Homologs in group_789

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03700 FBDBKF_03700 100.0 Morganella morganii S1 hycH Formate hydrogenlyase maturation protein HycH
EHELCC_06835 EHELCC_06835 100.0 Morganella morganii S2 hycH Formate hydrogenlyase maturation protein HycH
LHKJJB_06695 LHKJJB_06695 100.0 Morganella morganii S3 hycH Formate hydrogenlyase maturation protein HycH
HKOGLL_04235 HKOGLL_04235 100.0 Morganella morganii S5 hycH Formate hydrogenlyase maturation protein HycH
F4V73_RS11170 F4V73_RS11170 93.1 Morganella psychrotolerans - formate hydrogenlyase maturation HycH family protein
PMI_RS12455 PMI_RS12455 74.3 Proteus mirabilis HI4320 - formate hydrogenlyase maturation HycH family protein

Distribution of the homologs in the orthogroup group_789

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_789

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77453 1.69e-46 150 51 0 130 4 hyfJ Hydrogenase-4 component J Escherichia coli (strain K12)
P0AEV7 2.94e-39 132 49 1 130 4 hycH Formate hydrogenlyase maturation protein HycH Escherichia coli (strain K12)
P0AEV8 2.94e-39 132 49 1 130 3 hycH Formate hydrogenlyase maturation protein HycH Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_07160
Feature type CDS
Gene hycH
Product Formate hydrogenlyase maturation protein HycH
Location 103872 - 104306 (strand: 1)
Length 435 (nucleotides) / 144 (amino acids)

Contig

Accession ZDB_522
Length 269640 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_789
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF07450 Formate hydrogenlyase maturation protein HycH

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12145 hydrogenase-4 component J [EC:1.-.-.-] - -

Protein Sequence

MPEQTPDHAGTDGKVIFWSLRQKFVDSDTDVPEEAQQVMYYSLAIGHHVGMIDCLNTELICPLSGYQSWVNALPEGEARRKLQGLITFGEINIDSTHTNMLALALDPLTKDKNPDFREWSATLIRLLGEIEREPAIYLIVKRRP

Flanking regions ( +/- flanking 50bp)

GCGCGAAATTGTGAACCGTCTGGTGACCGTATTACAACAAGGAGGCATTCATGCCTGAACAGACACCCGATCATGCAGGTACTGACGGAAAAGTGATCTTCTGGTCGCTGAGACAGAAATTTGTCGACAGTGATACTGATGTTCCGGAAGAGGCTCAGCAGGTGATGTACTACTCGCTGGCAATCGGCCACCACGTTGGCATGATCGATTGTCTGAATACGGAGCTCATCTGCCCGCTCAGCGGTTATCAGTCCTGGGTGAATGCGCTTCCCGAAGGGGAGGCGCGCCGCAAATTGCAGGGGCTTATCACCTTCGGTGAAATCAATATCGACTCCACGCATACCAATATGCTGGCACTGGCACTGGATCCGCTGACGAAAGATAAAAATCCGGACTTCCGCGAATGGAGTGCCACGCTTATCCGCCTGCTGGGGGAAATTGAGCGTGAACCGGCAATTTACCTGATAGTGAAGCGCCGCCCATGAGTGAAACCACTGCAAAAAATGTGATGCTGGCGGTCGGTAACAGCATGATG