Homologs in group_472

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00710 FBDBKF_00710 100.0 Morganella morganii S1 flgC flagellar basal body rod protein FlgC
EHELCC_00835 EHELCC_00835 100.0 Morganella morganii S2 flgC flagellar basal body rod protein FlgC
LHKJJB_04140 LHKJJB_04140 100.0 Morganella morganii S3 flgC flagellar basal body rod protein FlgC
HKOGLL_02905 HKOGLL_02905 100.0 Morganella morganii S5 flgC flagellar basal body rod protein FlgC
F4V73_RS06720 F4V73_RS06720 96.3 Morganella psychrotolerans flgC flagellar basal body rod protein FlgC
PMI_RS08070 PMI_RS08070 78.9 Proteus mirabilis HI4320 flgC flagellar basal body rod protein FlgC

Distribution of the homologs in the orthogroup group_472

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_472

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q56894 1.9e-70 210 74 0 134 3 flgC Flagellar basal-body rod protein FlgC Yersinia enterocolitica
P0ABX2 4.62e-65 196 70 0 134 3 flgC Flagellar basal-body rod protein FlgC Escherichia coli (strain K12)
P0ABX3 4.62e-65 196 70 0 134 3 flgC Flagellar basal-body rod protein FlgC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ABX4 4.62e-65 196 70 0 134 3 flgC Flagellar basal-body rod protein FlgC Escherichia coli O157:H7
P0A1I7 5.26e-63 191 68 0 134 1 flgC Flagellar basal-body rod protein FlgC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1I8 5.26e-63 191 68 0 134 3 flgC Flagellar basal-body rod protein FlgC Salmonella typhi
P57420 7.13e-45 145 51 1 136 3 flgC Flagellar basal-body rod protein FlgC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9K8 9.42e-44 143 52 1 136 3 flgC Flagellar basal-body rod protein FlgC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AH9 3.43e-34 119 42 1 136 3 flgC Flagellar basal-body rod protein FlgC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q57466 1.31e-28 105 36 2 151 3 flgC Flagellar basal-body rod protein FlgC Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P24501 2.76e-26 99 38 3 150 3 flgC Flagellar basal-body rod protein FlgC Bacillus subtilis (strain 168)
O67243 1.73e-23 91 40 4 135 3 flgC Flagellar basal-body rod protein FlgC Aquifex aeolicus (strain VF5)
Q52944 8.88e-23 89 36 1 131 3 flgC Flagellar basal-body rod protein FlgC Rhizobium meliloti (strain 1021)
Q44336 4.87e-21 85 40 1 125 3 flgC Flagellar basal-body rod protein FlgC Agrobacterium fabrum (strain C58 / ATCC 33970)
P70911 7.42e-06 43 40 0 49 3 flgC Flagellar basal-body rod protein FlgC (Fragment) Borrelia hermsii

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_02625
Feature type CDS
Gene flgC
Product flagellar basal body rod protein FlgC
Location 490764 - 491168 (strand: -1)
Length 405 (nucleotides) / 134 (amino acids)

Contig

Accession ZDB_519
Length 680340 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_472
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00460 Flagella basal body rod protein
PF06429 Flagellar basal body rod FlgEFG protein C-terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1558 Cell motility (N) N Flagellar basal body rod protein FlgC

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02388 flagellar basal-body rod protein FlgC Flagellar assembly -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG002350 flagellar basal-body rod protein FlgC VF0394 Motility

Protein Sequence

MALLSIFDISASALTAQSQRLNVSASNMANAESVAGPDGEPYRAKQVVFQTAPQGRYDIGGVKVSQLIEDPAPPRLEYKPGHPLADEKGYVRMPNVDTVGEMINTISASRSYQANLEVMNTAKVLLQKTLTLGQ

Flanking regions ( +/- flanking 50bp)

AACAGCCGCGTGAAAAGCATGCTGGCCGTCTTACAGCAAGGGTAATTCTGATGGCACTACTGAGTATTTTTGATATTTCCGCCTCCGCACTGACCGCGCAGTCCCAGCGTCTGAACGTCAGCGCCAGTAACATGGCGAACGCCGAAAGTGTGGCCGGGCCGGACGGCGAACCGTACCGTGCGAAACAGGTGGTATTTCAGACCGCGCCGCAGGGGCGCTATGACATCGGCGGCGTGAAAGTCAGCCAGTTGATTGAAGACCCGGCTCCGCCGCGTCTGGAGTACAAACCCGGTCATCCGCTGGCGGATGAAAAAGGTTATGTGCGGATGCCGAACGTGGACACTGTGGGTGAAATGATCAACACCATCTCCGCCTCCCGCAGTTATCAGGCAAACCTGGAAGTGATGAACACAGCCAAAGTGCTGTTGCAGAAAACCTTAACCCTCGGACAGTAACGGAGTGAGTCATGGGGATTAATGCAGCAACCAATGATCCGGTCAATAAC