Homologs in group_2944

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14960 FBDBKF_14960 100.0 Morganella morganii S1 nanE Putative N-acetylmannosamine-6-phosphate epimerase
EHELCC_11285 EHELCC_11285 100.0 Morganella morganii S2 nanE Putative N-acetylmannosamine-6-phosphate epimerase
LHKJJB_11490 LHKJJB_11490 100.0 Morganella morganii S3 nanE Putative N-acetylmannosamine-6-phosphate epimerase
HKOGLL_10100 HKOGLL_10100 100.0 Morganella morganii S5 nanE Putative N-acetylmannosamine-6-phosphate epimerase
PMI_RS14725 PMI_RS14725 87.5 Proteus mirabilis HI4320 - N-acetylmannosamine-6-phosphate 2-epimerase

Distribution of the homologs in the orthogroup group_2944

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2944

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EZY9 1.28e-138 390 87 0 232 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Proteus mirabilis (strain HI4320)
Q9L6B4 1.27e-102 299 68 0 214 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Pasteurella multocida (strain Pm70)
B8F667 2.44e-101 296 66 0 213 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Glaesserella parasuis serovar 5 (strain SH0165)
B5F7J7 1.43e-100 294 67 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Salmonella agona (strain SL483)
Q5PLF1 4.01e-100 293 66 0 225 3 nanE2 Putative N-acetylmannosamine-6-phosphate 2-epimerase 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZLQ7 7.32e-100 292 66 0 225 1 nanE2 Putative N-acetylmannosamine-6-phosphate 2-epimerase 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P59442 1.17e-99 292 66 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Shigella flexneri
Q0T067 1.17e-99 292 66 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Shigella flexneri serotype 5b (strain 8401)
B1IQQ6 1.17e-99 292 66 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A533 1.17e-99 292 66 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O9:H4 (strain HS)
Q3YX25 1.92e-99 291 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Shigella sonnei (strain Ss046)
A9N831 2.21e-99 291 66 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A9MNY8 4.26e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q31W92 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Shigella boydii serotype 4 (strain Sb227)
B2U1W1 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LGI8 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli (strain SMS-3-5 / SECEC)
B6I1U1 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli (strain SE11)
B7NDK1 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A761 4.36e-99 290 65 0 225 1 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli (strain K12)
P0A762 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCP3 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGB7 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O1:K1 / APEC
B1XHJ6 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli (strain K12 / DH10B)
C4ZSW1 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M0T5 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O8 (strain IAI1)
B7MBY5 4.36e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O45:K1 (strain S88 / ExPEC)
B5YSV0 7.78e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9G9 7.78e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O157:H7
B7NKT4 9.37e-99 290 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LRJ1 1.24e-98 289 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7UJV6 2.4e-98 288 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q32BB6 2.99e-98 288 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Shigella dysenteriae serotype 1 (strain Sd197)
A7ZSB6 3.8e-98 288 65 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Escherichia coli O139:H28 (strain E24377A / ETEC)
B3GZ03 6.32e-97 285 65 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N350 6.32e-97 285 65 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BSI0 8.97e-97 285 65 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
P71340 3.02e-96 283 64 0 214 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A6TEN5 8.68e-96 282 63 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q939I2 5.69e-95 280 63 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Klebsiella aerogenes
P60668 4.51e-94 278 65 0 225 1 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Salmonella typhi
P60631 4.51e-94 278 65 0 225 3 nanE1 Putative N-acetylmannosamine-6-phosphate 2-epimerase 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PG85 1.27e-93 276 64 0 225 3 nanE1 Putative N-acetylmannosamine-6-phosphate 2-epimerase 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C5B754 1.53e-90 269 61 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Edwardsiella ictaluri (strain 93-146)
B5XSS5 1.1e-89 267 60 0 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Klebsiella pneumoniae (strain 342)
Q7VKN0 1.07e-88 264 63 0 219 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q5E735 1.74e-88 264 57 2 230 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6LPV5 8.81e-86 257 57 2 231 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Photobacterium profundum (strain SS9)
A5F7B9 5.14e-77 235 52 1 226 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C3LNA0 1.06e-76 234 52 1 226 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Vibrio cholerae serotype O1 (strain M66-2)
Q9KR62 1.06e-76 234 52 1 226 1 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MD32 2.79e-71 219 53 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Vibrio vulnificus (strain YJ016)
Q8D613 2.79e-71 219 53 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Vibrio vulnificus (strain CMCP6)
B1JFV9 3.47e-70 217 60 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TMJ5 5.67e-70 217 60 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Yersinia pestis (strain Pestoides F)
Q1CJY8 5.67e-70 217 60 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCG8 5.67e-70 217 60 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Yersinia pestis
Q1C5U6 5.67e-70 217 60 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FG95 1.1e-69 216 60 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q668J7 1.36e-69 216 60 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K948 1.36e-69 216 60 0 212 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q8YBP2 8.08e-62 204 51 2 228 3 nanEK Bifunctional enzyme NanE/NanK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FWN5 2.16e-61 203 52 2 225 3 nanEK Bifunctional enzyme NanE/NanK Brucella suis biovar 1 (strain 1330)
Q0SWI9 5.94e-44 150 39 3 216 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Clostridium perfringens (strain SM101 / Type A)
Q8XNZ3 9.52e-43 147 37 3 216 1 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Clostridium perfringens (strain 13 / Type A)
Q0TUP9 9.52e-43 147 37 3 216 1 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q185B2 1.15e-42 147 36 3 218 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Clostridioides difficile (strain 630)
Q8R7I7 3.37e-42 146 39 6 228 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B9DVU8 1.13e-40 142 38 4 219 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q97Q95 1.62e-40 141 35 5 228 3 nanE1 Putative N-acetylmannosamine-6-phosphate 2-epimerase 1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q74HT0 5.74e-40 140 37 5 219 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8DGQ5 2.88e-39 138 42 4 228 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B8DD13 5.89e-39 137 37 4 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Listeria monocytogenes serotype 4a (strain HCC23)
