Homologs in group_911

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04905 FBDBKF_04905 100.0 Morganella morganii S1 arsB Na+/H+ antiporter NhaD or related arsenite permease
EHELCC_06195 EHELCC_06195 100.0 Morganella morganii S2 arsB Na+/H+ antiporter NhaD or related arsenite permease
LHKJJB_03395 LHKJJB_03395 100.0 Morganella morganii S3 arsB Na+/H+ antiporter NhaD or related arsenite permease
HKOGLL_06870 HKOGLL_06870 100.0 Morganella morganii S5 arsB Na+/H+ antiporter NhaD or related arsenite permease
F4V73_RS04895 F4V73_RS04895 87.2 Morganella psychrotolerans - arsenic transporter
PMI_RS10600 PMI_RS10600 93.0 Proteus mirabilis HI4320 - arsenic transporter

Distribution of the homologs in the orthogroup group_911

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_911

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P52146 0.0 702 82 0 426 4 arsB Arsenical pump membrane protein Escherichia coli
P08691 0.0 677 81 0 427 4 arsB Arsenical pump membrane protein Escherichia coli
P74985 0.0 675 78 0 427 3 arsB Arsenical pump membrane protein Yersinia enterocolitica
P0AB95 0.0 673 81 0 426 3 arsB Arsenical pump membrane protein Shigella flexneri
P0AB93 0.0 673 81 0 426 1 arsB Arsenical pump membrane protein Escherichia coli (strain K12)
P0AB94 0.0 673 81 0 426 3 arsB Arsenical pump membrane protein Escherichia coli O157:H7
P96678 1.12e-178 508 59 0 429 3 ydfA Putative arsenical pump membrane protein YdfA Bacillus subtilis (strain 168)
Q8CQF4 3.48e-173 494 59 0 419 3 arsB Arsenical pump membrane protein Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q01255 6.84e-173 493 60 0 423 3 arsB Arsenical pump membrane protein Staphylococcus xylosus
P30329 7.57e-171 488 60 0 423 3 arsB Arsenical pump membrane protein Staphylococcus aureus
Q6G8F6 8.21e-166 475 56 0 423 3 arsB Arsenical pump membrane protein Staphylococcus aureus (strain MSSA476)
Q8NW09 1.51e-165 475 56 0 423 3 arsB Arsenical pump membrane protein Staphylococcus aureus (strain MW2)
P63620 1.63e-165 474 56 0 423 3 arsB Arsenical pump membrane protein Staphylococcus aureus (strain N315)
P63619 1.63e-165 474 56 0 423 3 arsB Arsenical pump membrane protein Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HF02 1.63e-165 474 56 0 423 3 arsB Arsenical pump membrane protein Staphylococcus aureus (strain COL)
Q5HRI3 1.89e-165 474 56 0 423 3 arsB Arsenical pump membrane protein Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GFT0 2.01e-163 469 57 0 415 3 arsB Arsenical pump membrane protein Staphylococcus aureus (strain MRSA252)
O05224 5.42e-54 189 30 4 435 3 ywrK Putative arsenical pump membrane protein Bacillus subtilis (strain 168)
P74635 3.99e-18 89 22 7 386 3 slr0753 Uncharacterized transporter slr0753 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WPD8 4.69e-16 83 25 11 398 3 MT2758 Uncharacterized transporter MT2758 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A607 5.43e-16 83 24 10 398 3 BQ2027_MB2703 Uncharacterized transporter Mb2703 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPD9 5.43e-16 83 24 10 398 3 Rv2684 Uncharacterized transporter Rv2684 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P46838 3.51e-13 74 22 8 420 3 ag45 46 kDa membrane protein Mycobacterium leprae (strain TN)
P9WPD7 1.79e-11 69 23 9 387 1 Rv2685 Uncharacterized transporter Rv2685 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPD6 1.79e-11 69 23 9 387 3 MT2759 Uncharacterized transporter MT2759 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q54GU0 4.14e-06 52 22 3 204 2 arsB Putative transporter arsB Dictyostelium discoideum
Q57898 0.000777 45 25 8 192 3 MJ0456 Uncharacterized transporter MJ0456 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_06515
Feature type CDS
Gene arsB
Product Na+/H+ antiporter NhaD or related arsenite permease
Location 288987 - 290276 (strand: -1)
Length 1290 (nucleotides) / 429 (amino acids)

