Homologs in group_1369

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08475 FBDBKF_08475 100.0 Morganella morganii S1 purA adenylosuccinate synthase
EHELCC_13050 EHELCC_13050 100.0 Morganella morganii S2 purA adenylosuccinate synthase
LHKJJB_13165 LHKJJB_13165 100.0 Morganella morganii S3 purA adenylosuccinate synthase
HKOGLL_11865 HKOGLL_11865 100.0 Morganella morganii S5 purA adenylosuccinate synthase
F4V73_RS09695 F4V73_RS09695 96.8 Morganella psychrotolerans - adenylosuccinate synthase
PMI_RS16770 PMI_RS16770 90.0 Proteus mirabilis HI4320 - adenylosuccinate synthase

Distribution of the homologs in the orthogroup group_1369

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1369

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MAX9 0.0 818 91 0 432 3 purA2 Adenylosuccinate synthetase 2 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4F271 0.0 806 90 0 432 3 purA Adenylosuccinate synthetase Proteus mirabilis (strain HI4320)
C6DFJ2 0.0 789 87 0 432 3 purA Adenylosuccinate synthetase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D072 0.0 786 86 0 432 3 purA Adenylosuccinate synthetase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1JMN3 0.0 783 86 0 432 3 purA Adenylosuccinate synthetase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FB0 0.0 783 86 0 432 3 purA Adenylosuccinate synthetase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRN4 0.0 783 86 0 432 3 purA Adenylosuccinate synthetase Yersinia pestis (strain Pestoides F)
Q1CEG0 0.0 783 86 0 432 3 purA Adenylosuccinate synthetase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYM6 0.0 783 86 0 432 3 purA Adenylosuccinate synthetase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIV7 0.0 783 86 0 432 1 purA Adenylosuccinate synthetase Yersinia pestis
B2K2K4 0.0 783 86 0 432 3 purA Adenylosuccinate synthetase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C105 0.0 783 86 0 432 3 purA Adenylosuccinate synthetase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FMX4 0.0 782 86 0 432 3 purA Adenylosuccinate synthetase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JIS0 0.0 778 86 0 432 3 purA Adenylosuccinate synthetase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B5Y325 0.0 775 86 0 432 3 purA Adenylosuccinate synthetase Klebsiella pneumoniae (strain 342)
A6TH93 0.0 773 86 0 432 3 purA Adenylosuccinate synthetase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q3YUG6 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Shigella sonnei (strain Ss046)
Q328F6 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Shigella dysenteriae serotype 1 (strain Sd197)
Q31TA7 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Shigella boydii serotype 4 (strain Sb227)
B2TY52 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A9MFN5 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7LLV9 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R383 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli (strain UTI89 / UPEC)
B1LQJ7 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli (strain SMS-3-5 / SECEC)
B6I281 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli (strain SE11)
B7NGB1 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A7D4 0.0 771 85 0 432 1 purA Adenylosuccinate synthetase Escherichia coli (strain K12)
B1IT29 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A7D5 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0T9L6 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AJ82 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O1:K1 / APEC
A8A7S2 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O9:H4 (strain HS)
B1XDS8 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli (strain K12 / DH10B)
C4ZR54 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M8T7 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O8 (strain IAI1)
B7MSJ5 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O81 (strain ED1a)
B7NTN3 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z2I3 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A7D6 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O157:H7
B7LC36 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli (strain 55989 / EAEC)
B7MKY1 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UQI6 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZV47 0.0 771 85 0 432 3 purA Adenylosuccinate synthetase Escherichia coli O139:H28 (strain E24377A / ETEC)
P65882 0.0 770 85 0 432 3 purA Adenylosuccinate synthetase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65883 0.0 770 85 0 432 3 purA Adenylosuccinate synthetase Salmonella typhi
A9N4Z1 0.0 770 85 0 432 3 purA Adenylosuccinate synthetase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A4W5R8 0.0 769 85 0 432 3 purA Adenylosuccinate synthetase Enterobacter sp. (strain 638)
Q83P33 0.0 769 85 0 432 3 purA Adenylosuccinate synthetase Shigella flexneri
Q0SXA5 0.0 769 85 0 432 3 purA Adenylosuccinate synthetase Shigella flexneri serotype 5b (strain 8401)
B4TSF7 0.0 769 85 0 432 3 purA Adenylosuccinate synthetase Salmonella schwarzengrund (strain CVM19633)
B5BKI5 0.0 769 85 0 432 3 purA Adenylosuccinate synthetase Salmonella paratyphi A (strain AKU_12601)
Q5PL58 0.0 769 85 0 432 3 purA Adenylosuccinate synthetase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T2S2 0.0 769 85 0 432 3 purA Adenylosuccinate synthetase Salmonella newport (strain SL254)
B4TFB1 0.0 769 85 0 432 3 purA Adenylosuccinate synthetase Salmonella heidelberg (strain SL476)
B5R9C3 0.0 769 85 0 432 3 purA Adenylosuccinate synthetase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R0P3 0.0 769 85 0 432 3 purA Adenylosuccinate synthetase Salmonella enteritidis PT4 (strain P125109)
B5FRN3 0.0 769 85 0 432 3 purA Adenylosuccinate synthetase Salmonella dublin (strain CT_02021853)
B5F392 0.0 768 85 0 432 3 purA Adenylosuccinate synthetase Salmonella agona (strain SL483)
C0Q6D4 0.0 768 84 0 432 3 purA Adenylosuccinate synthetase Salmonella paratyphi C (strain RKS4594)
Q57GL4 0.0 766 84 0 432 3 purA Adenylosuccinate synthetase Salmonella choleraesuis (strain SC-B67)
A8AMM3 0.0 765 84 0 432 3 purA Adenylosuccinate synthetase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A8G8V4 0.0 764 84 0 432 3 purA Adenylosuccinate synthetase Serratia proteamaculans (strain 568)
O31047 0.0 763 85 0 432 3 purA Adenylosuccinate synthetase Edwardsiella ictaluri (strain 93-146)
A7MM94 0.0 759 83 0 432 3 purA Adenylosuccinate synthetase Cronobacter sakazakii (strain ATCC BAA-894)
B2VCW8 0.0 758 84 0 432 3 purA Adenylosuccinate synthetase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NW58 0.0 749 82 0 432 3 purA Adenylosuccinate synthetase Sodalis glossinidius (strain morsitans)
Q65S32 0.0 694 75 0 432 3 purA Adenylosuccinate synthetase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P57889 0.0 692 75 0 432 3 purA Adenylosuccinate synthetase Pasteurella multocida (strain Pm70)
A5UCM6 0.0 689 74 0 432 3 purA Adenylosuccinate synthetase Haemophilus influenzae (strain PittEE)
