Homologs in group_1726

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11745 FBDBKF_11745 100.0 Morganella morganii S1 rpsG 30S ribosomal protein S7
EHELCC_14560 EHELCC_14560 100.0 Morganella morganii S2 rpsG 30S ribosomal protein S7
LHKJJB_14955 LHKJJB_14955 100.0 Morganella morganii S3 rpsG 30S ribosomal protein S7
HKOGLL_19335 HKOGLL_19335 100.0 Morganella morganii S5 rpsG 30S ribosomal protein S7
F4V73_RS14915 F4V73_RS14915 97.4 Morganella psychrotolerans rpsG 30S ribosomal protein S7
PMI_RS13800 PMI_RS13800 96.8 Proteus mirabilis HI4320 rpsG 30S ribosomal protein S7

Distribution of the homologs in the orthogroup group_1726

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1726

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
C6DG81 7.66e-111 314 98 0 156 3 rpsG Small ribosomal subunit protein uS7 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q7N9B3 1.23e-110 313 98 0 156 3 rpsG Small ribosomal subunit protein uS7 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6CZW4 3.12e-110 312 98 0 156 3 rpsG Small ribosomal subunit protein uS7 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NQL5 1.02e-109 311 97 0 156 3 rpsG Small ribosomal subunit protein uS7 Sodalis glossinidius (strain morsitans)
A8GKK3 3.49e-109 310 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Serratia proteamaculans (strain 568)
Q0SZX6 8.56e-109 310 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Shigella flexneri serotype 5b (strain 8401)
Q3YWT1 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Shigella sonnei (strain Ss046)
P66608 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Shigella flexneri
Q31VU8 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Shigella boydii serotype 4 (strain Sb227)
B2U2U8 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B4TXE9 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella schwarzengrund (strain CVM19633)
B5RH08 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R298 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella enteritidis PT4 (strain P125109)
B5FJM1 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella dublin (strain CT_02021853)
B5F8F9 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella agona (strain SL483)
B7LS47 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R5U2 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli (strain UTI89 / UPEC)
B1LHE1 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli (strain SMS-3-5 / SECEC)
B6I241 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli (strain SE11)
B7NDU9 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IPV8 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P66606 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCB8 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGM8 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O1:K1 / APEC
A8A5E8 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O9:H4 (strain HS)
B7M1P2 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O8 (strain IAI1)
B7N1C2 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O81 (strain ED1a)
B7NLP6 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YTP8 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O157:H7 (strain EC4115 / EHEC)
P66607 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O157:H7
B7L4L6 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli (strain 55989 / EAEC)
B7MCV6 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UK51 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZSL6 9.07e-109 309 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli O139:H28 (strain E24377A / ETEC)
P02359 1.1e-108 310 96 0 156 1 rpsG Small ribosomal subunit protein uS7 Escherichia coli (strain K12)
B1X6J1 1.1e-108 310 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli (strain K12 / DH10B)
C4ZUJ6 1.1e-108 310 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Escherichia coli (strain K12 / MC4100 / BW2952)
B1JIV4 1.59e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664R5 1.59e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGY5 1.59e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Yersinia pestis (strain Pestoides F)
Q1CCT7 1.59e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Yersinia pestis bv. Antiqua (strain Nepal516)
A9R463 1.59e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJB4 1.59e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Yersinia pestis
B2K5N6 1.59e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C2T9 1.59e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Yersinia pestis bv. Antiqua (strain Antiqua)
A7FNP0 1.59e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JS56 1.59e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B2VK37 1.61e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P0A2B3 2.87e-108 308 96 0 156 1 rpsG Small ribosomal subunit protein uS7 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2B4 2.87e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella typhi
B5BGZ3 2.87e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella paratyphi A (strain AKU_12601)
C0Q0C3 2.87e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella paratyphi C (strain RKS4594)
A9MT07 2.87e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIW2 2.87e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SUU7 2.87e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella newport (strain SL254)
B4TKM2 2.87e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella heidelberg (strain SL476)
A9MN38 2.87e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7MKJ3 2.87e-108 308 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Cronobacter sakazakii (strain ATCC BAA-894)
C5BGM9 3.17e-108 307 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Edwardsiella ictaluri (strain 93-146)
B4EYV8 5.55e-108 307 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Proteus mirabilis (strain HI4320)
B5XN86 7.46e-108 306 95 0 156 3 rpsG Small ribosomal subunit protein uS7 Klebsiella pneumoniae (strain 342)
Q32B25 7.71e-108 306 96 0 156 3 rpsG Small ribosomal subunit protein uS7 Shigella dysenteriae serotype 1 (strain Sd197)
Q57J25 1.38e-107 306 95 0 156 3 rpsG Small ribosomal subunit protein uS7 Salmonella choleraesuis (strain SC-B67)
A8AQM9 2.07e-107 305 94 0 156 3 rpsG Small ribosomal subunit protein uS7 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6TEX9 2.67e-107 305 94 0 156 3 rpsG Small ribosomal subunit protein uS7 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4WFD4 5.62e-107 304 95 0 156 3 rpsG Small ribosomal subunit protein uS7 Enterobacter sp. (strain 638)