A0AMC4 6.74e-39 137 36 4 220 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q660M6 6.74e-39 137 35 6 234 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q0SMK9 7.84e-39 137 35 6 234 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Borreliella afzelii (strain PKo)
Q040Z7 1.24e-38 136 36 5 219 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q8Y3N4 1.3e-38 137 36 4 225 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q926V7 1.29e-37 134 36 4 220 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
C1L0D5 1.45e-37 134 36 3 220 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q71VW2 1.55e-37 134 36 3 220 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Listeria monocytogenes serotype 4b (strain F2365)
Q6A6A0 1.86e-37 133 41 7 220 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Cutibacterium acnes (strain DSM 16379 / KPA171202)
C1CSU8 1.92e-37 133 34 6 232 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pneumoniae (strain Taiwan19F-14)
C1C8S3 1.92e-37 133 34 6 232 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pneumoniae (strain 70585)
P65521 1.92e-37 133 34 6 232 3 nanE2 Putative N-acetylmannosamine-6-phosphate 2-epimerase 2 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P65520 1.92e-37 133 34 6 232 3 nanE2 Putative N-acetylmannosamine-6-phosphate 2-epimerase 2 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q1JIP7 2.46e-37 133 37 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M2 (strain MGAS10270)
P65523 2.51e-37 133 37 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M18 (strain MGAS8232)
P65522 2.51e-37 133 37 4 221 1 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M1
B5XJP1 2.54e-37 133 36 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M49 (strain NZ131)
Q8DPF0 4.59e-37 132 34 5 233 3 nanE1 Putative N-acetylmannosamine-6-phosphate 2-epimerase 1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8KU93 7.23e-37 132 35 4 224 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Enterococcus faecalis (strain ATCC 700802 / V583)
B7J2K0 7.36e-37 132 34 5 224 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Borreliella burgdorferi (strain ZS7)
O51589 7.36e-37 132 34 5 224 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q5XDY5 7.68e-37 132 37 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1J8K5 8.1e-37 132 36 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M4 (strain MGAS10750)
A2RCG2 8.45e-37 132 36 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M5 (strain Manfredo)
P0DC69 9.51e-37 132 36 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48VD6 9.51e-37 132 36 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JNJ8 9.51e-37 132 36 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDM7 9.51e-37 132 36 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DC68 9.51e-37 132 36 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q6MT55 8.25e-36 129 33 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q8RDN5 2.26e-35 128 35 2 216 1 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9CGC2 4.59e-35 127 38 5 219 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Lactococcus lactis subsp. lactis (strain IL1403)
Q5WK54 3.1e-34 125 34 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Shouchella clausii (strain KSM-K16)
A4VW79 4.88e-34 125 35 4 231 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus suis (strain 05ZYH33)
C5VXY0 4.88e-34 125 35 4 231 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus suis (strain P1/7)
Q98QJ8 8.25e-34 124 35 4 224 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Mycoplasmopsis pulmonis (strain UAB CTIP)
A8AUI0 2.13e-33 123 33 5 233 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P0CB52 2.16e-33 123 35 4 231 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus suis
A2RKU2 2.21e-33 123 35 7 226 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Lactococcus lactis subsp. cremoris (strain MG1363)
Q2SS69 2.33e-33 123 33 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q02YU5 4.02e-33 122 33 4 224 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Lactococcus lactis subsp. cremoris (strain SK11)
Q3K3Z4 5.8e-33 122 34 4 220 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P65519 7.99e-33 121 34 4 220 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65518 7.99e-33 121 34 4 220 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus agalactiae serotype III (strain NEM316)
B9DIJ5 1.59e-32 120 34 4 219 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus carnosus (strain TM300)
P65517 2.01e-32 120 34 4 217 1 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain N315)
P65516 2.01e-32 120 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IPI5 2.01e-32 120 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain JH9)
A6TYA2 2.01e-32 120 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain JH1)
A7WXZ6 2.01e-32 120 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NYC4 3.7e-32 119 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain MW2)
Q6GCF3 3.7e-32 119 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain MSSA476)
Q2YVA8 4.68e-32 119 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A8YZE2 4.78e-32 119 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GJZ8 4.78e-32 119 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain MRSA252)
A6QDV0 4.78e-32 119 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain Newman)
Q5HJ50 4.78e-32 119 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain COL)
Q2G157 4.78e-32 119 34 4 217 1 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJU6 4.78e-32 119 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus aureus (strain USA300)
Q38V36 5.05e-32 119 34 3 222 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Latilactobacillus sakei subsp. sakei (strain 23K)
Q4L9T7 5.63e-32 119 33 4 220 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus haemolyticus (strain JCSC1435)
Q4A094 3.52e-30 114 34 4 216 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A3CK30 4.94e-30 114 32 5 220 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Streptococcus sanguinis (strain SK36)
A4WDW4 3.96e-29 112 36 3 220 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Enterobacter sp. (strain 638)
Q8EMP6 5.26e-29 111 34 4 217 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8EWM9 2.11e-27 107 32 5 222 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Malacoplasma penetrans (strain HF-2)
P59441 2.8e-27 107 36 3 219 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q03HR3 3.01e-25 102 37 5 223 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q8NMD0 1.1e-22 95 32 5 222 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QH48 1.1e-22 95 32 5 222 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Corynebacterium glutamicum (strain R)
Q5N1J0 4.68e-20 88 40 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31KC5 4.68e-20 88 40 4 221 3 nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_11630
Feature type CDS
Gene nanE
Product Putative N-acetylmannosamine-6-phosphate epimerase
Location 78983 - 79681 (strand: 1)
Length 699 (nucleotides) / 232 (amino acids)

