Homologs in group_3422

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13725 FBDBKF_13725 100.0 Morganella morganii S1 lysR DNA-binding transcriptional regulator, LysR family
EHELCC_11395 EHELCC_11395 100.0 Morganella morganii S2 lysR DNA-binding transcriptional regulator, LysR family
LHKJJB_11600 LHKJJB_11600 100.0 Morganella morganii S3 lysR DNA-binding transcriptional regulator, LysR family
HKOGLL_10210 HKOGLL_10210 100.0 Morganella morganii S5 lysR DNA-binding transcriptional regulator, LysR family

Distribution of the homologs in the orthogroup group_3422

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3422

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P52044 4.4e-11 65 23 1 173 3 ygfI Uncharacterized HTH-type transcriptional regulator YgfI Escherichia coli (strain K12)
P52669 1.15e-10 64 25 4 222 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
P75836 1.21e-10 64 28 6 190 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
P25544 1.87e-10 63 30 5 157 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
P0ACR0 1.92e-10 63 33 2 119 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 1.92e-10 63 33 2 119 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
Q9S4Y7 2.28e-10 63 32 2 119 3 allS HTH-type transcriptional activator AllS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCH2 2.28e-10 63 32 2 119 3 allS HTH-type transcriptional activator AllS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57S50 2.29e-10 63 32 2 119 3 allS HTH-type transcriptional activator AllS Salmonella choleraesuis (strain SC-B67)
Q8FK66 4.35e-10 62 33 2 119 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 4.35e-10 62 33 2 119 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8Z8R3 4.92e-10 62 32 2 119 3 allS HTH-type transcriptional activator AllS Salmonella typhi
Q1RF30 5.01e-10 62 33 2 119 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 5.01e-10 62 33 2 119 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
P27111 4.16e-09 60 28 5 174 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
P30864 6.38e-09 59 25 6 189 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
P37499 6.66e-09 59 28 4 171 3 yybE Uncharacterized HTH-type transcriptional regulator YybE Bacillus subtilis (strain 168)
Q8X4M5 1.33e-08 58 29 4 154 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
P55576 1.34e-08 58 29 1 119 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P0ACR8 2.48e-08 57 42 0 61 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 2.48e-08 57 42 0 61 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
Q47141 2.97e-08 57 39 1 83 1 hcaR Hca operon transcriptional activator HcaR Escherichia coli (strain K12)
P55181 6.65e-08 56 30 4 147 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
Q04778 1.07e-07 55 23 8 271 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
P77333 1.16e-07 55 31 2 121 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
Q06610 1.23e-07 55 42 1 76 3 rbcR RuBisCO operon transcriptional regulator Acidithiobacillus ferrooxidans
Q765S2 1.23e-07 55 29 2 119 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
P37641 1.9e-07 55 28 4 158 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
P0A9F6 7.2e-07 53 25 1 138 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 7.2e-07 53 25 1 138 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 7.2e-07 53 25 1 138 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
P42507 7.25e-07 53 25 2 133 3 hvrB AhcY transcriptional activator HvrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q9JXW7 1.68e-06 52 26 5 192 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P52595 1.92e-06 52 27 3 144 3 cbbR HTH-type transcriptional regulator CbbR Rhodospirillum rubrum
Q9JPU9 2.27e-06 51 24 5 198 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
Q5N5I5 2.37e-06 52 29 2 121 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 2.37e-06 52 29 2 121 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P45349 2.59e-06 51 25 2 147 3 metR HTH-type transcriptional regulator MetR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P46068 4.81e-06 50 43 0 64 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
P52686 4.85e-06 50 44 0 58 3 sdsB SDS degradation transcriptional activation protein Pseudomonas sp. (strain ATCC 19151)
A4QH19 5.05e-06 50 48 0 58 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
Q00678 5.69e-06 50 28 2 125 3 nocR Regulatory protein NocR Agrobacterium fabrum (strain C58 / ATCC 33970)
P42722 8.17e-06 50 33 0 83 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P23841 8.54e-06 50 27 2 118 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
Q01610 1.02e-05 49 35 1 92 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P49518 1.72e-05 49 29 6 178 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
A0T0V5 1.73e-05 49 45 0 62 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
P52696 1.8e-05 48 40 0 59 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
P77559 1.93e-05 48 37 0 64 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
P77744 1.95e-05 48 22 2 143 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
O33945 2.18e-05 48 30 1 103 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
P35112 2.22e-05 48 28 2 125 3 nocR Regulatory protein NocR Agrobacterium tumefaciens (strain T37)
P52670 2.29e-05 48 34 1 81 3 ilvR HTH-type transcriptional regulator IlvR Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P0A2Q2 2.41e-05 48 27 4 148 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q3 2.41e-05 48 27 4 148 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhi
Q05840 3.15e-05 48 37 0 64 3 clcR HTH-type transcriptional regulator ClcR Pseudomonas putida
P42427 3.36e-05 47 35 0 64 3 tfdT HTH-type transcriptional regulator TfdT Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P52666 3.43e-05 48 39 0 64 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
B5FN59 3.78e-05 47 25 3 147 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
P0A2Q0 3.92e-05 47 25 3 147 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 3.92e-05 47 25 3 147 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 3.92e-05 47 25 3 147 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 3.92e-05 47 25 3 147 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 3.92e-05 47 25 3 147 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 3.92e-05 47 25 3 147 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TAZ8 3.92e-05 47 25 3 147 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5EZ22 3.92e-05 47 25 3 147 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