B0BQ12 0.0 689 74 0 432 3 purA Adenylosuccinate synthetase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H1V8 0.0 689 74 0 432 3 purA Adenylosuccinate synthetase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q4QL68 0.0 688 74 0 432 3 purA Adenylosuccinate synthetase Haemophilus influenzae (strain 86-028NP)
A3N181 0.0 688 74 0 432 3 purA Adenylosuccinate synthetase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A5F534 0.0 687 74 0 432 3 purA Adenylosuccinate synthetase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P45283 0.0 687 74 0 432 3 purA Adenylosuccinate synthetase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UIZ2 0.0 687 74 0 432 3 purA Adenylosuccinate synthetase Haemophilus influenzae (strain PittGG)
C3LRR4 0.0 686 74 0 432 3 purA Adenylosuccinate synthetase Vibrio cholerae serotype O1 (strain M66-2)
Q9KNX8 0.0 686 74 0 432 3 purA Adenylosuccinate synthetase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B0UW92 0.0 686 75 0 430 3 purA Adenylosuccinate synthetase Histophilus somni (strain 2336)
A3QI59 0.0 685 76 0 430 3 purA Adenylosuccinate synthetase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B8F8E6 0.0 684 74 0 432 3 purA Adenylosuccinate synthetase Glaesserella parasuis serovar 5 (strain SH0165)
B8CIP5 0.0 684 75 0 430 3 purA Adenylosuccinate synthetase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q8EAG5 0.0 684 75 0 431 3 purA Adenylosuccinate synthetase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0TUV4 0.0 682 75 0 430 3 purA Adenylosuccinate synthetase Shewanella halifaxensis (strain HAW-EB4)
A8H8L8 0.0 681 75 0 430 3 purA Adenylosuccinate synthetase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q7VKR5 0.0 679 74 0 432 3 purA Adenylosuccinate synthetase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0I4Q5 0.0 679 74 0 430 3 purA Adenylosuccinate synthetase Histophilus somni (strain 129Pt)
Q1LSQ9 0.0 679 74 0 430 3 purA Adenylosuccinate synthetase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q12RX5 0.0 679 75 0 431 3 purA Adenylosuccinate synthetase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B1KIH9 0.0 678 75 0 430 3 purA Adenylosuccinate synthetase Shewanella woodyi (strain ATCC 51908 / MS32)
P40607 0.0 674 73 1 438 3 purA Adenylosuccinate synthetase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q07XS1 0.0 673 74 0 430 3 purA Adenylosuccinate synthetase Shewanella frigidimarina (strain NCIMB 400)
Q6LM35 0.0 672 74 0 430 3 purA Adenylosuccinate synthetase Photobacterium profundum (strain SS9)
Q7MH07 0.0 672 72 1 438 3 purA Adenylosuccinate synthetase Vibrio vulnificus (strain YJ016)
A6VQD4 0.0 672 72 0 430 3 purA Adenylosuccinate synthetase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q8DCU4 0.0 671 72 1 438 3 purA Adenylosuccinate synthetase Vibrio vulnificus (strain CMCP6)
Q5E2D3 0.0 669 73 1 438 3 purA Adenylosuccinate synthetase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B4S195 0.0 669 74 0 432 3 purA Adenylosuccinate synthetase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q3IEZ3 0.0 667 73 1 436 3 purA1 Adenylosuccinate synthetase 1 Pseudoalteromonas translucida (strain TAC 125)
C4K3C2 0.0 665 71 0 431 3 purA Adenylosuccinate synthetase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A1SA65 0.0 661 72 0 431 3 purA Adenylosuccinate synthetase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q88DD8 0.0 659 72 1 430 3 purA Adenylosuccinate synthetase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KKZ0 0.0 659 72 1 430 3 purA Adenylosuccinate synthetase Pseudomonas putida (strain GB-1)
A5W9S5 0.0 659 72 1 430 3 purA Adenylosuccinate synthetase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1JAI0 0.0 657 72 1 430 3 purA Adenylosuccinate synthetase Pseudomonas putida (strain W619)
A4XPZ3 0.0 657 71 0 430 3 purA Adenylosuccinate synthetase Pseudomonas mendocina (strain ymp)
C4L9M5 0.0 655 71 0 430 3 purA Adenylosuccinate synthetase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q1I454 0.0 655 72 1 430 3 purA Adenylosuccinate synthetase Pseudomonas entomophila (strain L48)
Q48A17 0.0 653 72 0 430 3 purA Adenylosuccinate synthetase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A6VD51 0.0 652 72 1 430 3 purA Adenylosuccinate synthetase Pseudomonas aeruginosa (strain PA7)
Q15ZE1 0.0 652 71 0 431 3 purA Adenylosuccinate synthetase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q4KJ68 0.0 652 71 1 430 3 purA Adenylosuccinate synthetase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9HUM6 0.0 651 72 1 430 3 purA Adenylosuccinate synthetase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02F80 0.0 651 72 1 430 3 purA Adenylosuccinate synthetase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V201 0.0 651 72 1 430 3 purA Adenylosuccinate synthetase Pseudomonas aeruginosa (strain LESB58)
Q4ZYX5 0.0 648 70 1 430 3 purA Adenylosuccinate synthetase Pseudomonas syringae pv. syringae (strain B728a)
Q48NZ7 0.0 648 70 1 430 3 purA Adenylosuccinate synthetase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q87VJ9 0.0 647 70 1 430 3 purA Adenylosuccinate synthetase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5QW95 0.0 647 71 0 430 3 purA Adenylosuccinate synthetase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1SZK6 0.0 641 68 1 437 3 purA Adenylosuccinate synthetase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
C1DLQ8 0.0 631 70 1 430 3 purA Adenylosuccinate synthetase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q3KIY4 0.0 620 68 1 430 3 purA Adenylosuccinate synthetase Pseudomonas fluorescens (strain Pf0-1)
C3KDW8 0.0 620 68 1 430 3 purA Adenylosuccinate synthetase Pseudomonas fluorescens (strain SBW25)
Q1QY21 0.0 617 68 1 430 3 purA Adenylosuccinate synthetase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
C5BRH0 0.0 616 69 1 430 3 purA Adenylosuccinate synthetase Teredinibacter turnerae (strain ATCC 39867 / T7901)
B8GND3 0.0 607 67 1 431 3 purA Adenylosuccinate synthetase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q2SBC8 0.0 605 67 0 432 3 purA Adenylosuccinate synthetase Hahella chejuensis (strain KCTC 2396)
Q21HA8 0.0 602 66 1 431 3 purA Adenylosuccinate synthetase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q3SL57 0.0 593 66 1 430 3 purA Adenylosuccinate synthetase Thiobacillus denitrificans (strain ATCC 25259)
Q0VMF3 0.0 584 66 1 430 3 purA Adenylosuccinate synthetase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A6VYL0 0.0 578 65 0 430 3 purA Adenylosuccinate synthetase Marinomonas sp. (strain MWYL1)
Q1QD25 0.0 577 65 2 432 3 purA Adenylosuccinate synthetase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A1U4C0 0.0 577 64 1 430 3 purA Adenylosuccinate synthetase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q606N8 0.0 575 63 1 432 3 purA Adenylosuccinate synthetase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q4FTX2 0.0 574 64 2 432 3 purA Adenylosuccinate synthetase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q5WZ56 0.0 570 63 0 430 3 purA Adenylosuccinate synthetase Legionella pneumophila (strain Lens)
