Homologs in group_3250

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05065 FBDBKF_05065 100.0 Morganella morganii S1 - Osmotically-inducible lipoprotein B
EHELCC_12525 EHELCC_12525 100.0 Morganella morganii S2 - Osmotically-inducible lipoprotein B
LHKJJB_12725 LHKJJB_12725 100.0 Morganella morganii S3 - Osmotically-inducible lipoprotein B
HKOGLL_11340 HKOGLL_11340 100.0 Morganella morganii S5 - Osmotically-inducible lipoprotein B

Distribution of the homologs in the orthogroup group_3250

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3250

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37723 1.5e-05 41 55 0 67 2 osmB Osmotically-inducible lipoprotein B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0ADB0 1.73e-05 41 55 0 67 3 osmB Osmotically-inducible lipoprotein B Shigella flexneri
P0ADA7 1.73e-05 41 55 0 67 2 osmB Osmotically-inducible lipoprotein B Escherichia coli (strain K12)
P0ADA8 1.73e-05 41 55 0 67 3 osmB Osmotically-inducible lipoprotein B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ADA9 1.73e-05 41 55 0 67 3 osmB Osmotically-inducible lipoprotein B Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_12865
Feature type CDS
Gene -
Product Osmotically-inducible lipoprotein B
Location 161360 - 161566 (strand: -1)
Length 207 (nucleotides) / 68 (amino acids)
In genomic island -

Contig

Accession ZDB_527
Length 181446 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3250
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04062 osmotically inducible lipoprotein OsmB - -

Protein Sequence

MKKIVTALLVAGGLLALSGCKNLSEQEKDTAIGAELGAISGAILTDGSGLGTVGGAAVGGIIGHEAGQ

Flanking regions ( +/- flanking 50bp)

TAACGTGATTGCTATAGTGATGCTAATCAGACATGCAGCGGGGAAATAAGATGAAGAAAATAGTAACGGCTTTGCTTGTCGCCGGTGGCCTGCTGGCACTCAGCGGCTGTAAGAACCTGTCAGAGCAGGAGAAAGATACCGCAATTGGTGCTGAGTTAGGTGCTATCAGCGGCGCAATTCTGACGGACGGATCCGGTTTGGGTACAGTGGGTGGTGCTGCCGTCGGCGGGATTATCGGCCACGAAGCCGGCCAGTAATGAAGGCGTCCGGATGGACGCCTTATCTCTCTGTCAGCCGCCTGCCAGTT