B4TNR5 4.14e-05 47 25 3 147 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)
B4SYF7 4.25e-05 47 25 3 147 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
P0A2Q4 4.27e-05 48 26 4 150 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 4.27e-05 48 26 4 150 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
P05827 4.59e-05 47 26 3 146 3 ilvY HTH-type transcriptional regulator IlvY Escherichia coli (strain K12)
P0A9G1 5.26e-05 47 25 4 154 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 5.26e-05 47 25 4 154 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 5.26e-05 47 25 4 154 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
P52676 5.36e-05 47 24 0 123 3 nmcR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Enterobacter cloacae
P77171 5.85e-05 47 44 0 58 3 ydcI Uncharacterized HTH-type transcriptional regulator YdcI Escherichia coli (strain K12)
P96194 6.3e-05 45 40 2 76 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
P0A4T7 7.49e-05 47 22 2 149 3 pcaQ HTH-type transcriptional regulator PcaQ Rhizobium radiobacter
P0A4T6 7.49e-05 47 22 2 149 3 pcaQ HTH-type transcriptional regulator PcaQ Agrobacterium fabrum (strain C58 / ATCC 33970)
P0ACR2 8.72e-05 47 35 0 65 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli (strain K12)
P0ACR3 8.72e-05 47 35 0 65 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli O157:H7
Q8KA72 9.6e-05 47 26 5 169 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9X5P2 0.000115 46 36 0 60 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
Q1R4H3 0.000152 46 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 0.000152 46 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 0.000152 46 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 0.000152 46 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 0.000152 46 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
O32255 0.000158 46 23 7 206 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
Q57083 0.000165 46 25 2 136 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
B2TU26 0.000173 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LUJ5 0.000176 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NU32 0.000177 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q329U3 0.000179 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B6I4A0 0.000179 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7M5B2 0.000179 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 0.000179 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 0.000179 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 0.000179 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 0.000179 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YVK2 0.000181 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 0.000181 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 0.000181 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 0.000181 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 0.000181 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 0.000181 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 0.000181 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 0.000181 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 0.000181 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 0.000181 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7UMM1 0.000181 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NF72 0.000182 45 40 1 66 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P77309 0.000183 45 40 0 57 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
P45099 0.000193 45 25 5 183 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P52690 0.000226 45 40 0 55 3 cbbR HTH-type transcriptional regulator CbbR Cereibacter sphaeroides
O35038 0.000239 45 28 5 145 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
B1JQ39 0.000325 45 23 8 255 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 0.000325 45 23 8 255 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 0.000325 45 23 8 255 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 0.000325 45 23 8 255 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 0.000325 45 23 8 255 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 0.000325 45 23 8 255 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 0.000325 45 23 8 255 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 0.000325 45 23 8 255 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 0.000325 45 23 8 255 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P77746 0.000351 45 36 0 60 2 ybdO Uncharacterized HTH-type transcriptional regulator YbdO Escherichia coli (strain K12)
P0A4T3 0.000378 45 22 3 170 1 occR Octopine catabolism/uptake operon regulatory protein OccR Rhizobium radiobacter
P0A4T4 0.000378 45 22 3 170 1 occR Octopine catabolism/uptake operon regulatory protein OccR Agrobacterium tumefaciens (strain Ach5)
P52678 0.000415 45 40 0 59 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium leprae (strain TN)
P44876 0.000498 44 26 6 150 3 HI_0775 Uncharacterized HTH-type transcriptional regulator HI_0775 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q46M57 0.000543 44 35 0 64 1 tfdR HTH-type transcriptional regulator TdfR Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46M54 0.000553 44 35 0 64 1 tfdS HTH-type transcriptional regulator TfdS Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P30979 0.000583 44 28 2 141 3 ybeF Uncharacterized HTH-type transcriptional regulator YbeF Escherichia coli (strain K12)
P20668 0.000593 44 36 0 58 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
Q55459 0.000622 44 28 6 164 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0ACR4 0.000624 44 27 3 139 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 0.000624 44 27 3 139 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 0.000624 44 27 3 139 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
P27102 0.000814 43 28 6 186 3 tcbR HTH-type transcriptional regulator TcbR Pseudomonas sp. (strain P51)
P05051 0.000851 43 27 3 132 3 ampR HTH-type transcriptional activator AmpR Enterobacter cloacae