Q5X7Q5 0.0 569 63 0 430 3 purA Adenylosuccinate synthetase Legionella pneumophila (strain Paris)
A5IHA9 0.0 567 63 0 430 3 purA Adenylosuccinate synthetase Legionella pneumophila (strain Corby)
Q8RNM2 0.0 565 62 0 430 1 purA Adenylosuccinate synthetase Legionella pneumophila
Q5ZY86 0.0 565 62 0 430 3 purA Adenylosuccinate synthetase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q0AHF5 0.0 565 61 1 431 3 purA Adenylosuccinate synthetase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0AB55 0.0 563 62 1 432 3 purA Adenylosuccinate synthetase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A5WGF9 0.0 563 62 2 432 3 purA Adenylosuccinate synthetase Psychrobacter sp. (strain PRwf-1)
Q82V29 0.0 558 61 1 431 3 purA Adenylosuccinate synthetase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q494F3 0.0 558 59 0 432 3 purA Adenylosuccinate synthetase Blochmanniella pennsylvanica (strain BPEN)
Q3J808 0.0 554 62 1 430 3 purA Adenylosuccinate synthetase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A1WUT0 0.0 553 64 2 432 3 purA Adenylosuccinate synthetase Halorhodospira halophila (strain DSM 244 / SL1)
Q2YBX2 0.0 553 60 2 435 3 purA Adenylosuccinate synthetase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B2SNJ3 0.0 550 61 1 430 3 purA Adenylosuccinate synthetase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q5H4F2 0.0 548 61 1 430 3 purA Adenylosuccinate synthetase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P782 0.0 548 61 1 430 3 purA Adenylosuccinate synthetase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q3BWF4 0.0 548 61 1 430 3 purA Adenylosuccinate synthetase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PNB5 0.0 548 61 1 430 3 purA Adenylosuccinate synthetase Xanthomonas axonopodis pv. citri (strain 306)
Q8PBR6 0.0 547 61 1 430 3 purA Adenylosuccinate synthetase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RYD5 0.0 547 61 1 430 3 purA Adenylosuccinate synthetase Xanthomonas campestris pv. campestris (strain B100)
Q4URT6 0.0 547 61 1 430 3 purA Adenylosuccinate synthetase Xanthomonas campestris pv. campestris (strain 8004)
Q6FCS7 0.0 545 63 3 441 3 purA Adenylosuccinate synthetase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A4G4L2 0.0 541 61 2 432 3 purA Adenylosuccinate synthetase Herminiimonas arsenicoxydans
B4SS80 0.0 540 62 1 430 3 purA Adenylosuccinate synthetase Stenotrophomonas maltophilia (strain R551-3)
A1AWH8 0.0 537 58 3 441 3 purA Adenylosuccinate synthetase Ruthia magnifica subsp. Calyptogena magnifica
A4SYD1 0.0 537 59 2 441 3 purA Adenylosuccinate synthetase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A5CWQ5 0.0 534 58 2 439 3 purA Adenylosuccinate synthetase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B1XU85 0.0 533 59 2 441 3 purA Adenylosuccinate synthetase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q9PG47 0.0 531 59 1 430 3 purA Adenylosuccinate synthetase Xylella fastidiosa (strain 9a5c)
Q8K916 0.0 531 59 2 431 3 purA Adenylosuccinate synthetase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q7VQP1 0.0 530 58 1 437 3 purA Adenylosuccinate synthetase Blochmanniella floridana
B0U498 0.0 529 59 1 430 3 purA Adenylosuccinate synthetase Xylella fastidiosa (strain M12)
Q46ZJ3 0.0 529 60 2 439 3 purA1 Adenylosuccinate synthetase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q87B33 0.0 528 59 1 430 3 purA Adenylosuccinate synthetase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I7V8 0.0 528 59 1 430 3 purA Adenylosuccinate synthetase Xylella fastidiosa (strain M23)
Q1LLK1 0.0 527 60 2 437 3 purA Adenylosuccinate synthetase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q31GN4 0.0 527 62 2 437 3 purA Adenylosuccinate synthetase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q39FS0 0.0 526 60 2 437 3 purA1 Adenylosuccinate synthetase 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q63US2 0.0 525 61 2 437 3 purA Adenylosuccinate synthetase Burkholderia pseudomallei (strain K96243)
A3NA42 0.0 525 61 2 437 3 purA Adenylosuccinate synthetase Burkholderia pseudomallei (strain 668)
A3NVV9 0.0 525 61 2 437 3 purA Adenylosuccinate synthetase Burkholderia pseudomallei (strain 1106a)
B2U9W0 0.0 525 60 2 437 3 purA Adenylosuccinate synthetase Ralstonia pickettii (strain 12J)
Q3JRR4 0.0 524 60 2 437 3 purA Adenylosuccinate synthetase Burkholderia pseudomallei (strain 1710b)
A1V4I9 0.0 524 60 2 437 3 purA Adenylosuccinate synthetase Burkholderia mallei (strain SAVP1)
Q62JX6 0.0 524 60 2 437 3 purA Adenylosuccinate synthetase Burkholderia mallei (strain ATCC 23344)
A2S2B3 0.0 524 60 2 437 3 purA Adenylosuccinate synthetase Burkholderia mallei (strain NCTC 10229)
A3MK63 0.0 524 60 2 437 3 purA Adenylosuccinate synthetase Burkholderia mallei (strain NCTC 10247)
B6J083 0.0 523 58 1 428 3 purA Adenylosuccinate synthetase Coxiella burnetii (strain CbuG_Q212)
B6J734 0.0 523 58 1 428 3 purA Adenylosuccinate synthetase Coxiella burnetii (strain CbuK_Q154)
A9KCC7 0.0 522 58 1 428 3 purA Adenylosuccinate synthetase Coxiella burnetii (strain Dugway 5J108-111)
B2SXR9 0.0 522 59 2 437 3 purA Adenylosuccinate synthetase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q8Y019 0.0 521 59 2 437 3 purA Adenylosuccinate synthetase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q83CV4 0.0 521 58 1 428 3 purA Adenylosuccinate synthetase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NCS8 0.0 521 58 1 428 3 purA Adenylosuccinate synthetase Coxiella burnetii (strain RSA 331 / Henzerling II)
Q2SWD3 0.0 521 60 2 437 1 purA Adenylosuccinate synthetase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q47BS7 0.0 520 59 3 435 3 purA Adenylosuccinate synthetase Dechloromonas aromatica (strain RCB)
P57629 0.0 520 58 1 430 3 purA Adenylosuccinate synthetase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8D0 0.0 520 58 1 430 3 purA Adenylosuccinate synthetase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q7NS98 0.0 520 59 1 430 3 purA2 Adenylosuccinate synthetase 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B8D887 0.0 519 58 1 430 3 purA Adenylosuccinate synthetase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
Q13X40 0.0 518 59 2 437 3 purA Adenylosuccinate synthetase Paraburkholderia xenovorans (strain LB400)
B9TAD0 0.0 517 59 4 441 3 PURA1 Adenylosuccinate synthetase 1, chloroplastic Ricinus communis
B2JIU0 0.0 516 59 2 437 3 purA Adenylosuccinate synthetase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q1H0Y6 7.3e-179 509 57 4 441 3 purA Adenylosuccinate synthetase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A1K400 8.52e-179 509 59 3 437 3 purA Adenylosuccinate synthetase Azoarcus sp. (strain BH72)
A9IK82 2.46e-178 508 58 1 430 3 purA Adenylosuccinate synthetase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2KYA7 5.45e-178 507 59 1 430 3 purA Adenylosuccinate synthetase Bordetella avium (strain 197N)
P52151 1.58e-177 506 60 1 425 3 purA Adenylosuccinate synthetase Acidithiobacillus ferrooxidans