B8F7Z3 5.49e-102 291 91 0 156 3 rpsG Small ribosomal subunit protein uS7 Glaesserella parasuis serovar 5 (strain SH0165)
Q9Z6D1 1.01e-101 291 90 0 156 3 rpsG Small ribosomal subunit protein uS7 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0BQZ4 2.39e-101 290 90 0 156 3 rpsG Small ribosomal subunit protein uS7 Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2G6 2.39e-101 290 90 0 156 3 rpsG Small ribosomal subunit protein uS7 Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N248 2.39e-101 290 90 0 156 3 rpsG Small ribosomal subunit protein uS7 Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0UWC5 1.53e-100 288 90 0 156 3 rpsG Small ribosomal subunit protein uS7 Histophilus somni (strain 2336)
Q0I536 1.53e-100 288 90 0 156 3 rpsG Small ribosomal subunit protein uS7 Histophilus somni (strain 129Pt)
P44376 2.47e-100 287 89 0 156 3 rpsG Small ribosomal subunit protein uS7 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UHC0 2.47e-100 287 89 0 156 3 rpsG Small ribosomal subunit protein uS7 Haemophilus influenzae (strain PittGG)
A5U9Q9 2.47e-100 287 89 0 156 3 rpsG Small ribosomal subunit protein uS7 Haemophilus influenzae (strain PittEE)
Q4QMT7 2.47e-100 287 89 0 156 3 rpsG Small ribosomal subunit protein uS7 Haemophilus influenzae (strain 86-028NP)
Q9CL85 2.76e-100 287 89 0 156 3 rpsG Small ribosomal subunit protein uS7 Pasteurella multocida (strain Pm70)
A6VL12 7.92e-99 284 88 0 156 3 rpsG Small ribosomal subunit protein uS7 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C3LR92 3.76e-98 282 87 0 156 3 rpsG Small ribosomal subunit protein uS7 Vibrio cholerae serotype O1 (strain M66-2)
Q9KUZ8 3.76e-98 282 87 0 156 3 rpsG Small ribosomal subunit protein uS7 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3J8 3.76e-98 282 87 0 156 3 rpsG Small ribosomal subunit protein uS7 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C4K4G0 3.93e-98 282 86 0 156 3 rpsG Small ribosomal subunit protein uS7 Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q87L44 1.55e-97 280 87 0 156 3 rpsG Small ribosomal subunit protein uS7 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q65W90 3.3e-97 280 87 0 156 3 rpsG Small ribosomal subunit protein uS7 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B7VLG1 3.56e-97 280 86 0 156 3 rpsG Small ribosomal subunit protein uS7 Vibrio atlanticus (strain LGP32)
A7MZ63 5.18e-97 279 86 0 156 3 rpsG Small ribosomal subunit protein uS7 Vibrio campbellii (strain ATCC BAA-1116)
Q7MH41 8.76e-97 278 86 0 156 3 rpsG Small ribosomal subunit protein uS7 Vibrio vulnificus (strain YJ016)
Q8DCQ9 8.76e-97 278 86 0 156 3 rpsG Small ribosomal subunit protein uS7 Vibrio vulnificus (strain CMCP6)
Q3ILP6 1.09e-96 278 85 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudoalteromonas translucida (strain TAC 125)
B6EPR6 1.57e-96 278 85 0 156 3 rpsG Small ribosomal subunit protein uS7 Aliivibrio salmonicida (strain LFI1238)
C4LBU5 2.4e-96 277 84 0 156 3 rpsG Small ribosomal subunit protein uS7 Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B8D853 3.03e-96 277 85 0 156 3 rpsG Small ribosomal subunit protein uS7 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57594 3.03e-96 277 85 0 156 3 rpsG Small ribosomal subunit protein uS7 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9V1 3.03e-96 277 85 0 156 3 rpsG Small ribosomal subunit protein uS7 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B5FG05 3.57e-96 277 85 0 156 3 rpsG Small ribosomal subunit protein uS7 Aliivibrio fischeri (strain MJ11)
Q5E8C0 3.57e-96 277 85 0 156 3 rpsG Small ribosomal subunit protein uS7 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6LVC2 7.2e-96 276 85 0 156 3 rpsG Small ribosomal subunit protein uS7 Photobacterium profundum (strain SS9)
P59059 1.14e-95 276 83 0 156 3 rpsG Small ribosomal subunit protein uS7 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A3Q978 5.6e-95 274 83 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q15YA8 1.13e-94 273 82 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q47UW2 3.86e-94 272 83 0 156 3 rpsG Small ribosomal subunit protein uS7 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A0KRM0 1.04e-93 271 81 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella sp. (strain ANA-3)
B8CNC8 1.39e-93 270 81 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella piezotolerans (strain WP3 / JCM 13877)
Q0I0A9 1.72e-93 270 81 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella sp. (strain MR-7)
Q0HNU1 1.72e-93 270 81 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella sp. (strain MR-4)
Q8EK72 1.72e-93 270 81 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0KQ97 1.85e-93 270 81 0 156 3 rpsG Small ribosomal subunit protein uS7 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SHV7 1.96e-93 270 81 0 156 3 rpsG Small ribosomal subunit protein uS7 Aeromonas salmonicida (strain A449)
A8GYX2 2.28e-93 270 81 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TM16 2.28e-93 270 81 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella halifaxensis (strain HAW-EB4)
A9KW98 1.63e-92 268 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella baltica (strain OS195)
A6WHS4 1.63e-92 268 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella baltica (strain OS185)
A3DB98 1.63e-92 268 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EBK9 1.63e-92 268 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella baltica (strain OS223)
Q089Q8 1.66e-92 268 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella frigidimarina (strain NCIMB 400)
Q12SW3 1.94e-92 268 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B1KMY7 2.12e-92 267 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella woodyi (strain ATCC 51908 / MS32)
A1S214 2.28e-92 267 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q5QWB5 3.58e-92 267 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1REB0 4.13e-92 267 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella sp. (strain W3-18-1)
A4YBY7 4.13e-92 267 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1T058 1.18e-91 266 80 0 156 3 rpsG Small ribosomal subunit protein uS7 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q1LSY6 1.24e-91 265 81 0 156 3 rpsG Small ribosomal subunit protein uS7 Baumannia cicadellinicola subsp. Homalodisca coagulata