Contig

Accession ZDB_526
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2944
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF04131 Putative N-acetylmannosamine-6-phosphate epimerase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3010 Carbohydrate transport and metabolism (G) G Putative N-acetylmannosamine-6-phosphate epimerase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01788 N-acylglucosamine-6-phosphate 2-epimerase [EC:5.1.3.9] Amino sugar and nucleotide sugar metabolism
Metabolic pathways
-

Protein Sequence

MALIEKMTKDIQQKGGLIVSCQPVDNSPMDKPEIVAAMARAAVNAGAVAVRIEGIDNLKATRPLIDVPIIGIVKRDLPDSPVRITPWLSDAEALATEGADIIAFDGTDRVRPVPINELLACIHHLNKLAMADCSTFNEGMHCRKLGAEFIGSTMSGYTGGEIPKLPDLQLVTALAENGCRVIAEGRYNTPIIAARAIQAGAWAVTVGSALTRLEHVCDWFTHALKLQQELVK

Flanking regions ( +/- flanking 50bp)

AAAATAATATCAAATGGAGTTACATTTCAAAAAAGAATGGTGAATTCAAAATGGCATTAATTGAAAAAATGACTAAGGATATTCAACAAAAAGGAGGGCTGATCGTTTCTTGTCAGCCTGTCGATAATAGCCCTATGGATAAGCCAGAAATTGTGGCAGCAATGGCCCGGGCTGCTGTAAATGCAGGTGCCGTAGCAGTACGAATTGAGGGGATAGATAATTTAAAAGCAACCCGCCCCCTTATTGATGTACCAATTATCGGTATTGTCAAACGTGATTTACCGGATAGTCCGGTCAGGATCACGCCTTGGTTAAGTGATGCAGAAGCATTAGCGACAGAAGGTGCCGATATTATCGCTTTTGATGGTACGGATCGTGTACGTCCAGTTCCAATTAATGAGTTACTGGCTTGCATACACCACCTTAATAAATTAGCGATGGCCGATTGCTCCACATTTAATGAGGGAATGCATTGCCGGAAATTAGGAGCAGAATTTATTGGTTCAACAATGTCGGGCTACACAGGTGGCGAAATACCGAAATTACCTGATTTACAATTAGTCACTGCATTGGCTGAAAATGGGTGTCGTGTAATAGCCGAAGGCCGTTATAACACCCCAATAATTGCAGCAAGAGCCATACAAGCCGGAGCCTGGGCTGTCACTGTTGGTTCCGCATTAACCCGACTTGAACATGTTTGTGATTGGTTTACTCATGCGCTCAAGTTACAGCAGGAGTTAGTTAAATGAATATATTAGCAATTGATATTGGAGGAACAAAGATTTCGGCTGCATTAATC