Q9JV25 2.52e-177 505 57 1 431 3 purA Adenylosuccinate synthetase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A5EVE1 9.06e-177 504 57 2 425 3 purA Adenylosuccinate synthetase Dichelobacter nodosus (strain VCS1703A)
Q5P7C4 9.23e-177 504 58 3 437 3 purA Adenylosuccinate synthetase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q21W39 1.55e-176 504 56 4 453 3 purA Adenylosuccinate synthetase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A1KT71 8.16e-176 501 57 1 431 3 purA Adenylosuccinate synthetase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M3P7 1.99e-175 501 57 1 431 3 purA Adenylosuccinate synthetase Neisseria meningitidis serogroup C (strain 053442)
B9MFY7 3.59e-175 501 57 5 457 3 purA Adenylosuccinate synthetase Acidovorax ebreus (strain TPSY)
A9BMU3 4.18e-175 501 56 4 457 3 purA Adenylosuccinate synthetase Delftia acidovorans (strain DSM 14801 / SPH-1)
A2SHA4 5.7e-175 500 57 4 439 3 purA Adenylosuccinate synthetase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q12AC9 7.85e-175 499 59 3 438 3 purA Adenylosuccinate synthetase Polaromonas sp. (strain JS666 / ATCC BAA-500)
C5CXH7 9.92e-175 499 57 3 438 3 purA Adenylosuccinate synthetase Variovorax paradoxus (strain S110)
Q8D322 1.15e-174 499 54 2 429 3 purA Adenylosuccinate synthetase Wigglesworthia glossinidia brevipalpis
Q9K012 1.88e-174 498 57 1 431 3 purA Adenylosuccinate synthetase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1W588 2.12e-174 499 57 5 457 3 purA Adenylosuccinate synthetase Acidovorax sp. (strain JS42)
B4RK98 8e-174 496 57 1 431 3 purA Adenylosuccinate synthetase Neisseria gonorrhoeae (strain NCCP11945)
Q5F9J5 1.04e-173 496 57 1 431 3 purA Adenylosuccinate synthetase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1VNG5 1.6e-173 496 59 3 438 3 purA Adenylosuccinate synthetase Polaromonas naphthalenivorans (strain CJ2)
A1WMN5 7.96e-172 493 55 4 453 3 purA Adenylosuccinate synthetase Verminephrobacter eiseniae (strain EF01-2)
A1TM37 1.95e-171 491 56 5 453 3 purA Adenylosuccinate synthetase Paracidovorax citrulli (strain AAC00-1)
Q7VWM1 3.22e-167 480 57 1 431 3 purA Adenylosuccinate synthetase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WHP1 3.29e-167 480 57 1 431 3 purA Adenylosuccinate synthetase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W6Q7 5.86e-167 479 57 1 431 3 purA Adenylosuccinate synthetase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A0L7T9 1.52e-166 478 55 3 432 3 purA Adenylosuccinate synthetase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
P59428 5.48e-165 474 53 1 427 3 purA Adenylosuccinate synthetase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
C6DZQ7 1.28e-164 473 55 2 428 3 purA Adenylosuccinate synthetase Geobacter sp. (strain M21)
B5ECF3 1.32e-164 473 54 2 429 3 purA Adenylosuccinate synthetase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q6AN65 1.77e-164 473 53 3 430 3 purA Adenylosuccinate synthetase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A5GC19 7e-164 471 54 2 430 3 purA Adenylosuccinate synthetase Geotalea uraniireducens (strain Rf4)
A1ALC9 3.67e-163 469 53 2 428 3 purA Adenylosuccinate synthetase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B9M1R2 6.84e-163 469 53 2 430 3 purA Adenylosuccinate synthetase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A0LHR1 2.61e-162 467 53 2 428 3 purA Adenylosuccinate synthetase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
C0QB49 1.06e-160 463 53 3 428 3 purA Adenylosuccinate synthetase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q747F9 2.99e-160 462 53 2 428 3 purA Adenylosuccinate synthetase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B8FB83 2.49e-159 459 53 3 428 3 purA Adenylosuccinate synthetase Desulfatibacillum aliphaticivorans
B3EAS4 5.01e-159 459 53 3 428 3 purA Adenylosuccinate synthetase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B6ITA0 1.16e-158 458 53 3 429 3 purA Adenylosuccinate synthetase Rhodospirillum centenum (strain ATCC 51521 / SW)
Q39QK1 3.98e-158 456 53 2 428 3 purA Adenylosuccinate synthetase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q2LSI8 4.79e-156 451 52 1 430 3 purA Adenylosuccinate synthetase Syntrophus aciditrophicus (strain SB)
A8I1V7 1.55e-155 450 53 3 430 3 purA Adenylosuccinate synthetase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q11DJ4 2.06e-155 450 53 4 430 3 purA Adenylosuccinate synthetase Chelativorans sp. (strain BNC1)
Q3A828 1.23e-154 447 53 2 429 3 purA Adenylosuccinate synthetase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A7HDA9 2.79e-154 447 53 2 430 3 purA Adenylosuccinate synthetase Anaeromyxobacter sp. (strain Fw109-5)
Q6N1V9 9.97e-154 445 53 3 430 3 purA Adenylosuccinate synthetase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A7GJL2 1.24e-153 445 51 2 424 3 purA Adenylosuccinate synthetase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IHP2 1.24e-153 445 51 2 424 3 purA Adenylosuccinate synthetase Clostridium botulinum (strain Okra / Type B1)
A0QLW6 1.24e-153 445 52 3 429 3 purA Adenylosuccinate synthetase Mycobacterium avium (strain 104)
B3Q6W6 1.54e-153 445 53 3 430 3 purA Adenylosuccinate synthetase Rhodopseudomonas palustris (strain TIE-1)
C3KWG8 1.77e-153 445 50 2 424 3 purA Adenylosuccinate synthetase Clostridium botulinum (strain 657 / Type Ba4)
Q2RVD8 1.79e-153 445 52 4 429 3 purA Adenylosuccinate synthetase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
C1FNL8 2.09e-153 444 51 2 424 3 purA Adenylosuccinate synthetase Clostridium botulinum (strain Kyoto / Type A2)
Q98F97 2.34e-153 444 53 4 430 3 purA Adenylosuccinate synthetase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A5I7Y9 3.37e-153 444 51 2 424 3 purA Adenylosuccinate synthetase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZF9 3.37e-153 444 51 2 424 3 purA Adenylosuccinate synthetase Clostridium botulinum (strain ATCC 19397 / Type A)
Q2W2D1 5.39e-153 443 52 4 428 3 purA Adenylosuccinate synthetase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q24MC6 5.74e-153 443 52 2 427 3 purA Adenylosuccinate synthetase Desulfitobacterium hafniense (strain Y51)
B8G0I5 5.8e-153 443 52 2 427 3 purA Adenylosuccinate synthetase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B2HPW4 9.54e-153 443 51 3 425 3 purA Adenylosuccinate synthetase Mycobacterium marinum (strain ATCC BAA-535 / M)
C6BRT2 1.06e-152 442 52 3 424 3 purA Adenylosuccinate synthetase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B9JRD7 1.21e-152 442 52 4 431 3 purA Adenylosuccinate synthetase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q07J18 1.73e-152 442 52 3 430 3 purA Adenylosuccinate synthetase Rhodopseudomonas palustris (strain BisA53)
Q73T50 1.74e-152 442 52 3 429 3 purA Adenylosuccinate synthetase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q20Z24 2.57e-152 442 52 3 430 3 purA Adenylosuccinate synthetase Rhodopseudomonas palustris (strain BisB18)
Q0S555 2.77e-152 442 52 3 425 3 purA Adenylosuccinate synthetase Rhodococcus jostii (strain RHA1)