A8G1F2 4.27e-91 264 79 0 156 3 rpsG Small ribosomal subunit protein uS7 Shewanella sediminis (strain HAW-EB3)
Q492B0 5.39e-88 256 78 0 156 3 rpsG Small ribosomal subunit protein uS7 Blochmanniella pennsylvanica (strain BPEN)
Q057A0 8.73e-87 253 76 0 156 3 rpsG Small ribosomal subunit protein uS7 Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q89A66 7.49e-82 241 78 0 156 3 rpsG Small ribosomal subunit protein uS7 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8D3H3 3.71e-81 239 73 0 156 3 rpsG Small ribosomal subunit protein uS7 Wigglesworthia glossinidia brevipalpis
Q0VSL9 3.55e-80 236 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q7VRN8 2.34e-79 234 72 1 157 3 rpsG Small ribosomal subunit protein uS7 Blochmanniella floridana
A6W396 4.14e-79 234 71 1 157 3 rpsG Small ribosomal subunit protein uS7 Marinomonas sp. (strain MWYL1)
Q1R0H9 2.84e-77 229 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q3K5Y4 7.07e-77 228 73 1 157 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas fluorescens (strain Pf0-1)
Q21M90 1.28e-76 228 69 0 156 3 rpsG Small ribosomal subunit protein uS7 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
C1DKK8 1.59e-76 227 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q3J8R0 2.49e-76 227 69 0 156 3 rpsG Small ribosomal subunit protein uS7 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A1TYJ3 2.84e-76 227 69 0 156 3 rpsG Small ribosomal subunit protein uS7 Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A9IJ08 3.31e-76 226 67 0 156 3 rpsG Small ribosomal subunit protein uS7 Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B1JDW8 3.7e-76 226 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas putida (strain W619)
Q88QN9 3.7e-76 226 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KK63 3.7e-76 226 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas putida (strain GB-1)
A5VXP3 3.7e-76 226 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A4XZ94 3.7e-76 226 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas mendocina (strain ymp)
Q1IFX0 3.7e-76 226 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas entomophila (strain L48)
Q4K529 4.55e-76 226 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q889X5 5.08e-76 226 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
C3K2Y0 8.78e-76 225 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas fluorescens (strain SBW25)
Q48D32 8.78e-76 225 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1H4P1 8.78e-76 225 67 0 156 3 rpsG Small ribosomal subunit protein uS7 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q4ZMP0 8.98e-76 225 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas syringae pv. syringae (strain B728a)
Q9HWD1 2.13e-75 224 70 0 156 1 rpsG Small ribosomal subunit protein uS7 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02T84 2.13e-75 224 70 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V640 2.13e-75 224 70 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas aeruginosa (strain LESB58)
A6UZI4 2.13e-75 224 70 0 156 3 rpsG Small ribosomal subunit protein uS7 Pseudomonas aeruginosa (strain PA7)
A1WVC6 2.51e-75 224 68 2 159 3 rpsG Small ribosomal subunit protein uS7 Halorhodospira halophila (strain DSM 244 / SL1)
B8GV62 2.69e-75 224 69 1 156 3 rpsG Small ribosomal subunit protein uS7 Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q7VTD6 2.87e-75 224 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W2F9 2.87e-75 224 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WRC8 2.87e-75 224 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2S908 3.13e-75 224 68 0 156 3 rpsG Small ribosomal subunit protein uS7 Hahella chejuensis (strain KCTC 2396)
Q2L2H3 3.46e-75 224 67 0 156 3 rpsG Small ribosomal subunit protein uS7 Bordetella avium (strain 197N)
A4VHM6 1.15e-74 223 71 0 156 3 rpsG Small ribosomal subunit protein uS7 Stutzerimonas stutzeri (strain A1501)
B0V8Y4 1.95e-74 222 68 0 156 3 rpsG Small ribosomal subunit protein uS7 Acinetobacter baumannii (strain AYE)
A3M305 1.95e-74 222 68 0 156 3 rpsG Small ribosomal subunit protein uS7 Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VTG4 1.95e-74 222 68 0 156 3 rpsG Small ribosomal subunit protein uS7 Acinetobacter baumannii (strain SDF)
B7I7S0 1.95e-74 222 68 0 156 1 rpsG Small ribosomal subunit protein uS7 Acinetobacter baumannii (strain AB0057)
B7GYM9 1.95e-74 222 68 0 156 3 rpsG Small ribosomal subunit protein uS7 Acinetobacter baumannii (strain AB307-0294)
Q0ABH9 2.93e-74 221 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q7NQE9 3.53e-74 221 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q6FDS7 1.42e-73 220 67 0 156 3 rpsG Small ribosomal subunit protein uS7 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A4SUV7 1.75e-73 219 67 0 156 3 rpsG Small ribosomal subunit protein uS7 Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
C5BQ42 2.43e-73 219 67 0 156 3 rpsG Small ribosomal subunit protein uS7 Teredinibacter turnerae (strain ATCC 39867 / T7901)
B1XSP7 2.65e-73 219 67 0 156 3 rpsG Small ribosomal subunit protein uS7 Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A5WGL1 2.68e-73 219 68 1 157 3 rpsG Small ribosomal subunit protein uS7 Psychrobacter sp. (strain PRwf-1)
Q4FQG4 2.8e-73 219 68 1 157 3 rpsG Small ribosomal subunit protein uS7 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1Q8P0 3.19e-73 219 68 1 157 3 rpsG Small ribosomal subunit protein uS7 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q13TG6 3.41e-73 219 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Paraburkholderia xenovorans (strain LB400)
B2T755 3.41e-73 219 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B2JIH0 3.41e-73 219 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q3A6Q1 1.26e-72 218 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A4JAN6 1.46e-72 217 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q1BRU4 1.46e-72 217 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia orbicola (strain AU 1054)
B1JU18 1.46e-72 217 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia orbicola (strain MC0-3)
Q39KH1 1.46e-72 217 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BJ50 1.46e-72 217 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B4E5B6 1.46e-72 217 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K3M1 1.46e-72 217 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia cenocepacia (strain HI2424)
