Homologs in group_532

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01165 FBDBKF_01165 100.0 Morganella morganii S1 hmpA NO-inducible flavohemoprotein
EHELCC_00380 EHELCC_00380 100.0 Morganella morganii S2 hmpA NO-inducible flavohemoprotein
LHKJJB_04595 LHKJJB_04595 100.0 Morganella morganii S3 hmpA NO-inducible flavohemoprotein
HKOGLL_02450 HKOGLL_02450 100.0 Morganella morganii S5 hmpA NO-inducible flavohemoprotein
F4V73_RS07240 F4V73_RS07240 83.0 Morganella psychrotolerans hmpA NO-inducible flavohemoprotein
PMI_RS09220 PMI_RS09220 62.9 Proteus mirabilis HI4320 hmpA NO-inducible flavohemoprotein

Distribution of the homologs in the orthogroup group_532

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_532

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZCR0 0.0 525 62 1 396 3 hmp Flavohemoprotein Yersinia pestis
Q7N215 0.0 518 61 1 396 3 hmp Flavohemoprotein Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8Z4M3 1.03e-180 510 62 2 396 3 hmp Flavohemoprotein Salmonella typhi
Q5PIH6 1.14e-180 510 62 2 396 3 hmp Flavohemoprotein Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P24232 8.33e-180 508 61 2 396 1 hmp Flavohemoprotein Escherichia coli (strain K12)
Q7ABK6 1.04e-179 508 61 2 396 3 hmp Flavohemoprotein Escherichia coli O157:H7
Q57LF5 1.36e-179 508 61 2 396 3 hmp Flavohemoprotein Salmonella choleraesuis (strain SC-B67)
Q8FF30 1.87e-179 507 61 2 396 3 hmp Flavohemoprotein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P26353 2.02e-179 507 61 1 396 2 hmp Flavohemoprotein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6D245 2.35e-179 507 60 2 397 3 hmp Flavohemoprotein Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7C0F9 3.49e-179 506 61 2 396 3 hmp Flavohemoprotein Shigella flexneri
Q47266 1.49e-176 500 61 1 395 3 hmp Flavohemoprotein Dickeya dadantii (strain 3937)
Q6LM37 5.4e-164 468 57 2 396 3 hmp Flavohemoprotein Photobacterium profundum (strain SS9)
P40609 2.14e-162 464 55 2 396 3 hmp Flavohemoprotein Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MH09 6.92e-155 445 54 2 396 3 hmp Flavohemoprotein Vibrio vulnificus (strain YJ016)
Q8DCU2 1.07e-154 444 54 2 396 3 hmp Flavohemoprotein Vibrio vulnificus (strain CMCP6)
Q9KMY3 9.55e-121 358 49 8 403 1 hmp Flavohemoprotein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7WUM8 2.7e-119 355 45 4 399 3 hmp Flavohemoprotein Rhizobium meliloti (strain 1021)
Q9RC40 2.78e-108 327 43 4 399 3 hmp Flavohemoprotein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P39662 2.43e-107 324 43 4 399 1 hmp Flavohemoprotein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q73B49 5.51e-105 318 43 2 397 3 hmp Flavohemoprotein Bacillus cereus (strain ATCC 10987 / NRS 248)
Q7NSD8 9.94e-104 315 45 6 403 3 hmp Flavohemoprotein Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q6HLA6 1.66e-103 314 43 2 397 3 hmp Flavohemoprotein Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81FW4 2.27e-103 314 43 2 397 3 hmp Flavohemoprotein Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9RYR5 2.94e-103 314 44 3 396 3 hmp Flavohemoprotein Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q88PP0 4.6e-103 313 44 8 400 3 hmp Flavohemoprotein Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9I0H4 5.01e-103 313 44 6 393 3 hmp Flavohemoprotein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q81T23 1.22e-102 312 43 2 397 3 hmp Flavohemoprotein Bacillus anthracis
Q8GAZ4 7.22e-100 305 43 6 398 3 hmp Flavohemoprotein Burkholderia sp. (strain TH2)
Q7TTP0 9.13e-98 300 45 4 397 3 hmp Flavohemoprotein Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8ETH0 1.01e-97 300 40 3 395 3 hmp Flavohemoprotein Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7TTP2 1.04e-97 300 45 4 397 3 hmp Flavohemoprotein Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WHW5 1.04e-97 300 45 4 397 3 hmp Flavohemoprotein Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7UIY1 1.12e-97 300 39 6 411 3 hmp Flavohemoprotein Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
