3 1.85e-125 371 51 4 399 3 pepT Peptidase T Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B1IBG7 2.86e-125 371 49 4 399 3 pepT Peptidase T Streptococcus pneumoniae (strain Hungary19A-6)
C1CK88 4.93e-125 370 49 4 399 3 pepT Peptidase T Streptococcus pneumoniae (strain P1031)
B2IPG2 9.27e-125 369 49 4 399 3 pepT Peptidase T Streptococcus pneumoniae (strain CGSP14)
C1CRC4 1.55e-124 369 49 4 399 3 pepT Peptidase T Streptococcus pneumoniae (strain Taiwan19F-14)
C1CE02 2.14e-124 369 48 4 399 3 pepT Peptidase T Streptococcus pneumoniae (strain JJA)
Q02X44 2.72e-124 369 48 5 406 3 pepT Peptidase T Lactococcus lactis subsp. cremoris (strain SK11)
A2RMN0 2.72e-124 369 48 5 406 3 pepT Peptidase T Lactococcus lactis subsp. cremoris (strain MG1363)
Q76HM7 2.72e-124 369 48 5 406 1 pepT Peptidase T Lactococcus lactis subsp. cremoris
Q8DQ05 3.45e-124 368 49 4 399 3 pepT Peptidase T Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04KS5 3.45e-124 368 49 4 399 3 pepT Peptidase T Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P0C2T7 4.95e-124 368 48 5 406 1 pepT Peptidase T Lactococcus lactis subsp. cremoris
Q76HM5 6.22e-124 367 48 5 406 1 pepT Peptidase T Lactococcus lactis subsp. lactis
Q9CEM7 6.22e-124 367 48 5 406 3 pepT Peptidase T Lactococcus lactis subsp. lactis (strain IL1403)
Q84BV2 1.18e-123 367 48 5 406 1 pepT Peptidase T Lactococcus lactis subsp. hordniae
B8ZPG1 1.03e-122 364 48 4 399 3 pepT Peptidase T Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
A4VVF5 5.98e-122 362 47 4 400 3 pepT Peptidase T Streptococcus suis (strain 05ZYH33)
A4W1Q9 5.98e-122 362 47 4 400 3 pepT Peptidase T Streptococcus suis (strain 98HAH33)
Q9L4G1 2.21e-115 346 44 6 406 1 pepT Peptidase T Lactobacillus helveticus
Q8ZH96 3.51e-89 278 38 8 407 3 YPO1009 Peptidase T-like protein YPO1009/y3403/YP_3421 Yersinia pestis
Q92VT5 1.87e-87 274 38 6 408 3 RB0614 Peptidase T-like protein RB0614 Rhizobium meliloti (strain 1021)
P54542 3.72e-22 100 26 12 418 3 yqjE Uncharacterized protein YqjE Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_15945
Feature type CDS
Gene pepT
Product peptidase T
Location 48187 - 49419 (strand: -1)
Length 1233 (nucleotides) / 410 (amino acids)
In genomic island -

Contig

Accession ZDB_532
Length 116685 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1983
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01546 Peptidase family M20/M25/M40
PF07687 Peptidase dimerisation domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2195 Amino acid transport and metabolism (E) E Di- or tripeptidase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01258 tripeptide aminopeptidase [EC:3.4.11.4] - -

Protein Sequence

MDKLLERFFGYVSFDTQSKPSAKLTPSSDGQLRLARALEKELKTLGLSDVSLDDNGCVMATLPANVDWPVPVIGFISHLDTSPDFSGRNVNPQVLENYRGGDIALGIGDEVLSPVMFPVLHTMLGKTLIMTDGKTLLGADDKAGIAEIITAMVRLKNSDIPHGDIRIAFTPDEEIGRGAQYVDLKKFGAQWAYTVDGGGVGELEYENFNAAAVAIRIEGNNVHPGSAKGVMVNALSLATRIHSELPPEETPENTEGYEGFYHLQSIKGTVERAEMNYIIRDFDRNNFEKRKSNMIAIAEKVGKGLHPDCYIELTIDDSYYNMRDHVVKHPHVIELAKQAMIDCDIEPDIKPIRGGTDGAQLSYRGLPCPNLFTGGYNFHSKHEFISLEGMEQAVSVIMRIAELTALDMKK

Flanking regions ( +/- flanking 50bp)

TCAATTTATGTTTCCCCGATAATAAGAAATCAATGTTATTGGGGGAACACATGGATAAGTTATTAGAGCGCTTTTTCGGTTATGTCTCTTTTGACACGCAGTCGAAGCCGTCAGCCAAGCTGACACCAAGCAGCGACGGTCAGTTAAGGCTGGCGCGTGCTCTGGAAAAAGAGCTGAAAACGCTGGGGTTATCAGATGTCTCGCTGGATGATAACGGCTGCGTGATGGCAACGTTACCGGCGAATGTTGACTGGCCGGTACCGGTTATCGGTTTTATTTCTCACCTTGATACCTCACCGGATTTCTCCGGGCGTAATGTGAATCCTCAGGTTCTGGAAAATTACCGTGGTGGTGATATCGCACTCGGCATCGGCGATGAAGTGCTGTCGCCGGTAATGTTCCCGGTGCTGCACACCATGCTGGGTAAAACCCTGATTATGACCGACGGTAAAACCCTGCTGGGTGCGGATGACAAAGCCGGTATCGCAGAAATCATTACTGCCATGGTGCGTTTGAAAAACAGTGATATTCCGCACGGTGATATCCGCATTGCCTTCACGCCGGATGAAGAAATCGGTCGTGGTGCACAGTATGTGGATCTGAAAAAATTCGGTGCACAGTGGGCTTATACCGTTGATGGCGGTGGTGTCGGTGAGCTGGAATATGAAAACTTCAATGCGGCGGCAGTTGCCATCCGTATTGAGGGCAATAACGTGCATCCGGGCAGTGCCAAAGGTGTGATGGTGAACGCGCTGTCACTGGCAACCCGTATCCACAGCGAATTACCGCCGGAAGAAACGCCGGAAAATACCGAAGGGTATGAAGGTTTCTATCATCTGCAAAGCATCAAAGGCACGGTTGAACGCGCGGAAATGAACTATATCATCCGTGATTTTGACCGTAACAATTTTGAAAAACGCAAAAGCAATATGATTGCGATTGCCGAGAAAGTCGGTAAAGGTCTGCATCCGGACTGCTATATCGAGCTGACGATTGATGACAGCTATTACAATATGCGCGACCATGTGGTGAAACACCCGCATGTGATCGAACTGGCCAAACAGGCGATGATTGACTGCGATATTGAGCCGGATATCAAACCTATTCGTGGTGGTACTGACGGTGCGCAACTCTCTTACCGTGGTCTGCCGTGCCCGAATCTGTTTACCGGTGGTTATAACTTCCACAGTAAACACGAGTTTATCTCACTGGAAGGCATGGAACAGGCTGTTTCTGTGATTATGCGGATTGCAGAATTAACCGCACTGGATATGAAGAAATAAATAATTCACATATCAATTAAATATTATAAAAGCCATCTTGCATAAGATGG