B1YRC6 1.46e-72 217 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia ambifaria (strain MC40-6)
Q3SLQ3 1.56e-72 217 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Thiobacillus denitrificans (strain ATCC 25259)
Q21RV4 1.58e-72 217 66 1 157 3 rpsG Small ribosomal subunit protein uS7 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B5ELX5 2.76e-72 216 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J463 2.76e-72 216 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A5EX67 3.33e-72 216 67 0 156 3 rpsG Small ribosomal subunit protein uS7 Dichelobacter nodosus (strain VCS1703A)
Q5F5S2 3.8e-72 216 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1KRG9 4.33e-72 216 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P66614 4.33e-72 216 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P66613 4.33e-72 216 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M3X1 4.33e-72 216 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Neisseria meningitidis serogroup C (strain 053442)
P35642 4.62e-72 216 68 1 157 3 rpsG Small ribosomal subunit protein uS7 Eikenella corrodens
Q2SU23 5.88e-72 216 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63Q07 5.88e-72 216 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia pseudomallei (strain K96243)
A3NEI3 5.88e-72 216 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia pseudomallei (strain 668)
Q3JMQ8 5.88e-72 216 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia pseudomallei (strain 1710b)
A3P0B7 5.88e-72 216 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia pseudomallei (strain 1106a)
A1V8A7 5.88e-72 216 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia mallei (strain SAVP1)
Q62GK1 5.88e-72 216 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia mallei (strain ATCC 23344)
A2S7H2 5.88e-72 216 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia mallei (strain NCTC 10229)
A3MRV0 5.88e-72 216 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia mallei (strain NCTC 10247)
A9ADI9 5.88e-72 216 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Burkholderia multivorans (strain ATCC 17616 / 249)
Q1LI28 9.32e-72 215 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1VIP6 1.06e-71 215 65 1 157 3 rpsG Small ribosomal subunit protein uS7 Polaromonas naphthalenivorans (strain CJ2)
B3R7T2 1.68e-71 214 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B1Y7G8 1.78e-71 214 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
C1DAR3 1.9e-71 214 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Laribacter hongkongensis (strain HLHK9)
Q0AIJ9 2.17e-71 214 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q2YB01 3.4e-71 214 66 0 156 3 rpsG Small ribosomal subunit protein uS7 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q46WD9 4e-71 214 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0K610 4e-71 214 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5P336 4.98e-71 213 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q12GX5 7.39e-71 213 64 1 157 3 rpsG Small ribosomal subunit protein uS7 Polaromonas sp. (strain JS666 / ATCC BAA-500)
B2UEM3 7.89e-71 213 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Ralstonia pickettii (strain 12J)
Q8XV09 7.89e-71 213 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q82T69 1.03e-70 213 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q31IY6 1.16e-70 213 66 1 157 3 rpsG Small ribosomal subunit protein uS7 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A2SLG1 1.25e-70 213 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B9KL87 2.05e-70 212 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A4WVL2 2.05e-70 212 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q3J5S6 2.05e-70 212 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PGJ3 2.05e-70 212 65 0 156 3 rpsG1 Small ribosomal subunit protein uS7A/uS7B Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
O50564 2.52e-70 212 65 0 156 3 rpsG Small ribosomal subunit protein uS7 Thiomonas delicata
A1WHC1 2.97e-70 211 65 1 157 3 rpsG Small ribosomal subunit protein uS7 Verminephrobacter eiseniae (strain EF01-2)
A0LII7 4.71e-70 211 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A6T3K8 8.14e-70 210 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Janthinobacterium sp. (strain Marseille)
A5FZW8 1.09e-69 210 63 1 158 3 rpsG Small ribosomal subunit protein uS7 Acidiphilium cryptum (strain JF-5)
C5CP59 1.21e-69 210 64 1 157 3 rpsG Small ribosomal subunit protein uS7 Variovorax paradoxus (strain S110)
Q47JA7 2.6e-69 209 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Dechloromonas aromatica (strain RCB)
A4G9U2 2.84e-69 209 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Herminiimonas arsenicoxydans
A1TJ03 3.27e-69 209 64 1 157 3 rpsG Small ribosomal subunit protein uS7 Paracidovorax citrulli (strain AAC00-1)
B3PK33 3.94e-69 209 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Cellvibrio japonicus (strain Ueda107)
A7HBL5 4.03e-69 209 63 0 156 3 rpsG Small ribosomal subunit protein uS7 Anaeromyxobacter sp. (strain Fw109-5)
A1W2Q3 4.59e-69 208 64 1 157 3 rpsG Small ribosomal subunit protein uS7 Acidovorax sp. (strain JS42)
B9MB69 4.59e-69 208 64 1 157 3 rpsG Small ribosomal subunit protein uS7 Acidovorax ebreus (strain TPSY)
B4UB96 7.12e-69 208 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Anaeromyxobacter sp. (strain K)
B8J857 7.12e-69 208 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A1KB31 7.69e-69 208 63 0 156 3 rpsG Small ribosomal subunit protein uS7 Azoarcus sp. (strain BH72)
Q5WZL6 8.65e-69 208 62 2 174 3 rpsG Small ribosomal subunit protein uS7 Legionella pneumophila (strain Lens)
Q5ZYP7 8.65e-69 208 62 2 174 3 rpsG Small ribosomal subunit protein uS7 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IHR8 8.65e-69 208 62 2 174 3 rpsG Small ribosomal subunit protein uS7 Legionella pneumophila (strain Corby)
Q5X863 8.65e-69 208 62 2 174 3 rpsG Small ribosomal subunit protein uS7 Legionella pneumophila (strain Paris)
A9ETC1 9.47e-69 207 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Sorangium cellulosum (strain So ce56)
Q2G8Y4 1.03e-68 207 63 0 156 3 rpsG Small ribosomal subunit protein uS7 Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q0BUQ3 1.91e-68 207 63 1 158 3 rpsG Small ribosomal subunit protein uS7 Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A9BPR4 1.99e-68 207 63 1 157 3 rpsG Small ribosomal subunit protein uS7 Delftia acidovorans (strain DSM 14801 / SPH-1)