Q89EM1 3.26e-152 441 53 3 430 3 purA Adenylosuccinate synthetase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B1KU85 4.13e-152 441 50 2 424 3 purA Adenylosuccinate synthetase Clostridium botulinum (strain Loch Maree / Type A3)
B4UGW9 4.29e-152 441 53 2 430 3 purA Adenylosuccinate synthetase Anaeromyxobacter sp. (strain K)
Q5LTU4 4.42e-152 441 52 3 428 3 purA Adenylosuccinate synthetase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q3A8S5 4.91e-152 441 52 2 426 3 purA Adenylosuccinate synthetase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8UCN6 5.34e-152 441 52 4 431 3 purA Adenylosuccinate synthetase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1MCS2 6.29e-152 441 52 4 431 3 purA Adenylosuccinate synthetase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2IQF7 7.57e-152 441 53 2 430 3 purA Adenylosuccinate synthetase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q3SNC6 7.88e-152 441 51 3 430 3 purA Adenylosuccinate synthetase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B8JDH9 8.26e-152 441 53 2 430 3 purA Adenylosuccinate synthetase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A8ZTF0 9.17e-152 440 51 3 428 3 purA Adenylosuccinate synthetase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
C1AWU5 1.15e-151 440 52 3 425 3 purA Adenylosuccinate synthetase Rhodococcus opacus (strain B4)
B5ZMS8 1.85e-151 440 52 4 431 3 purA Adenylosuccinate synthetase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q1D936 2.34e-151 439 52 3 433 3 purA Adenylosuccinate synthetase Myxococcus xanthus (strain DK1622)
Q317B9 2.36e-151 439 52 3 424 3 purA Adenylosuccinate synthetase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
P9WHN3 4.83e-151 439 51 3 425 1 purA Adenylosuccinate synthetase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHN2 4.83e-151 439 51 3 425 3 purA Adenylosuccinate synthetase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5TZ84 4.83e-151 439 51 3 425 3 purA Adenylosuccinate synthetase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AK32 4.83e-151 439 51 3 425 3 purA Adenylosuccinate synthetase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KFH8 4.83e-151 439 51 3 425 3 purA Adenylosuccinate synthetase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P65881 4.83e-151 439 51 3 425 3 purA Adenylosuccinate synthetase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B1M1K0 5.55e-151 438 51 3 429 3 purA Adenylosuccinate synthetase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q5YNL6 6.52e-151 438 51 3 425 3 purA Adenylosuccinate synthetase Nocardia farcinica (strain IFM 10152)
Q28MG6 9.58e-151 438 51 4 429 3 purA Adenylosuccinate synthetase Jannaschia sp. (strain CCS1)
A0QQH7 1.01e-150 438 51 3 429 1 purA Adenylosuccinate synthetase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q5FQZ9 1.09e-150 437 54 4 430 3 purA Adenylosuccinate synthetase Gluconobacter oxydans (strain 621H)
C3MI14 1.14e-150 437 51 4 431 3 purA Adenylosuccinate synthetase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q1GVU1 1.92e-150 437 51 4 428 3 purA Adenylosuccinate synthetase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q2NCV0 1.92e-150 437 51 4 428 3 purA Adenylosuccinate synthetase Erythrobacter litoralis (strain HTCC2594)
Q92MA5 1.97e-150 437 51 4 431 3 purA Adenylosuccinate synthetase Rhizobium meliloti (strain 1021)
A0PS01 2.42e-150 437 51 3 425 3 purA Adenylosuccinate synthetase Mycobacterium ulcerans (strain Agy99)
Q0BTV7 2.78e-150 437 52 4 429 3 purA Adenylosuccinate synthetase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B0T890 3.49e-150 436 52 6 429 3 purA Adenylosuccinate synthetase Caulobacter sp. (strain K31)
Q1QP77 4.35e-150 436 50 3 430 3 purA Adenylosuccinate synthetase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A6WY94 4.44e-150 436 52 4 428 3 purA Adenylosuccinate synthetase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q2K4X9 7.2e-150 436 51 4 431 3 purA Adenylosuccinate synthetase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3PY13 8.11e-150 436 52 4 431 3 purA Adenylosuccinate synthetase Rhizobium etli (strain CIAT 652)
A5VS40 8.82e-150 435 52 4 428 3 purA Adenylosuccinate synthetase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A1T2W5 9.04e-150 435 51 3 429 3 purA Adenylosuccinate synthetase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q1BEP8 1.01e-149 435 51 3 425 3 purA Adenylosuccinate synthetase Mycobacterium sp. (strain MCS)
A1UA84 1.01e-149 435 51 3 425 3 purA Adenylosuccinate synthetase Mycobacterium sp. (strain KMS)
Q2J0H0 1.06e-149 435 52 3 430 3 purA Adenylosuccinate synthetase Rhodopseudomonas palustris (strain HaA2)
O69595 1.09e-149 435 52 3 425 3 purA Adenylosuccinate synthetase Mycobacterium leprae (strain TN)
B8ZU80 1.09e-149 435 52 3 425 3 purA Adenylosuccinate synthetase Mycobacterium leprae (strain Br4923)
Q2G4V4 1.13e-149 435 51 4 428 3 purA Adenylosuccinate synthetase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A3PTT9 1.24e-149 435 51 3 425 3 purA Adenylosuccinate synthetase Mycobacterium sp. (strain JLS)
B1MIV1 1.58e-149 435 50 3 425 3 purA Adenylosuccinate synthetase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
P65879 2.43e-149 434 52 4 428 3 purA Adenylosuccinate synthetase Brucella suis biovar 1 (strain 1330)
P65878 2.43e-149 434 52 4 428 3 purA Adenylosuccinate synthetase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0REU7 2.43e-149 434 52 4 428 3 purA Adenylosuccinate synthetase Brucella melitensis biotype 2 (strain ATCC 23457)
A9M7I3 2.43e-149 434 52 4 428 3 purA Adenylosuccinate synthetase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
P0C115 2.43e-149 434 52 4 428 3 purA Adenylosuccinate synthetase Brucella abortus biovar 1 (strain 9-941)
Q2YQI5 2.43e-149 434 52 4 428 3 purA Adenylosuccinate synthetase Brucella abortus (strain 2308)
Q2RG43 2.7e-149 434 52 2 426 3 purA Adenylosuccinate synthetase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
C0ZTG3 2.92e-149 434 51 3 425 3 purA Adenylosuccinate synthetase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q1GF65 4.47e-149 434 51 6 436 3 purA Adenylosuccinate synthetase Ruegeria sp. (strain TM1040)
A9WWG0 8.6e-149 433 52 4 428 3 purA Adenylosuccinate synthetase Brucella suis (strain ATCC 23445 / NCTC 10510)
B8H3C9 1.04e-148 432 51 6 429 3 purA Adenylosuccinate synthetase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A3U9 1.04e-148 432 51 6 429 3 purA Adenylosuccinate synthetase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A4T142 1.35e-148 432 50 3 425 3 purA Adenylosuccinate synthetase Mycolicibacterium gilvum (strain PYR-GCK)
A6UCR6 1.49e-148 432 51 4 431 3 purA Adenylosuccinate synthetase Sinorhizobium medicae (strain WSM419)
A3PL98 1.77e-148 432 51 3 429 3 purA Adenylosuccinate synthetase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B9KKA7 2.01e-148 432 51 3 429 3 purA Adenylosuccinate synthetase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A5ED09 2.53e-148 432 51 3 430 3 purA Adenylosuccinate synthetase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A0PXA8 2.66e-148 431 49 3 422 3 purA Adenylosuccinate synthetase Clostridium novyi (strain NT)