P49852 3.69e-94 290 41 5 395 2 hmp Flavohemoprotein Bacillus subtilis (strain 168)
Q9UAG7 7.5e-92 284 39 7 401 2 fhbA Flavohemoprotein A Dictyostelium discoideum
E2RTZ4 2.18e-87 275 35 9 457 1 hmpA Flavohemoprotein Giardia intestinalis (strain ATCC 50803 / WB clone C6)
E1F8H4 5.96e-87 274 36 9 456 3 hmpA-2 Flavohemoprotein-2 Giardia intestinalis (strain P15)
E1F8Q4 1.22e-86 273 35 9 456 3 hmpA-1 Flavohemoprotein-1 Giardia intestinalis (strain P15)
C6LR75 2.04e-86 272 36 9 462 3 hmpA Flavohemoprotein Giardia intestinalis (strain ATCC 50581 / GS clone H7)
Q9PH91 1.26e-83 263 37 5 388 3 hmp Flavohemoprotein Xylella fastidiosa (strain 9a5c)
Q87F90 1.33e-82 261 36 5 388 3 hmp Flavohemoprotein Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q54D73 4.98e-70 229 33 9 409 1 fhbB Flavohemoprotein B Dictyostelium discoideum
P39676 3.86e-61 205 34 10 412 1 YHB1 Flavohemoprotein Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9URY5 6.34e-56 192 30 10 399 3 SPAC869.02c Flavohemoprotein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q59MV9 1.27e-51 180 29 8 395 2 YHB1 Flavohemoprotein Candida albicans (strain SC5314 / ATCC MYA-2876)
Q03331 9.72e-43 156 28 10 388 1 None Flavohemoprotein Candida norvegensis
P04252 2.85e-35 129 46 1 143 1 vhb Bacterial hemoglobin Vitreoscilla stercoraria
O66586 1.95e-32 122 43 1 141 1 aq_211 Uncharacterized globin-like protein aq_211 Aquifex aeolicus (strain VF5)
P9WNE9 7.8e-20 93 31 6 215 1 Rv3230c NADPH oxidoreductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNE8 7.8e-20 93 31 6 215 3 MT3327 NADPH oxidoreductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q1QYU6 1.5e-19 92 27 6 220 1 bmoB Glycine betaine monooxygenase reductase subunit Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q44257 2.87e-17 85 30 13 239 3 cbaB 3-chlorobenzoate-3,4-dioxygenase reductase subunit Comamonas testosteroni
Q9HTF3 4.7e-17 85 25 5 219 2 gbcB Glycine betaine monooxygenase reductase subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZJB2 4.7e-17 85 25 5 219 2 gbcB Glycine betaine monooxygenase reductase subunit Pseudomonas aeruginosa (strain UCBPP-PA14)
E9RFT0 1.5e-15 80 25 6 239 1 mimB Propane 2-monooxygenase, reductase component Mycolicibacterium goodii
P75824 4.25e-15 79 28 4 197 1 hcr NADH oxidoreductase HCR Escherichia coli (strain K12)
A0QTU9 5.25e-15 79 25 6 232 1 mimB Propane 2-monooxygenase, reductase component Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P07771 6.1e-15 79 25 4 230 1 benC Benzoate 1,2-dioxygenase electron transfer component Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P76254 1.23e-14 77 28 11 243 1 yeaX Carnitine monooxygenase reductase subunit Escherichia coli (strain K12)
Q0SJK8 1.99e-14 77 25 7 239 1 prmB Propane 2-monooxygenase, reductase component Rhodococcus jostii (strain RHA1)
B6V6V6 8.51e-14 75 28 7 209 1 kshB 3-ketosteroid-9-alpha-monooxygenase, ferredoxin reductase component Rhodococcus rhodochrous
A0R525 2.5e-13 73 29 6 206 3 kshB 3-ketosteroid-9-alpha-monooxygenase, ferredoxin reductase component Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
H9N291 1.35e-12 72 27 11 235 1 ndmD Oxidoreductase NdmD Pseudomonas putida
P9WJ93 1.73e-12 71 27 6 206 1 hmp 3-ketosteroid-9-alpha-monooxygenase, ferredoxin reductase component Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJ92 1.73e-12 71 27 6 206 3 hmp 3-ketosteroid-9-alpha-monooxygenase, ferredoxin reductase component Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O54037 5.42e-12 69 29 11 234 3 vanB Vanillate O-demethylase oxidoreductase Pseudomonas putida