Q2IJ92 2.25e-68 207 63 0 156 3 rpsG Small ribosomal subunit protein uS7 Anaeromyxobacter dehalogenans (strain 2CP-C)
C4XLW9 2.4e-68 207 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A5V606 2.43e-68 207 64 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q5FTY0 2.83e-68 206 63 1 158 3 rpsG Small ribosomal subunit protein uS7 Gluconobacter oxydans (strain 621H)
A6Q6I5 3.23e-68 206 59 0 154 3 rpsG Small ribosomal subunit protein uS7 Sulfurovum sp. (strain NBC37-1)
A9H3R8 3.72e-68 206 63 1 158 3 rpsG Small ribosomal subunit protein uS7 Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q1D778 3.76e-68 206 62 0 156 3 rpsG Small ribosomal subunit protein uS7 Myxococcus xanthus (strain DK1622)
Q30TP4 4.24e-68 206 60 0 154 3 rpsG Small ribosomal subunit protein uS7 Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q2N9A6 4.68e-68 206 62 0 156 3 rpsG Small ribosomal subunit protein uS7 Erythrobacter litoralis (strain HTCC2594)
Q605A8 8.01e-68 205 64 0 145 3 rpsG Small ribosomal subunit protein uS7 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B8FET8 2.42e-67 204 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Desulfatibacillum aliphaticivorans
A1VEC0 3.05e-67 204 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Nitratidesulfovibrio vulgaris (strain DP4)
Q72CI4 3.05e-67 204 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q39Y10 5.88e-67 203 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A4IJI5 6.28e-67 203 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Geobacillus thermodenitrificans (strain NG80-2)
B8H415 1.34e-66 202 61 1 157 3 rpsG Small ribosomal subunit protein uS7 Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A3K3 1.34e-66 202 61 1 157 3 rpsG Small ribosomal subunit protein uS7 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q890N7 1.41e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium tetani (strain Massachusetts / E88)
A1B022 1.7e-66 202 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Paracoccus denitrificans (strain Pd 1222)
P22744 2.05e-66 202 58 0 156 1 rpsG Small ribosomal subunit protein uS7 Geobacillus stearothermophilus
Q4L3K7 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus haemolyticus (strain JCSC1435)
P66618 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRK6 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P66617 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain MW2)
A8YZP4 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBU1 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain MSSA476)
Q6GJC2 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain MRSA252)
P66616 2.12e-66 202 59 0 156 1 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain N315)
P66615 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QEJ8 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain Newman)
Q5HIC9 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain COL)
A5IQA0 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain JH9)
P48940 2.12e-66 202 59 0 156 1 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ94 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain USA300)
A6TZ23 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain JH1)
A7WYX3 2.12e-66 202 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5NQ67 2.29e-66 202 61 0 156 3 rpsG Small ribosomal subunit protein uS7 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q2RQV6 2.39e-66 201 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B2IK58 2.41e-66 201 61 0 156 3 rpsG Small ribosomal subunit protein uS7 Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
C3KVQ5 2.61e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium botulinum (strain 657 / Type Ba4)
B5EFP6 3.35e-66 201 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
C6E4R1 3.58e-66 201 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Geobacter sp. (strain M21)
B3E7T1 3.7e-66 201 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q49V56 3.82e-66 201 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B6JES9 3.82e-66 201 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q2YSB5 4.13e-66 201 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus aureus (strain bovine RF122 / ET3-1)
B2TIH1 4.51e-66 201 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium botulinum (strain Eklund 17B / Type B)
B2UYA6 4.51e-66 201 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium botulinum (strain Alaska E43 / Type E3)
Q6HPR2 5.67e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63H94 5.67e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus cereus (strain ZK / E33L)
B9IZJ0 5.67e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus cereus (strain Q1)
B7HQU0 5.67e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus cereus (strain AH187)
C1ET35 5.67e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus cereus (strain 03BB102)
Q73FA0 5.67e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JKB5 5.67e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus cereus (strain AH820)
Q81VT4 5.67e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus anthracis
A0R8H6 5.67e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus thuringiensis (strain Al Hakam)
C3LJ78 5.67e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9Q1 5.67e-66 201 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus anthracis (strain A0248)
B8G1W2 5.73e-66 201 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A1ALT7 5.8e-66 201 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q5L401 5.86e-66 201 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Geobacillus kaustophilus (strain HTA426)
B0SUQ5 5.99e-66 201 61 1 157 3 rpsG Small ribosomal subunit protein uS7 Caulobacter sp. (strain K31)
B7GJ63 6.06e-66 201 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q250N6 6.54e-66 201 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Desulfitobacterium hafniense (strain Y51)
Q5LMR3 7.06e-66 200 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
C6C182 8.41e-66 200 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A6LPQ7 8.89e-66 200 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q5WLR6 9.28e-66 200 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Shouchella clausii (strain KSM-K16)
B1KSM9 1.05e-65 200 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium botulinum (strain Loch Maree / Type A3)