A9HLQ1 3.18e-148 431 53 4 430 3 purA Adenylosuccinate synthetase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q3J0Z3 5.03e-148 431 51 3 429 3 purA Adenylosuccinate synthetase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B0K5I0 7.25e-148 430 49 2 425 3 purA Adenylosuccinate synthetase Thermoanaerobacter sp. (strain X514)
B0K8D7 7.25e-148 430 49 2 425 3 purA Adenylosuccinate synthetase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B8IPM5 9.56e-148 430 51 3 429 3 purA Adenylosuccinate synthetase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q97D87 1.38e-147 430 50 2 424 3 purA Adenylosuccinate synthetase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A5N4D3 1.56e-147 429 48 2 424 3 purA Adenylosuccinate synthetase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B1Z962 2.78e-147 429 51 3 429 3 purA Adenylosuccinate synthetase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A8LIN4 4.31e-147 429 51 5 430 3 purA Adenylosuccinate synthetase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A7HV25 5.23e-147 428 50 4 430 3 purA Adenylosuccinate synthetase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A4FQK6 6.21e-147 428 50 3 422 3 purA Adenylosuccinate synthetase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
B5YKK9 8.49e-147 427 51 2 426 3 purA Adenylosuccinate synthetase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A0LWT8 8.71e-147 427 49 1 423 3 purA Adenylosuccinate synthetase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
B7L289 9.02e-147 427 50 3 429 3 purA Adenylosuccinate synthetase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A5VFF3 9.31e-147 427 50 4 428 3 purA Adenylosuccinate synthetase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A4WQW4 1.32e-146 427 50 3 429 3 purA Adenylosuccinate synthetase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q168S1 2.43e-146 427 50 5 430 3 purA Adenylosuccinate synthetase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6MN06 2.46e-146 427 49 3 429 3 purA Adenylosuccinate synthetase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
C0ZA40 2.48e-146 426 49 2 423 3 purA Adenylosuccinate synthetase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A4Z0B8 2.54e-146 426 50 3 430 3 purA Adenylosuccinate synthetase Bradyrhizobium sp. (strain ORS 278)
B0UJ78 3.16e-146 426 51 3 429 3 purA Adenylosuccinate synthetase Methylobacterium sp. (strain 4-46)
A1AZM1 4.1e-146 426 50 3 428 3 purA Adenylosuccinate synthetase Paracoccus denitrificans (strain Pd 1222)
Q47KH7 7.85e-146 425 51 2 423 3 purA Adenylosuccinate synthetase Thermobifida fusca (strain YX)
B0TA52 1.24e-145 425 49 2 427 3 purA Adenylosuccinate synthetase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A8FJC0 1.37e-145 425 49 2 427 3 purA Adenylosuccinate synthetase Bacillus pumilus (strain SAFR-032)
Q6G4G5 2.88e-145 424 52 4 428 3 purA Adenylosuccinate synthetase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
B8DVC2 3.2e-145 424 48 2 427 3 purA Adenylosuccinate synthetase Bifidobacterium animalis subsp. lactis (strain AD011)
Q9X8P6 3.42e-145 424 49 2 420 3 purA Adenylosuccinate synthetase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q026Q7 3.97e-145 424 50 3 424 3 purA Adenylosuccinate synthetase Solibacter usitatus (strain Ellin6076)
A8LDR3 4.69e-145 423 51 2 424 3 purA Adenylosuccinate synthetase Parafrankia sp. (strain EAN1pec)
Q03TS9 5.77e-145 423 49 3 430 3 purA Adenylosuccinate synthetase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
A4ITU9 5.77e-145 423 48 2 427 3 purA Adenylosuccinate synthetase Geobacillus thermodenitrificans (strain NG80-2)
Q131X4 6.45e-145 423 50 3 430 3 purA Adenylosuccinate synthetase Rhodopseudomonas palustris (strain BisB5)
A1V9U1 8.34e-145 422 50 4 425 3 purA Adenylosuccinate synthetase Nitratidesulfovibrio vulgaris (strain DP4)
Q5KU76 1.46e-144 422 48 2 427 3 purA Adenylosuccinate synthetase Geobacillus kaustophilus (strain HTA426)
A4W440 1.52e-144 422 48 2 429 3 purA Adenylosuccinate synthetase Streptococcus suis (strain 98HAH33)
A4J9P7 1.77e-144 422 50 2 427 3 purA Adenylosuccinate synthetase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q8DW14 1.91e-144 422 49 2 423 3 purA Adenylosuccinate synthetase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A0ZZG5 2.04e-144 422 48 2 427 3 purA Adenylosuccinate synthetase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
C5D9W9 2.09e-144 422 48 2 427 3 purA Adenylosuccinate synthetase Geobacillus sp. (strain WCH70)
B4RDX2 2.33e-144 421 53 6 429 3 purA Adenylosuccinate synthetase Phenylobacterium zucineum (strain HLK1)
A7ZAP4 2.6e-144 421 48 2 429 3 purA Adenylosuccinate synthetase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q0RBA3 3.63e-144 421 51 2 424 3 purA Adenylosuccinate synthetase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q82ER6 4.66e-144 421 50 2 420 3 purA Adenylosuccinate synthetase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q725K9 5.37e-144 421 50 4 425 3 purA Adenylosuccinate synthetase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q5HK16 7.53e-144 420 48 2 423 3 purA Adenylosuccinate synthetase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B0JXF6 7.75e-144 421 50 2 427 3 purA Adenylosuccinate synthetase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q8CQK1 8.04e-144 420 48 2 423 3 purA Adenylosuccinate synthetase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9K5R0 9.58e-144 420 49 2 427 3 purA Adenylosuccinate synthetase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5WAI0 1.05e-143 420 48 2 427 3 purA Adenylosuccinate synthetase Shouchella clausii (strain KSM-K16)
Q839Y4 1.27e-143 420 48 2 423 3 purA Adenylosuccinate synthetase Enterococcus faecalis (strain ATCC 700802 / V583)
Q2J4S8 1.43e-143 419 51 2 424 3 purA Adenylosuccinate synthetase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q8XH63 1.56e-143 419 49 3 424 3 purA Adenylosuccinate synthetase Clostridium perfringens (strain 13 / Type A)
B9DT31 2.17e-143 419 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q4FN13 2.24e-143 419 49 3 430 3 purA Adenylosuccinate synthetase Pelagibacter ubique (strain HTCC1062)
B7JXN4 2.25e-143 420 50 2 427 3 purA Adenylosuccinate synthetase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q5M2A7 2.32e-143 419 49 2 423 3 purA Adenylosuccinate synthetase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXQ5 2.32e-143 419 49 2 423 3 purA Adenylosuccinate synthetase Streptococcus thermophilus (strain CNRZ 1066)
C3PJK0 2.7e-143 419 49 2 424 3 purA Adenylosuccinate synthetase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q03IE5 3.51e-143 419 49 2 423 3 purA Adenylosuccinate synthetase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
B8EK29 3.63e-143 419 51 4 429 3 purA Adenylosuccinate synthetase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