Contig

Accession ZDB_521
Length 325332 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_911
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02040 Arsenical pump membrane protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1055 Inorganic ion transport and metabolism (P) P Na+/H+ antiporter NhaD or related arsenite permease

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03893 arsenical pump membrane protein - -

Protein Sequence

MFIAAFIFILTITFVIWQPKGLGIGWSATAGAVLALIFGVISFQDIPIVWNIVWNATATFVAVIIISLLLDESGFFEWAALHVAKWGGGKGKLLFSYIVLLGATVAALFANDGAALILTPIVIAMLLALGFNKGTTLAFVMAAGFIADTASLPLIVSNLVNIVSADFFNIGFTEYASIMVPVDIAAIIATLAMLHWFFRKDIPKQYDVTKLSEPTLAIKDMTTFKTGWLVLVLLLIGFFVLEPLGIPISAIAAIGALILWMIAARGHTINTKKVLRGAPWQIVIFSLGMYLVVYGLRNAGLTDYLSETLNYLADKGLWVATIGTGFITAFLSSIMNNMPTVLIGALSIEGSEASGLIQQAMVYANVIGADLGPKITPIGSLATLLWLHVLSQKNMTITWGYYFKTGIIMTIPVLIVTLVALVLRLSLLN

Flanking regions ( +/- flanking 50bp)

ATTTTCTAAAAATAAAAGGTGCGGAAAAGTACCTTTTAAATGAGGTTGTTATGTTTATTGCCGCATTCATTTTTATTTTAACGATCACCTTTGTTATTTGGCAACCCAAAGGACTTGGTATTGGCTGGAGTGCTACAGCAGGGGCTGTATTGGCACTGATCTTTGGTGTGATCAGTTTCCAGGACATCCCGATTGTCTGGAACATTGTTTGGAATGCCACGGCGACATTTGTTGCCGTAATTATCATTAGTCTACTTTTAGATGAAAGTGGTTTCTTTGAATGGGCTGCATTACATGTTGCCAAGTGGGGCGGGGGTAAAGGAAAACTGTTATTCAGTTATATTGTGTTACTTGGAGCAACGGTTGCAGCCTTATTTGCCAATGATGGCGCAGCATTGATATTAACGCCCATTGTGATTGCGATGTTATTGGCACTTGGTTTCAACAAAGGCACGACATTAGCATTTGTCATGGCTGCCGGGTTTATTGCAGATACGGCGAGCTTGCCGCTGATCGTTTCGAACCTCGTGAATATCGTTTCTGCAGACTTCTTTAATATTGGATTTACTGAATATGCATCGATTATGGTGCCAGTGGATATTGCAGCAATTATTGCAACATTAGCGATGCTGCATTGGTTTTTCCGCAAAGATATTCCTAAACAATATGATGTTACCAAACTGAGTGAACCGACTTTAGCCATTAAGGATATGACAACGTTTAAAACAGGTTGGCTGGTATTGGTACTGCTGCTTATTGGTTTCTTTGTCTTAGAACCATTAGGTATTCCAATCAGTGCAATTGCGGCTATTGGCGCTTTAATTCTTTGGATGATTGCAGCCAGAGGCCATACGATTAATACCAAAAAAGTATTACGCGGAGCACCGTGGCAAATCGTCATTTTCTCTTTAGGTATGTACTTGGTTGTTTATGGTTTAAGAAATGCAGGGTTAACCGATTATCTTTCTGAAACGCTCAATTACCTTGCAGACAAAGGGTTATGGGTTGCAACAATTGGTACGGGATTTATAACTGCATTTTTATCCTCAATAATGAATAACATGCCAACGGTATTAATTGGTGCTCTGTCCATTGAAGGAAGTGAAGCATCAGGGTTAATTCAGCAAGCAATGGTTTATGCTAACGTGATTGGTGCCGATTTGGGTCCGAAAATCACACCAATAGGTAGTTTGGCTACATTGCTGTGGCTGCATGTTTTATCGCAAAAAAACATGACCATTACATGGGGATATTATTTCAAAACCGGGATTATCATGACTATCCCTGTGCTCATTGTCACACTCGTTGCTTTAGTACTTCGACTTTCACTGTTAAATTAAAGGTAACTCCATGAATGAGATCACTATCTACCATAACCCCAATTGTGGCA