A7GJ78 1.05e-65 200 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
C1FMV5 1.05e-65 200 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium botulinum (strain Kyoto / Type A2)
A5I7L0 1.05e-65 200 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZ73 1.05e-65 200 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium botulinum (strain ATCC 19397 / Type A)
C5D3R3 1.11e-65 200 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Geobacillus sp. (strain WCH70)
Q2W2I7 1.13e-65 200 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q98N60 1.32e-65 200 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B8J3F6 1.42e-65 199 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q81J44 1.49e-65 199 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HJ44 1.49e-65 199 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus cereus (strain B4264)
A7GK16 1.55e-65 199 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q1GK43 1.66e-65 199 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Ruegeria sp. (strain TM1040)
Q1GP95 1.77e-65 199 64 0 145 3 rpsG Small ribosomal subunit protein uS7 Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
B6IRQ2 1.95e-65 199 62 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhodospirillum centenum (strain ATCC 51521 / SW)
A5ELN1 2.04e-65 199 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q9PA89 2.36e-65 199 60 1 156 3 rpsG Small ribosomal subunit protein uS7 Xylella fastidiosa (strain 9a5c)
Q160Y2 2.38e-65 199 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B0U5X4 2.49e-65 199 60 1 156 3 rpsG Small ribosomal subunit protein uS7 Xylella fastidiosa (strain M12)
B4R8L2 2.6e-65 199 61 1 157 3 rpsG Small ribosomal subunit protein uS7 Phenylobacterium zucineum (strain HLK1)
B1LWS2 2.81e-65 199 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
B0UHX3 3e-65 199 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Methylobacterium sp. (strain 4-46)
B9DKV6 3.2e-65 199 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Staphylococcus carnosus (strain TM300)
B1IGF8 3.34e-65 199 56 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium botulinum (strain Okra / Type B1)
C0QVZ2 3.49e-65 199 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
B2FQ41 3.69e-65 199 60 1 157 3 rpsG Small ribosomal subunit protein uS7 Stenotrophomonas maltophilia (strain K279a)
B4SKV9 3.69e-65 199 60 1 157 3 rpsG Small ribosomal subunit protein uS7 Stenotrophomonas maltophilia (strain R551-3)
Q65PB1 3.94e-65 198 56 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P59061 4.3e-65 198 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhodobacter capsulatus
Q97EH3 4.96e-65 198 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q3SSX0 5.12e-65 198 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A8LM44 6.24e-65 198 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B8ELG7 6.45e-65 198 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q30Z37 6.59e-65 198 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B9M6U9 6.66e-65 198 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A7Z0N3 6.66e-65 198 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P21469 6.66e-65 198 55 0 156 1 rpsG Small ribosomal subunit protein uS7 Bacillus subtilis (strain 168)
Q87A34 8.57e-65 197 59 1 156 3 rpsG Small ribosomal subunit protein uS7 Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA65 8.57e-65 197 59 1 156 3 rpsG Small ribosomal subunit protein uS7 Xylella fastidiosa (strain M23)
A8F980 8.86e-65 197 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus pumilus (strain SAFR-032)
Q748Y7 1.06e-64 197 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q18CF5 1.16e-64 197 56 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridioides difficile (strain 630)
Q11HP8 1.23e-64 197 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Chelativorans sp. (strain BNC1)
B3QBY4 1.24e-64 197 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhodopseudomonas palustris (strain TIE-1)
Q6N4T3 1.24e-64 197 59 0 156 1 rpsG Small ribosomal subunit protein uS7 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q05HS6 1.4e-64 197 60 1 156 3 rpsG Small ribosomal subunit protein uS7 Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SQQ4 1.4e-64 197 60 1 156 3 rpsG Small ribosomal subunit protein uS7 Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NZY1 1.4e-64 197 60 1 156 3 rpsG Small ribosomal subunit protein uS7 Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
C3MAX6 1.47e-64 197 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2K9M0 1.5e-64 197 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3PW63 1.5e-64 197 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhizobium etli (strain CIAT 652)
B5ZYT1 1.51e-64 197 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A5GAY4 1.65e-64 197 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Geotalea uraniireducens (strain Rf4)
Q8ETY6 1.86e-64 197 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9Z9L8 2.04e-64 197 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A0L5W9 2.1e-64 197 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B9E8Q2 2.37e-64 196 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Macrococcus caseolyticus (strain JCSC5402)
Q89J80 2.45e-64 196 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B9JDS5 2.62e-64 196 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B0U0Z2 2.98e-64 196 61 1 157 3 rpsG Small ribosomal subunit protein uS7 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q8UE14 3.12e-64 196 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q3BWY8 3.15e-64 196 60 1 156 3 rpsG Small ribosomal subunit protein uS7 Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PNS7 3.15e-64 196 60 1 156 3 rpsG Small ribosomal subunit protein uS7 Xanthomonas axonopodis pv. citri (strain 306)
C1F646 3.76e-64 196 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
B1YGU6 3.84e-64 196 56 0 156 3 rpsG Small ribosomal subunit protein uS7 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q8PC53 4.38e-64 196 60 1 156 3 rpsG Small ribosomal subunit protein uS7 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RU86 4.38e-64 196 60 1 156 3 rpsG Small ribosomal subunit protein uS7 Xanthomonas campestris pv. campestris (strain B100)
Q4URD5 4.38e-64 196 60 1 156 3 rpsG Small ribosomal subunit protein uS7 Xanthomonas campestris pv. campestris (strain 8004)