O24840 5.61e-12 69 25 6 223 3 vanB Vanillate O-demethylase oxidoreductase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P23101 1.32e-11 68 27 6 207 3 xylZ Toluate 1,2-dioxygenase electron transfer component Pseudomonas putida
P0DPQ8 1.41e-11 68 28 9 218 1 gcoB Aromatic O-demethylase, reductase subunit Amycolatopsis sp. (strain ATCC 39116 / 75iv2)
O85675 2.17e-11 68 25 6 214 1 antC Anthranilate 1,2-dioxygenase electron transfer component Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P33164 1.79e-10 65 25 10 246 1 ophA1 Phthalate dioxygenase reductase Burkholderia cepacia
Q51603 3.22e-10 64 24 6 223 1 cbdC 2-halobenzoate 1,2-dioxygenase electron transfer component Burkholderia cepacia
Q605A0 9.03e-10 63 24 6 202 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
G8FRC6 1.05e-09 63 28 12 239 1 mdpK Tert-butanol monooxygenase / tert-amyl alcohol desaturase reductase subunit Aquincola tertiaricarbonis
A1KSH3 1.61e-09 62 22 7 221 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9K0M8 1.61e-09 62 22 7 221 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVQ3 1.61e-09 62 22 7 221 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M2A6 1.61e-09 62 22 7 221 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup C (strain 053442)
Q5F6X5 1.79e-09 62 23 8 221 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9HZL1 2.46e-09 62 25 6 200 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A6V3A2 2.46e-09 62 25 6 200 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Pseudomonas aeruginosa (strain PA7)
Q52126 2.73e-09 61 20 3 212 1 ndoR Naphthalene 1,2-dioxygenase system ferredoxin--NAD(P)(+), reductase component Pseudomonas putida
Q52186 3.38e-09 61 29 13 229 2 pobB Phenoxybenzoate dioxygenase subunit beta Pseudomonas oleovorans
Q768T4 6.71e-09 60 22 6 237 1 prmB Propane 2-monooxygenase, reductase component Gordonia sp. (strain TY-5)
Q02PF8 8.25e-09 60 24 6 200 1 nqrF Na(+)-translocating NADH-quinone reductase subunit F Pseudomonas aeruginosa (strain UCBPP-PA14)
A8GAC4 1.07e-08 60 21 8 238 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Serratia proteamaculans (strain 568)
P21394 1.44e-08 59 32 5 130 1 xylA Xylene/toluene monooxygenase electron transfer component XylA Pseudomonas putida
P76081 1.89e-08 59 25 7 215 1 paaE 1,2-phenylacetyl-CoA epoxidase, subunit E Escherichia coli (strain K12)
Q05182 2.61e-08 58 27 12 247 2 pht2 Phthalate 4,5-dioxygenase oxygenase reductase subunit Pseudomonas putida
P12580 5.54e-08 57 25 9 228 3 vanB Vanillate O-demethylase oxidoreductase Pseudomonas sp. (strain ATCC 19151)
Q03304 5.89e-08 57 26 8 236 1 tmoF Toluene-4-monooxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas mendocina
A6VLY1 5.96e-08 57 22 6 201 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q0I5Y1 9.34e-08 57 23 6 201 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Histophilus somni (strain 129Pt)
Q7VNU4 2.73e-07 55 22 6 201 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q65VU9 5.27e-07 55 22 6 201 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
O52378 5.83e-07 54 22 7 217 1 nagAa Naphthalene 1,2-dioxygenase/salicylate 5-hydroxylase systems, ferredoxin--NAD(P)(+), reductase component Ralstonia sp.
Q4FPV2 6.61e-07 54 23 7 202 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
P68641 8.69e-07 53 22 7 214 3 ascD CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehydrase reductase Yersinia pestis
Q66DP5 9.42e-07 53 22 7 214 1 ascD CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehydrase reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1Q7Z7 1.1e-06 53 23 7 202 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q3C1E0 1.3e-06 53 21 6 215 1 tphA1I Terephthalate 1,2-dioxygenase, reductase component 1 Comamonas sp.
O05012 1.44e-06 53 22 6 201 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P02239 1.45e-06 51 31 6 148 1 Lb1 Leghemoglobin-1 Lupinus luteus