A9IQ57 3.95e-143 418 51 4 428 3 purA Adenylosuccinate synthetase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q8R6T8 4.5e-143 418 50 2 424 3 purA Adenylosuccinate synthetase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B2TRE4 4.6e-143 418 49 2 420 3 purA Adenylosuccinate synthetase Clostridium botulinum (strain Eklund 17B / Type B)
P65888 4.7e-143 418 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P65887 4.7e-143 418 48 2 423 1 purA Adenylosuccinate synthetase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZJJ5 4.7e-143 418 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q04N48 4.7e-143 418 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q1MRW8 4.7e-143 418 48 5 428 3 purA Adenylosuccinate synthetase Lawsonia intracellularis (strain PHE/MN1-00)
B2V1S6 5.78e-143 418 49 2 420 3 purA Adenylosuccinate synthetase Clostridium botulinum (strain Alaska E43 / Type E3)
B8DQ18 8.46e-143 417 50 3 424 3 purA Adenylosuccinate synthetase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q9CE93 8.95e-143 417 49 1 423 3 purA Adenylosuccinate synthetase Lactococcus lactis subsp. lactis (strain IL1403)
B0CBU2 9.26e-143 418 49 2 427 3 purA Adenylosuccinate synthetase Acaryochloris marina (strain MBIC 11017)
Q88SV6 9.75e-143 417 49 2 423 3 purA Adenylosuccinate synthetase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B1VMC3 9.84e-143 417 49 2 420 3 purA Adenylosuccinate synthetase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q65CR5 1.03e-142 417 48 2 427 3 purA Adenylosuccinate synthetase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A1URK5 1.52e-142 417 50 4 428 3 purA Adenylosuccinate synthetase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q8FMB0 1.7e-142 417 48 2 428 3 purA Adenylosuccinate synthetase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q6G1A4 2.18e-142 416 51 4 428 3 purA Adenylosuccinate synthetase Bartonella quintana (strain Toulouse)
B1XIL5 2.28e-142 417 50 2 427 3 purA Adenylosuccinate synthetase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q10ZD0 2.37e-142 417 48 2 427 3 purA Adenylosuccinate synthetase Trichodesmium erythraeum (strain IMS101)
A7GVN0 2.38e-142 416 48 2 427 3 purA Adenylosuccinate synthetase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B9J8Q9 2.72e-142 416 50 5 431 3 purA Adenylosuccinate synthetase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
O67321 2.75e-142 416 50 6 429 3 purA Adenylosuccinate synthetase Aquifex aeolicus (strain VF5)
Q02WK8 2.87e-142 416 49 1 423 3 purA Adenylosuccinate synthetase Lactococcus lactis subsp. cremoris (strain SK11)
B1I6P8 3.06e-142 416 51 4 429 3 purA Adenylosuccinate synthetase Desulforudis audaxviator (strain MP104C)
B7GT29 3.33e-142 416 47 2 427 3 purA Adenylosuccinate synthetase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q8P2U1 3.77e-142 416 49 2 423 3 purA Adenylosuccinate synthetase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XE45 3.77e-142 416 49 2 423 3 purA Adenylosuccinate synthetase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
B5XJH8 5.51e-142 416 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pyogenes serotype M49 (strain NZ131)
C4L014 6.21e-142 415 47 2 429 3 purA Adenylosuccinate synthetase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
B2ICM9 6.22e-142 416 50 5 430 3 purA Adenylosuccinate synthetase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q0BXJ3 6.49e-142 415 48 3 429 3 purA Adenylosuccinate synthetase Hyphomonas neptunium (strain ATCC 15444)
Q6GKS8 9.17e-142 415 48 2 425 3 purA Adenylosuccinate synthetase Staphylococcus aureus (strain MRSA252)
P99099 9.17e-142 415 48 2 425 1 purA Adenylosuccinate synthetase Staphylococcus aureus (strain N315)
P65884 9.17e-142 415 48 2 425 3 purA Adenylosuccinate synthetase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A2RN80 9.3e-142 415 49 1 423 3 purA Adenylosuccinate synthetase Lactococcus lactis subsp. cremoris (strain MG1363)
Q8NYX6 9.37e-142 415 48 2 425 3 purA Adenylosuccinate synthetase Staphylococcus aureus (strain MW2)
Q6GD73 9.37e-142 415 48 2 425 3 purA Adenylosuccinate synthetase Staphylococcus aureus (strain MSSA476)
Q5HJX8 9.37e-142 415 48 2 425 3 purA Adenylosuccinate synthetase Staphylococcus aureus (strain COL)
Q8G6T9 1.08e-141 415 47 2 427 3 purA Adenylosuccinate synthetase Bifidobacterium longum (strain NCC 2705)
B2J8B7 1.11e-141 415 49 2 427 3 purA Adenylosuccinate synthetase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B3DNT3 1.34e-141 414 47 2 427 3 purA Adenylosuccinate synthetase Bifidobacterium longum (strain DJO10A)
Q4LAK0 1.4e-141 414 48 2 423 3 purA Adenylosuccinate synthetase Staphylococcus haemolyticus (strain JCSC1435)
C0MAE4 1.41e-141 414 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus equi subsp. equi (strain 4047)
Q8YMZ0 1.75e-141 415 49 2 427 3 purA Adenylosuccinate synthetase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A8AZM9 1.77e-141 414 47 2 423 3 purA Adenylosuccinate synthetase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P0DD55 1.93e-141 414 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DD54 1.93e-141 414 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q0ATY3 2.07e-141 414 50 4 422 3 purA Adenylosuccinate synthetase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q48VK8 2.59e-141 414 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JIX0 2.59e-141 414 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q3MBG1 2.65e-141 414 49 2 427 3 purA Adenylosuccinate synthetase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q1J8S0 2.92e-141 414 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q5N1D4 2.95e-141 414 49 2 427 3 purA Adenylosuccinate synthetase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
B1VHT9 3.04e-141 414 47 2 424 3 purA Adenylosuccinate synthetase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
Q31KI0 3.04e-141 414 49 2 427 3 purA Adenylosuccinate synthetase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A4QHG2 3.11e-141 414 48 2 424 3 purA Adenylosuccinate synthetase Corynebacterium glutamicum (strain R)
A3CQU5 3.95e-141 413 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus sanguinis (strain SK36)
Q8EKX9 4.41e-141 413 47 2 427 3 purA Adenylosuccinate synthetase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8NM16 4.56e-141 413 48 2 424 3 purA Adenylosuccinate synthetase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q9A1P8 5.42e-141 413 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pyogenes serotype M1
C0MFY0 9.04e-141 412 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus equi subsp. zooepidemicus (strain H70)
Q6A6A3 9.74e-141 412 48 2 427 3 purA Adenylosuccinate synthetase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q3APK8 1.03e-140 412 49 1 420 3 purA Adenylosuccinate synthetase Chlorobium chlorochromatii (strain CaD3)
B7KCX9 1.23e-140 413 48 2 427 3 purA Adenylosuccinate synthetase Gloeothece citriformis (strain PCC 7424)
Q1JNS3 2.46e-140 411 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pyogenes serotype M12 (strain MGAS9429)
B8I5L3 2.7e-140 411 49 2 419 3 purA Adenylosuccinate synthetase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q4JXT3 3.23e-140 411 47 2 424 3 purA Adenylosuccinate synthetase Corynebacterium jeikeium (strain K411)