A8ZV54 5.33e-64 196 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q1MPT0 5.45e-64 196 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Lawsonia intracellularis (strain PHE/MN1-00)
P66609 6.08e-64 196 59 0 154 3 rpsG Small ribosomal subunit protein uS7 Helicobacter pylori (strain ATCC 700392 / 26695)
P66610 6.08e-64 196 59 0 154 3 rpsG Small ribosomal subunit protein uS7 Helicobacter pylori (strain J99 / ATCC 700824)
Q1CS70 6.08e-64 196 59 0 154 3 rpsG Small ribosomal subunit protein uS7 Helicobacter pylori (strain HPAG1)
B6JN35 6.08e-64 196 59 0 154 3 rpsG Small ribosomal subunit protein uS7 Helicobacter pylori (strain P12)
Q17VN8 6.08e-64 196 59 0 154 3 rpsG Small ribosomal subunit protein uS7 Helicobacter acinonychis (strain Sheeba)
A9VP73 6.22e-64 196 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus mycoides (strain KBAB4)
B8IS81 6.29e-64 196 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B2UUV7 6.79e-64 195 59 0 154 3 rpsG Small ribosomal subunit protein uS7 Helicobacter pylori (strain Shi470)
Q38UQ8 7.17e-64 195 54 0 156 3 rpsG Small ribosomal subunit protein uS7 Latilactobacillus sakei subsp. sakei (strain 23K)
A9KRZ2 7.49e-64 195 56 0 156 3 rpsG Small ribosomal subunit protein uS7 Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q211E4 8.45e-64 195 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhodopseudomonas palustris (strain BisB18)
Q2IXR4 8.73e-64 195 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhodopseudomonas palustris (strain HaA2)
B1ZLK0 8.83e-64 195 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A9W4P7 9.42e-64 195 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Methylorubrum extorquens (strain PA1)
B7L0Q7 9.42e-64 195 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Methylorubrum extorquens (strain CM4 / NCIMB 13688)
B8DN93 9.53e-64 195 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q1QN34 1.02e-63 195 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q07KL4 1.05e-63 195 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhodopseudomonas palustris (strain BisA53)
A0PXU2 1.05e-63 195 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium novyi (strain NT)
C0ZIH4 1.38e-63 194 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A7HWQ7 1.44e-63 194 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q8G074 1.46e-63 194 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Brucella suis biovar 1 (strain 1330)
B0CH36 1.46e-63 194 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VR10 1.46e-63 194 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
C0RJK5 1.46e-63 194 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Brucella melitensis biotype 2 (strain ATCC 23457)
A9M5Q4 1.46e-63 194 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57CQ4 1.46e-63 194 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Brucella abortus biovar 1 (strain 9-941)
Q2YLZ9 1.46e-63 194 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Brucella abortus (strain 2308)
B2S683 1.46e-63 194 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Brucella abortus (strain S19)
B7IT15 1.94e-63 194 56 0 156 3 rpsG Small ribosomal subunit protein uS7 Bacillus cereus (strain G9842)
A5N4P3 1.96e-63 194 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DYA5 1.96e-63 194 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium kluyveri (strain NBRC 12016)
A6X0B4 2.21e-63 194 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q74L91 2.7e-63 194 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q0ANP6 2.91e-63 194 60 0 156 3 rpsG Small ribosomal subunit protein uS7 Maricaulis maris (strain MCS10)
Q134S5 3.28e-63 194 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhodopseudomonas palustris (strain BisB5)
Q1MIE5 3.43e-63 194 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8YHP4 4.13e-63 193 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5D5I6 4.51e-63 193 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A3DIZ8 5.14e-63 193 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A6U855 5.37e-63 193 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Sinorhizobium medicae (strain WSM419)
Q046C8 5.43e-63 193 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q92QH3 6.54e-63 193 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Rhizobium meliloti (strain 1021)
Q034X7 6.69e-63 193 53 0 156 3 rpsG Small ribosomal subunit protein uS7 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WAM3 6.69e-63 193 53 0 156 3 rpsG Small ribosomal subunit protein uS7 Lacticaseibacillus casei (strain BL23)
Q1WVA1 7.63e-63 192 53 0 156 3 rpsG Small ribosomal subunit protein uS7 Ligilactobacillus salivarius (strain UCC118)
B0TC52 8.7e-63 192 56 0 156 3 rpsG Small ribosomal subunit protein uS7 Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A4J107 8.89e-63 192 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q7MA54 9.6e-63 192 57 0 154 3 rpsG Small ribosomal subunit protein uS7 Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A1USL0 1.29e-62 192 59 0 156 3 rpsG1 Small ribosomal subunit protein uS7A/uS7B Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B5YG51 1.42e-62 192 53 0 156 3 rpsG Small ribosomal subunit protein uS7 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q88XY9 1.44e-62 192 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q3A9R1 1.52e-62 192 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B9KFH0 1.7e-62 192 58 1 155 3 rpsG Small ribosomal subunit protein uS7 Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q0BNT0 1.81e-62 192 60 1 157 3 rpsG Small ribosomal subunit protein uS7 Francisella tularensis subsp. holarctica (strain OSU18)
B9KZZ1 1.87e-62 192 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q7VJ84 1.91e-62 192 56 0 154 3 rpsG Small ribosomal subunit protein uS7 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A9NEN2 2.63e-62 191 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Acholeplasma laidlawii (strain PG-8A)
A6Q1M6 2.96e-62 191 58 1 155 3 rpsG Small ribosomal subunit protein uS7 Nitratiruptor sp. (strain SB155-2)
Q0SQE0 3.27e-62 191 54 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium perfringens (strain SM101 / Type A)
Q8XHS0 3.27e-62 191 54 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium perfringens (strain 13 / Type A)
