Homologs in group_2562

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02330 FBDBKF_02330 100.0 Morganella morganii S1 ytfE iron-sulfur cluster repair protein YtfE
EHELCC_02800 EHELCC_02800 100.0 Morganella morganii S2 ytfE iron-sulfur cluster repair protein YtfE
LHKJJB_01375 LHKJJB_01375 100.0 Morganella morganii S3 ytfE iron-sulfur cluster repair protein YtfE
HKOGLL_01415 HKOGLL_01415 100.0 Morganella morganii S5 ytfE iron-sulfur cluster repair protein YtfE
F4V73_RS04705 F4V73_RS04705 90.5 Morganella psychrotolerans ytfE iron-sulfur cluster repair protein YtfE

Distribution of the homologs in the orthogroup group_2562

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2562

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A8AMI9 3.41e-115 330 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7MSU8 1.09e-114 329 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O81 (strain ED1a)
B7LLZ8 1.6e-114 328 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R342 1.6e-114 328 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli (strain UTI89 / UPEC)
B1LR94 1.6e-114 328 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli (strain SMS-3-5 / SECEC)
Q8FAH0 1.6e-114 328 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AJC0 1.6e-114 328 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O1:K1 / APEC
B7NUC3 1.6e-114 328 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UQM4 1.6e-114 328 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NGE7 8.65e-114 327 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0T9H5 8.65e-114 327 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3YUD8 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Shigella sonnei (strain Ss046)
P69505 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Shigella flexneri
Q0SXF6 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Shigella flexneri serotype 5b (strain 8401)
Q328I9 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Shigella dysenteriae serotype 1 (strain Sd197)
B2TYT0 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I2C2 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli (strain SE11)
P69506 2.85e-113 325 68 0 220 1 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli (strain K12)
B1ISZ1 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A7W5 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O9:H4 (strain HS)
B1XDV9 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli (strain K12 / DH10B)
C4ZR85 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli (strain K12 / MC4100 / BW2952)
B7LCS2 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli (strain 55989 / EAEC)
B7MLM2 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZV87 2.85e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O139:H28 (strain E24377A / ETEC)
B7M9H2 6.35e-113 325 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O8 (strain IAI1)
Q31TE9 1.53e-112 323 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Shigella boydii serotype 4 (strain Sb227)
Q57GI1 3.75e-112 323 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella choleraesuis (strain SC-B67)
B5BKL8 5.68e-112 322 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella paratyphi A (strain AKU_12601)
C0Q6G8 5.68e-112 322 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella paratyphi C (strain RKS4594)
A9N529 5.68e-112 322 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJ71 5.68e-112 322 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T3G2 5.68e-112 322 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella newport (strain SL254)
B4TFE3 5.68e-112 322 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella heidelberg (strain SL476)
B5R9F8 5.68e-112 322 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R0S8 5.68e-112 322 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella enteritidis PT4 (strain P125109)
B5FSB1 5.68e-112 322 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella dublin (strain CT_02021853)
B5F3C5 5.68e-112 322 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella agona (strain SL483)
Q8ZK76 5.81e-112 322 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A7MM70 7.09e-112 322 69 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Cronobacter sakazakii (strain ATCC BAA-894)
B4TT41 1.26e-111 321 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella schwarzengrund (strain CVM19633)
B5Z3G5 1.51e-111 321 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCH9 1.51e-111 321 68 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Escherichia coli O157:H7
B5Y301 2.33e-111 320 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Klebsiella pneumoniae (strain 342)
A6THB9 4.71e-111 320 66 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8Z157 1.05e-110 319 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Salmonella typhi
A4W5T7 2.28e-110 318 67 0 220 3 ytfE Iron-sulfur cluster repair protein YtfE Enterobacter sp. (strain 638)
Q6D142 3.49e-102 297 65 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DDN6 5.91e-102 297 65 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B2K2M0 2.66e-99 290 61 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Yersinia pseudotuberculosis serotype IB (strain PB1/+)
C6CL12 1.14e-98 288 61 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Dickeya chrysanthemi (strain Ech1591)
A4TRL8 1.16e-98 288 61 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Yersinia pestis (strain Pestoides F)
Q1CEH8 1.16e-98 288 61 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Yersinia pestis bv. Antiqua (strain Nepal516)
A9R568 1.16e-98 288 61 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Yersinia pestis bv. Antiqua (strain Angola)
Q8ZB88 1.16e-98 288 61 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Yersinia pestis
Q1CBX2 1.16e-98 288 61 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Yersinia pestis bv. Antiqua (strain Antiqua)
B1JML7 1.67e-98 288 61 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66F95 1.67e-98 288 61 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FMV8 1.67e-98 288 61 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C6CAS5 2.67e-97 285 61 1 221 3 ytfE Iron-sulfur cluster repair protein YtfE Musicola paradisiaca (strain Ech703)
C5BF83 3.73e-94 277 59 2 220 3 ytfE Iron-sulfur cluster repair protein YtfE Edwardsiella ictaluri (strain 93-146)
P45312 4.03e-82 246 54 1 220 3 HI_1677 Probable iron-sulfur cluster repair protein HI_1677 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
D6JLP0 7.1e-36 127 44 1 151 1 dnrN Iron-sulfur cluster repair protein DnrN Neisseria gonorrhoeae
D3QFZ3 8.67e-25 100 27 4 222 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus lugdunensis (strain HKU09-01)
Q4L8T8 1.25e-23 97 27 6 230 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus haemolyticus (strain JCSC1435)
B9DK35 6.41e-23 95 27 4 208 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus carnosus (strain TM300)
Q8CQ32 8e-19 84 21 3 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR69 8e-19 84 21 3 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8Z0M2 2.38e-18 83 24 4 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain USA300 / TCH1516)
A6QDN3 2.38e-18 83 24 4 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain Newman)
Q5HJB7 2.38e-18 83 24 4 223 2 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain COL)
P72360 2.38e-18 83 24 4 223 1 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK11 2.38e-18 83 24 4 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain USA300)
Q7A7U6 3.57e-18 82 24 4 223 1 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain N315)
Q99WW4 3.57e-18 82 24 4 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IPC8 3.57e-18 82 24 4 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain JH9)
A6TY44 3.57e-18 82 24 4 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain JH1)
A7WXS1 3.57e-18 82 24 4 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GK53 7.23e-18 82 24 4 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain MRSA252)
Q8NYH4 1.94e-17 80 24 4 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain MW2)
Q6GCL3 1.94e-17 80 24 4 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain MSSA476)
Q2YV69 2.06e-16 78 23 4 223 3 scdA Iron-sulfur cluster repair protein ScdA Staphylococcus aureus (strain bovine RF122 / ET3-1)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_00660
Feature type CDS
Gene ytfE
Product iron-sulfur cluster repair protein YtfE
Location 136303 - 136965 (strand: -1)
Length 663 (nucleotides) / 220 (amino acids)
In genomic island -

