Homologs in group_163

Help

9 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14505 FBDBKF_14505 100.0 Morganella morganii S1 tnp IS3 family ISPrre1 transposase ORF A
FBDBKF_17930 FBDBKF_17930 93.0 Morganella morganii S1 tnp IS3 family transposase ORF A
EHELCC_06405 EHELCC_06405 93.0 Morganella morganii S2 tnp IS3 family transposase ORF A
EHELCC_07775 EHELCC_07775 100.0 Morganella morganii S2 tnp IS3 family ISPrre1 transposase ORF A
NLDBIP_06725 NLDBIP_06725 93.0 Morganella morganii S4 tnp IS3 family transposase ORF A
LHKJJB_06165 LHKJJB_06165 100.0 Morganella morganii S3 tnp IS3 family ISPrre1 transposase ORF A
LHKJJB_19325 LHKJJB_19325 93.0 Morganella morganii S3 tnp IS3 family transposase ORF A
HKOGLL_04665 HKOGLL_04665 93.0 Morganella morganii S5 tnp IS3 family transposase ORF A
HKOGLL_04750 HKOGLL_04750 100.0 Morganella morganii S5 tnp IS3 family ISPrre1 transposase ORF A

Distribution of the homologs in the orthogroup group_163

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_163

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P39213 1.89e-63 190 92 0 100 3 insN Transposase InsN for insertion sequence element IS911 Shigella dysenteriae
P75679 2.77e-54 168 90 0 88 5 insN1 Putative transposase InsN for insertion sequence element IS911A Escherichia coli (strain K12)
P39212 6.48e-52 160 88 0 86 5 insN2 Putative transposase InsN for insertion sequence element IS911B Escherichia coli (strain K12)
P16939 2.76e-08 50 29 1 99 3 None Insertion element IS600 uncharacterized 11 kDa protein Shigella sonnei
Q79E92 1.35e-07 48 31 1 87 5 ykgN Putative transposase YkgN Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_08100
Feature type CDS
Gene tnp
Product IS3 family ISPrre1 transposase ORF A
Location 18897 - 19199 (strand: -1)
Length 303 (nucleotides) / 100 (amino acids)

Contig

Accession ZDB_523
Length 257158 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_163
Orthogroup size 10
N. genomes 5

Actions

Genomic region

Domains

PF01527 Transposase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2963 Mobilome: prophages, transposons (X) X Transposase InsE and inactivated derivatives

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07483 transposase - -

Protein Sequence

MKKRNFSAEFRRESAQLVVDQNYTVADAAKAMNVGLSTLTRWVKQLRDERAGKTPKASPITPEQIEIRELKKKIHRIEMENEILKKATALLMSDSLNRSR

Flanking regions ( +/- flanking 50bp)

CCACCTGAACAGAGGTGATATGCTCACCTCAGAACAACACAGGTGCCTTAATGAAAAAACGAAATTTCAGTGCAGAATTCAGACGTGAATCAGCCCAGCTGGTTGTGGATCAGAACTATACAGTTGCGGATGCCGCGAAAGCCATGAATGTCGGGCTTTCCACCTTGACGCGGTGGGTAAAGCAATTACGGGACGAACGGGCAGGCAAAACACCGAAAGCATCCCCTATCACGCCGGAACAAATTGAGATACGTGAGCTGAAGAAAAAAATTCATCGTATTGAAATGGAAAACGAAATATTAAAAAAGGCTACCGCGCTCTTGATGTCAGACTCCCTGAACAGGTCTCGGTGATCGGGAAATTCAGAGCGCATTATCCTGTGGCCACTCTTTGCTGCGTGTTC