Q0TMP2 3.27e-62 191 54 0 156 3 rpsG Small ribosomal subunit protein uS7 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q6FZB8 3.49e-62 191 59 0 156 3 rpsG Small ribosomal subunit protein uS7 Bartonella quintana (strain Toulouse)
Q6G2W1 4.49e-62 191 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q0AUH6 4.64e-62 191 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A0ALZ0 5.29e-62 191 52 0 156 3 rpsG Small ribosomal subunit protein uS7 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
P66611 5.29e-62 191 52 0 156 1 rpsG Small ribosomal subunit protein uS7 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DAY5 5.29e-62 191 52 0 156 3 rpsG Small ribosomal subunit protein uS7 Listeria monocytogenes serotype 4a (strain HCC23)
Q71WB7 5.29e-62 191 52 0 156 3 rpsG Small ribosomal subunit protein uS7 Listeria monocytogenes serotype 4b (strain F2365)
C1KZK8 5.29e-62 191 52 0 156 3 rpsG Small ribosomal subunit protein uS7 Listeria monocytogenes serotype 4b (strain CLIP80459)
P66612 5.29e-62 191 52 0 156 3 rpsG Small ribosomal subunit protein uS7 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A4IZT7 5.65e-62 191 59 1 157 3 rpsG Small ribosomal subunit protein uS7 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NHX1 5.65e-62 191 59 1 157 3 rpsG Small ribosomal subunit protein uS7 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
A0Q4I0 5.65e-62 191 59 1 157 3 rpsG Small ribosomal subunit protein uS7 Francisella tularensis subsp. novicida (strain U112)
B2SDY8 5.65e-62 191 59 1 157 3 rpsG Small ribosomal subunit protein uS7 Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A5H3 5.65e-62 191 59 1 157 3 rpsG Small ribosomal subunit protein uS7 Francisella tularensis subsp. holarctica (strain LVS)
A7N9S3 5.65e-62 191 59 1 157 3 rpsG Small ribosomal subunit protein uS7 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q14JC3 5.65e-62 191 59 1 157 3 rpsG Small ribosomal subunit protein uS7 Francisella tularensis subsp. tularensis (strain FSC 198)
Q5HVX7 5.84e-62 191 57 1 155 3 rpsG Small ribosomal subunit protein uS7 Campylobacter jejuni (strain RM1221)
A1VYJ7 5.84e-62 191 57 1 155 3 rpsG Small ribosomal subunit protein uS7 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PI17 5.84e-62 191 57 1 155 3 rpsG Small ribosomal subunit protein uS7 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H4P6 5.84e-62 191 57 1 155 3 rpsG Small ribosomal subunit protein uS7 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FKR6 5.84e-62 191 57 1 155 3 rpsG Small ribosomal subunit protein uS7 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
B9JVN3 5.97e-62 191 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A9IW33 8.38e-62 190 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q04C18 8.85e-62 190 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GBM1 8.85e-62 190 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
B2G8Y1 9.15e-62 190 54 0 156 3 rpsG Small ribosomal subunit protein uS7 Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VLK9 9.15e-62 190 54 0 156 3 rpsG Small ribosomal subunit protein uS7 Limosilactobacillus reuteri (strain DSM 20016)
B9L7J9 9.99e-62 190 57 0 154 3 rpsG Small ribosomal subunit protein uS7 Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q2LQA4 1.05e-61 190 58 0 156 3 rpsG Small ribosomal subunit protein uS7 Syntrophus aciditrophicus (strain SB)
Q8R7V0 1.08e-61 190 57 0 156 3 rpsG Small ribosomal subunit protein uS7 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B8I5N6 1.14e-61 190 53 0 156 3 rpsG Small ribosomal subunit protein uS7 Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
C0MF26 1.45e-61 189 54 0 156 3 rpsG Small ribosomal subunit protein uS7 Streptococcus equi subsp. zooepidemicus (strain H70)
B4U0V8 1.45e-61 189 54 0 156 3 rpsG Small ribosomal subunit protein uS7 Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0M935 1.45e-61 189 54 0 156 3 rpsG Small ribosomal subunit protein uS7 Streptococcus equi subsp. equi (strain 4047)
Q6MJ12 1.62e-61 189 56 1 157 3 rpsG Small ribosomal subunit protein uS7 Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q5FM93 1.69e-61 189 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A8AUR5 1.73e-61 189 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A8YXK2 1.86e-61 189 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Lactobacillus helveticus (strain DPC 4571)
C1CPE4 1.95e-61 189 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Streptococcus pneumoniae (strain Taiwan19F-14)
C1CIF2 1.95e-61 189 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Streptococcus pneumoniae (strain P1031)
C1CC61 1.95e-61 189 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Streptococcus pneumoniae (strain JJA)
Q8CWU6 1.95e-61 189 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2ISJ8 1.95e-61 189 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Streptococcus pneumoniae (strain CGSP14)
B8ZKT9 1.95e-61 189 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1I8Z8 1.95e-61 189 55 0 156 3 rpsG Small ribosomal subunit protein uS7 Streptococcus pneumoniae (strain Hungary19A-6)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_15660
Feature type CDS
Gene rpsG
Product 30S ribosomal protein S7
Location 135745 - 136215 (strand: 1)
Length 471 (nucleotides) / 156 (amino acids)
In genomic island -

Contig

Accession ZDB_531
Length 138641 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1726
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00177 Ribosomal protein S7p/S5e

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0049 Translation, ribosomal structure and biogenesis (J) J Ribosomal protein S7

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02992 small subunit ribosomal protein S7 Ribosome -

Protein Sequence

MPRRRVIGQRKILPDPKFGSELLAKFVNILMVDGKKSTAESIVYTALETLAQRSGKEHLEAFEIALDNVRPTVEVKSRRVGGSTYQVPVEVRPVRRNALAMRWIVEAARKRGDKSMALRLANELSDAAENKGTAVKKREDVHRMAEANKAFAHYRW

Flanking regions ( +/- flanking 50bp)

ATAAACTCATTGAGTTTTGGACAACCCTGAATTAACAACGGAGTATTTCCATGCCACGTCGTCGTGTAATTGGTCAACGTAAAATTCTGCCAGATCCTAAGTTCGGATCAGAGCTGCTGGCCAAATTTGTAAATATCCTGATGGTAGACGGTAAAAAATCTACCGCAGAATCAATCGTATATACCGCGCTTGAGACCCTGGCTCAGCGTTCAGGTAAAGAGCACCTGGAAGCATTCGAAATCGCACTGGATAACGTGCGTCCGACTGTCGAAGTTAAGTCCCGCCGTGTTGGTGGTTCTACTTACCAGGTACCGGTTGAAGTTCGTCCGGTCCGCCGTAATGCATTAGCAATGCGCTGGATCGTTGAAGCTGCCCGTAAACGCGGTGATAAGTCCATGGCTCTGCGCCTGGCAAATGAATTATCCGATGCAGCTGAAAACAAAGGCACTGCCGTTAAGAAACGTGAAGACGTTCACCGTATGGCAGAAGCTAACAAGGCGTTCGCACACTACCGTTGGTAATCAAACCGTAGTGAATTGTGTATAGGGTAGCCGTAAGGCTGCCCGACCAA