Contig

Accession ZDB_519
Length 680340 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2562
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01814 Hemerythrin HHE cation binding domain
PF04405 Domain of Unknown function (DUF542)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2846 Posttranslational modification, protein turnover, chaperones (O) O Iron-sulfur cluster repair protein YtfE, RIC family, contains ScdAN and hemerythrin domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07322 regulator of cell morphogenesis and NO signaling - -

Protein Sequence

MTLREKTLGELALSVNGASALFRRYDLDFCCGGKRTLAKAAEKKSLNIDEIEQALLALKDEAPAQDWRKAPLSDIIAFIITRYHDRHRAQLPELILQAEKVERVHAAKASVPKGLARQLTALHEELTSHMMKEEQVLFPMICNGMGPQAAGPVQVMEAEHDDAGDIVEVIKFITNNVTAPEEACTTWRVLYNGINTFIDDLMEHISLENNLLFPRALAGE

Flanking regions ( +/- flanking 50bp)

CCGCAGCACTGATTTATCATGGTTTATGACTGAATTTTGAGGTAATAAAAATGACATTACGTGAAAAAACCCTGGGCGAACTGGCGCTGTCTGTGAATGGTGCATCGGCACTTTTCCGCCGTTATGATCTGGATTTCTGCTGCGGCGGAAAACGGACACTGGCAAAAGCAGCAGAGAAAAAATCCCTGAATATCGATGAAATTGAACAGGCATTACTCGCCCTGAAAGATGAGGCACCGGCGCAGGACTGGCGGAAAGCCCCGCTGAGCGACATTATCGCTTTTATTATTACCCGTTATCACGATCGCCACCGCGCACAATTACCGGAACTGATTTTACAGGCGGAAAAAGTGGAGCGGGTGCATGCCGCCAAAGCCAGTGTTCCGAAAGGGCTGGCCCGGCAGCTGACAGCACTGCATGAAGAGCTGACCTCCCATATGATGAAAGAGGAACAGGTGCTGTTTCCGATGATCTGCAACGGCATGGGACCACAGGCGGCGGGGCCGGTACAGGTTATGGAAGCAGAGCATGATGATGCGGGGGATATTGTGGAGGTGATTAAATTTATCACTAATAATGTCACAGCACCGGAAGAGGCCTGTACAACCTGGCGGGTGCTGTATAACGGTATCAATACCTTCATTGATGATTTAATGGAACACATCAGCCTGGAGAATAATTTGCTGTTCCCGCGCGCCCTGGCCGGGGAATAGTTCAGCCGCTGATATCATGACGGAACAGCGGGATATACTGCCCGCCTTGC