A2RCA2 3.8e-140 411 48 2 423 3 purA Adenylosuccinate synthetase Streptococcus pyogenes serotype M5 (strain Manfredo)
B8J4N1 4.71e-140 410 48 2 423 3 purA Adenylosuccinate synthetase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q7M7V8 4.72e-140 410 49 5 422 3 purA Adenylosuccinate synthetase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P73290 6.69e-140 410 50 2 430 3 purA Adenylosuccinate synthetase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A5CY74 1.16e-139 409 49 2 422 3 purA Adenylosuccinate synthetase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q8DLG2 1.62e-139 410 51 2 427 3 purA Adenylosuccinate synthetase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B2GEZ1 1.82e-139 409 49 2 426 3 purA Adenylosuccinate synthetase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B1WSJ0 1.99e-139 409 48 2 427 3 purA Adenylosuccinate synthetase Crocosphaera subtropica (strain ATCC 51142 / BH68)
A5G293 2.42e-139 409 50 4 428 3 purA Adenylosuccinate synthetase Acidiphilium cryptum (strain JF-5)
Q2JQX5 2.98e-139 409 49 2 427 3 purA Adenylosuccinate synthetase Synechococcus sp. (strain JA-3-3Ab)
B8D1A3 5.65e-139 408 53 2 421 3 purA Adenylosuccinate synthetase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A9BEC8 6.55e-139 408 48 2 427 3 purA Adenylosuccinate synthetase Prochlorococcus marinus (strain MIT 9211)
Q9RHX5 9.85e-139 407 50 2 427 3 purA Adenylosuccinate synthetase Corynebacterium ammoniagenes
A6M3K0 1.09e-138 407 50 2 420 3 purA Adenylosuccinate synthetase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A4SCU2 1.53e-138 407 48 1 420 3 purA Adenylosuccinate synthetase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
P96771 1.84e-138 400 75 1 260 3 purA Adenylosuccinate synthetase (Fragment) Aggregatibacter actinomycetemcomitans
C0R2E2 2.53e-138 406 46 2 427 3 purA Adenylosuccinate synthetase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
B3EGV7 3.85e-138 406 46 2 437 3 purA Adenylosuccinate synthetase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q1WRH2 4.93e-138 405 47 2 423 3 purA Adenylosuccinate synthetase Ligilactobacillus salivarius (strain UCC118)
A2C7N3 5.24e-138 405 48 2 427 3 purA Adenylosuccinate synthetase Prochlorococcus marinus (strain MIT 9303)
P65886 5.26e-138 405 47 2 423 3 purA Adenylosuccinate synthetase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65885 5.26e-138 405 47 2 423 3 purA Adenylosuccinate synthetase Streptococcus agalactiae serotype III (strain NEM316)
Q7V6A8 9.11e-138 405 48 2 427 3 purA Adenylosuccinate synthetase Prochlorococcus marinus (strain MIT 9313)
A7I328 1e-137 404 48 6 427 3 purA Adenylosuccinate synthetase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B3QQZ0 1.22e-137 405 46 3 439 3 purA Adenylosuccinate synthetase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A0JSA1 1.76e-137 404 47 2 424 3 purA Adenylosuccinate synthetase Arthrobacter sp. (strain FB24)
A3DK09 2.07e-137 404 46 2 421 3 purA Adenylosuccinate synthetase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q3JZ68 3.1e-137 403 47 2 423 3 purA Adenylosuccinate synthetase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3ALR7 3.79e-137 404 48 2 427 3 purA Adenylosuccinate synthetase Synechococcus sp. (strain CC9605)
A1BJ01 4.17e-137 403 48 1 420 3 purA Adenylosuccinate synthetase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q7VD77 5.08e-137 403 47 2 427 3 purA Adenylosuccinate synthetase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B4SC75 5.3e-137 403 47 2 433 3 purA Adenylosuccinate synthetase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B2GL12 7.4e-137 402 49 2 424 3 purA Adenylosuccinate synthetase Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q5NLU9 1.16e-136 402 49 4 428 3 purA Adenylosuccinate synthetase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A0AEN2 1.47e-136 402 48 2 424 3 purA Adenylosuccinate synthetase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q3B6D0 1.54e-136 402 48 1 420 3 purA Adenylosuccinate synthetase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q03W69 2.61e-136 401 48 5 424 3 purA Adenylosuccinate synthetase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q8KAK6 2.99e-136 401 46 3 439 3 purA Adenylosuccinate synthetase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8YAR1 3.32e-136 401 48 2 424 3 purA Adenylosuccinate synthetase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6NF38 3.7e-136 400 46 2 428 3 purA Adenylosuccinate synthetase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_13390
Feature type CDS
Gene purA
Product adenylosuccinate synthase
Location 86652 - 87989 (strand: -1)
Length 1338 (nucleotides) / 445 (amino acids)

Contig

Accession ZDB_528
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1369
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00709 Adenylosuccinate synthetase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0104 Nucleotide transport and metabolism (F) F Adenylosuccinate synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MLESFFKQPGKNEMGKNVVVLGTQWGDEGKGKIVDLLTERAKYVVRYQGGHNAGHTLVINGEKTVLHLIPSGILRENVVSIIANGVVLAPDALLKEMTALEERGVPVRERLLISEACPLILPYHVALDNAREKARGAKAIGTTGRGIGPAYEDKVARRGLRVGDLFDKETFAQKLKEILEYHNFQLVNYYKEPAVDYQKTLDEIMAVADILTGMVVDVSDLLYKATVNGELVMFEGAQGTLLDIDHGTYPYVTSSNTTAGGVATGSGLGPRYVDYVLGIIKAYSTRVGAGPFPTELFDETGEYLRTKGQEFGATTGRSRRCGWLDIIAIRRAVQINSLSGFCMTKLDVLDGLKEVKVCVGYRLPNGEIIETTPLAADNWEGIEPIYEVMPGWTETTFGAKSREELPQAALDYIRRIEELTGVPVDIISTGPDRSETMILRDPFDA

Flanking regions ( +/- flanking 50bp)

CAGGTGACTTTCATAAAGTGGATAAAAAGTGCTGAAAGGGCGGTCATGAGATGCTAGAATCCTTTTTTAAGCAACCAGGTAAAAACGAAATGGGTAAGAACGTTGTCGTATTGGGCACCCAATGGGGTGACGAGGGCAAGGGCAAAATCGTCGACTTGCTGACTGAACGGGCTAAGTATGTTGTTCGTTATCAAGGTGGCCACAACGCGGGTCACACTCTGGTTATCAACGGTGAGAAAACCGTCCTGCATTTAATTCCGTCAGGTATTCTCCGCGAAAACGTCGTCAGCATCATTGCTAACGGTGTTGTACTCGCACCCGATGCACTGCTGAAAGAAATGACTGCACTGGAAGAGCGTGGTGTTCCGGTGCGCGAACGTCTGCTGATTTCTGAAGCATGTCCGCTGATCCTCCCTTATCATGTTGCGCTGGATAATGCCCGTGAGAAAGCACGCGGTGCGAAAGCTATCGGCACAACAGGACGCGGTATCGGGCCTGCATACGAAGATAAAGTTGCCCGTCGCGGTCTGCGCGTGGGTGATCTCTTCGATAAAGAGACCTTCGCTCAGAAACTGAAAGAAATCCTTGAGTATCACAACTTCCAGTTAGTGAACTACTACAAAGAGCCTGCGGTTGACTATCAGAAAACCCTGGACGAAATCATGGCAGTTGCGGATATCCTGACCGGTATGGTTGTGGATGTCTCTGATCTGCTGTACAAAGCCACCGTTAACGGTGAGCTGGTGATGTTTGAAGGCGCGCAGGGTACACTGCTGGATATCGACCACGGTACCTATCCGTATGTGACTTCCTCAAACACCACTGCCGGCGGTGTTGCCACCGGTTCCGGTTTAGGTCCGCGTTATGTGGATTATGTTCTGGGTATCATCAAAGCTTACTCCACCCGCGTGGGTGCCGGTCCGTTCCCGACCGAACTGTTTGATGAAACCGGTGAATACCTGCGTACCAAAGGCCAGGAGTTCGGTGCGACCACCGGACGCAGCCGTCGTTGCGGCTGGCTGGACATCATTGCTATCCGCCGCGCTGTGCAGATCAACTCCCTGTCAGGGTTCTGCATGACCAAGCTGGATGTGCTGGATGGTCTGAAAGAAGTGAAAGTGTGTGTCGGTTACCGTTTACCGAATGGTGAAATCATCGAAACCACACCACTGGCTGCGGATAACTGGGAAGGCATCGAGCCTATCTATGAAGTGATGCCGGGCTGGACTGAAACCACCTTCGGGGCGAAGAGCCGCGAAGAACTGCCTCAGGCAGCACTGGATTACATCCGCCGCATTGAAGAACTGACAGGCGTTCCTGTTGATATTATTTCAACCGGTCCGGATCGTTCTGAAACGATGATCCTGCGCGACCCGTTCGACGCATAAGATCGTTCAGGTGATACCAGTCAGGGCCGGGCATGTTTGTCCGGCCTTTT