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_11740
Feature type CDS
Gene lysR
Product DNA-binding transcriptional regulator, LysR family
Location 122175 - 123056 (strand: 1)
Length 882 (nucleotides) / 293 (amino acids)

Contig

Accession ZDB_526
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3422
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MFISRQLKQFIAIAENISLTNAAEQLNLTPSALSHGIRELESKTGISLIKRSGQKVSLTTAGTHLYNDLLPYYLQMKNIEDKLSERKGNRISVNVKINGLYCSLIRGKILKFCKERHNIDLSLTSEEQIDIEKEILSNNTDIVISSAIIPDNKNIRYIKLPQEEAGLLVHNDLLSKYGSIQELIKHERLIQKENEVESEIFNTFLKIFFNKNGHCNITRISDACDIPEFISSAAGYSLIAGNNKFIPDMKRKNCSFISLALPYRMTINRRVYFREQCNQPITDLVLKISEANS

Flanking regions ( +/- flanking 50bp)

ATGATAACGACTATACCTTTGTTAATGACATTCCTGCATAGGTTAAAATTATGTTTATTTCAAGGCAGCTCAAACAATTTATTGCTATCGCTGAAAATATCAGCCTGACGAACGCGGCTGAACAACTTAATCTGACACCTTCAGCACTCAGCCATGGCATTCGTGAACTTGAATCTAAAACCGGCATTTCATTAATTAAACGCTCCGGCCAAAAGGTATCACTGACAACCGCAGGTACGCATCTTTACAATGATCTTTTACCTTATTATCTTCAGATGAAAAATATAGAAGATAAATTGTCAGAAAGAAAAGGTAACAGAATATCCGTTAATGTCAAAATTAACGGACTTTATTGTTCGTTAATCAGAGGAAAAATACTTAAATTTTGTAAAGAAAGACATAATATTGATCTATCTCTGACGTCAGAGGAACAAATTGATATTGAAAAAGAAATACTGTCAAACAATACAGATATAGTTATTTCATCAGCTATAATTCCGGATAATAAAAACATCAGATATATAAAACTCCCTCAGGAAGAGGCAGGATTACTTGTTCATAATGACCTGTTATCTAAATATGGTTCAATTCAGGAATTAATTAAACATGAACGTCTCATTCAGAAAGAAAATGAAGTTGAAAGTGAAATATTCAATACATTTTTAAAAATCTTCTTTAACAAAAATGGTCATTGCAATATCACCAGGATATCAGATGCATGTGATATTCCGGAGTTTATTTCTTCCGCTGCGGGTTATAGCCTTATCGCCGGTAATAATAAATTTATTCCTGATATGAAAAGAAAAAACTGTAGTTTTATTTCACTTGCTTTACCTTACCGCATGACTATTAACAGAAGAGTTTACTTCAGAGAACAATGTAATCAGCCAATTACTGACCTGGTATTAAAAATAAGTGAGGCCAATAGTTAACATTATCGCAACAATCGGATAATAAAAAAATGCCCCGAAAACAGGGCATT