A5UAX6 1.54e-06 53 22 6 201 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Haemophilus influenzae (strain PittEE)
O05617 1.55e-06 53 25 7 223 3 vanB Vanillate O-demethylase oxidoreductase Pseudomonas sp. (strain HR199 / DSM 7063)
A9FRJ0 1.56e-06 52 28 5 128 1 sce5135 Ferredoxin--NADP reductase B Sorangium cellulosum (strain So ce56)
Q9AHG2 1.67e-06 53 31 7 151 5 tsaB2 Putative toluene-4-sulfonate monooxygenase system reductase subunit TsaB2 Comamonas testosteroni
Q9CLA6 1.68e-06 53 22 6 201 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Pasteurella multocida (strain Pm70)
P26395 1.79e-06 53 25 2 99 4 rfbI Protein RfbI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3C1D2 2e-06 52 22 6 215 1 tphA1II Terephthalate 1,2-dioxygenase, reductase component 2 Comamonas sp.
Q4QP19 2.15e-06 53 22 6 201 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Haemophilus influenzae (strain 86-028NP)
P19734 2.43e-06 52 23 6 189 1 dmpP Phenol 2-monooxygenase, reductase component DmpP Pseudomonas sp. (strain CF600)
A6T526 2.67e-06 52 22 6 201 1 nqrF Na(+)-translocating NADH-quinone reductase subunit F Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
I3SX86 5.04e-06 49 29 4 137 2 GLB2-1 Atypical leghemoglobin 2-1 Lotus japonicus
Q12QK1 5.72e-06 51 20 7 224 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A3MYM7 6.79e-06 51 22 6 201 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q53563 9.14e-06 50 21 1 137 1 mmoC Methane monooxygenase component C Methylosinus trichosporium
B1AS42 1.22e-05 50 25 8 212 2 Cyb5rl NADH-cytochrome b5 reductase-like Mus musculus
A5UFX3 1.5e-05 50 22 6 201 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Haemophilus influenzae (strain PittGG)
D0C9N8 1.58e-05 50 24 7 233 1 cntB Carnitine monooxygenase reductase subunit Acinetobacter baumannii (strain ATCC 19606 / DSM 30007 / JCM 6841 / CCUG 19606 / CIP 70.34 / NBRC 109757 / NCIMB 12457 / NCTC 12156 / 81)
P02240 1.97e-05 47 30 5 141 1 Lb2 Leghemoglobin-2 Lupinus luteus
P22868 2.02e-05 49 19 4 212 1 mmoC Methane monooxygenase component C Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q45692 3.08e-05 49 24 2 102 1 dntAa 2,4-dinitrotoluene dioxygenase system ferredoxin--NAD(+), reductase component Burkholderia sp. (strain RASC)
F0KFI7 3.77e-05 48 25 10 231 1 yeaX Carnitine monooxygenase reductase subunit Acinetobacter pittii (strain PHEA-2)
Q9X406 7.02e-05 48 29 5 123 1 msmD Putative methanesulfonate monooxygenase ferredoxin reductase subunit Methylosulfonomonas methylovora
Q7WTJ2 9.28e-05 47 21 7 219 1 mphP Phenol hydroxylase P5 protein Acinetobacter pittii (strain PHEA-2)
Q9ER97 0.000153 45 22 3 138 1 Ngb Neuroglobin Mus musculus
A5E5C5 0.000172 46 30 3 93 3 MCR1 NADH-cytochrome b5 reductase 2 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q255Y6 0.000185 47 24 6 175 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Chlamydia felis (strain Fe/C-56)
Q99JA8 0.000191 45 22 3 138 2 Ngb Neuroglobin Rattus norvegicus
A7TNL7 0.000251 46 22 10 226 3 CBR1 NADH-cytochrome b5 reductase 1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
P94680 0.000269 46 30 7 151 1 tsaB1 Toluene-4-sulfonate monooxygenase system reductase subunit TsaB1 Comamonas testosteroni
Q93Y92 0.00058 43 25 4 135 3 HB2 Anaerobic nitrite reductase HB2 Gossypium hirsutum
A6ZVM6 0.000638 45 21 7 201 3 CBR1 NADH-cytochrome b5 reductase 1 Saccharomyces cerevisiae (strain YJM789)
P38626 0.00071 44 21 7 201 1 CBR1 NADH-cytochrome b5 reductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6EV97 0.000775 43 22 3 138 2 NGB Neuroglobin Oryctolagus cuniculus
Q93RE3 0.000894 44 24 10 199 3 petH Ferredoxin--NADP reductase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3KN66 0.001 42 21 3 138 2 NGB Neuroglobin Pan troglodytes
Q9NPG2 0.001 42 21 3 138 1 NGB Neuroglobin Homo sapiens

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_03080
Feature type CDS
Gene hmpA
Product NO-inducible flavohemoprotein
Location 588427 - 589608 (strand: 1)
Length 1182 (nucleotides) / 393 (amino acids)

Contig

Accession ZDB_519
Length 680340 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_532
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00042 Globin
PF00175 Oxidoreductase NAD-binding domain
PF00970 Oxidoreductase FAD-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1018 Energy production and conversion (C) C Flavodoxin/ferredoxin--NADP reductase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05916 nitric oxide dioxygenase [EC:1.14.12.17] - -

Protein Sequence

MLDVQTIATVKSTAPLIAATGPKLTAHFYDRMFRQHPELKDIFTMSHQQNGAQREALFNAVCAYAMNIDNLGALGAAVEKIANKHASLMIRPEHYPIVGENLLATIEELLNPGEEVLTAWGKAYGVLADIFIQREAGLYQEKAALQGGWEGLREFRVIRKQPQSDLITSFELAPVDDKPVADYRPGQYISVYINDDALENQEIRQYSLTQAPDGKTYRIAVKREDKGTISGWLHANVQEGDVVRLTPPLGDFFLEAEKETPVVLISAGVGLTPMMAMLQTLAAQQHPADVTWLHAAEHGGVHAFAEEVNRFGAQLPAFSQTVWYREPRADEAHPHLTGLMDLTAQQDALLSKTRHYYLCGPVAFMQHIARQLTAMGVNADQIHYECFGPHKIL

Flanking regions ( +/- flanking 50bp)

TACATGTTATAAATTTCACACTGATGTGATGCTTTTTCAGGAGCCCTGCTATGCTCGATGTACAAACTATCGCCACCGTAAAATCCACCGCCCCGCTGATTGCCGCCACCGGCCCGAAACTGACCGCCCATTTCTATGACCGCATGTTTCGTCAGCATCCTGAGTTAAAAGATATCTTCACCATGAGCCACCAGCAGAACGGCGCACAGCGTGAAGCGTTGTTTAATGCGGTCTGCGCCTATGCCATGAATATTGATAATCTCGGCGCGCTGGGTGCGGCAGTGGAAAAAATTGCCAACAAGCACGCCAGTCTGATGATCAGACCTGAGCATTATCCGATTGTCGGGGAAAACCTGCTTGCCACCATTGAAGAGTTGCTCAATCCGGGTGAGGAAGTCCTTACCGCTTGGGGGAAAGCATACGGCGTGCTGGCGGATATCTTTATTCAGCGCGAAGCCGGGCTGTATCAGGAAAAAGCGGCTTTACAGGGCGGATGGGAAGGACTGCGTGAATTCCGCGTGATCCGCAAACAGCCCCAGAGTGACCTTATTACCAGTTTCGAACTGGCGCCGGTTGATGATAAGCCTGTCGCGGATTACCGCCCGGGGCAGTATATCAGTGTCTATATCAATGATGATGCGCTGGAAAATCAGGAGATCCGCCAGTATTCCCTGACGCAGGCACCGGACGGTAAAACCTACCGGATTGCGGTCAAACGTGAAGACAAAGGTACGATTTCCGGCTGGCTGCACGCTAATGTGCAGGAAGGCGATGTGGTCAGACTGACACCACCGCTGGGGGATTTCTTCCTGGAGGCAGAAAAAGAAACCCCGGTGGTCCTGATTTCAGCCGGTGTCGGCTTAACACCGATGATGGCTATGCTGCAGACACTCGCCGCACAACAGCATCCGGCGGATGTGACCTGGCTGCACGCGGCAGAGCACGGCGGCGTGCATGCCTTTGCGGAGGAAGTAAACCGGTTTGGTGCGCAGTTGCCTGCGTTCAGCCAGACCGTCTGGTACAGAGAGCCGCGCGCAGATGAAGCTCATCCGCACCTGACCGGGCTGATGGATTTAACGGCTCAGCAGGATGCTCTGCTCAGTAAAACCCGCCACTATTACCTGTGCGGCCCGGTAGCCTTTATGCAGCACATTGCGCGTCAGCTGACTGCAATGGGCGTTAATGCAGACCAGATCCATTATGAATGTTTCGGTCCGCACAAAATTTTATAATCGCGACAGAATAACAATAACAACACGCTGGATATTCAGCGTATGTGCTT