Homologs in group_2564

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02690 FBDBKF_02690 100.0 Morganella morganii S1 lysR DNA-binding transcriptional regulator, LysR family
EHELCC_03160 EHELCC_03160 100.0 Morganella morganii S2 lysR DNA-binding transcriptional regulator, LysR family
LHKJJB_01735 LHKJJB_01735 100.0 Morganella morganii S3 lysR DNA-binding transcriptional regulator, LysR family
HKOGLL_01775 HKOGLL_01775 100.0 Morganella morganii S5 lysR DNA-binding transcriptional regulator, LysR family
F4V73_RS05185 F4V73_RS05185 93.0 Morganella psychrotolerans - LysR family transcriptional regulator

Distribution of the homologs in the orthogroup group_2564

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2564

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P52689 7.27e-40 145 30 5 294 3 ltrA Probable HTH-type transcriptional regulator LtrA Klebsiella pneumoniae
Q9JXW7 1.01e-39 144 33 6 292 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JPU9 1.35e-39 144 33 6 292 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
P43011 1.07e-38 141 31 4 276 3 HI_1364 Uncharacterized HTH-type transcriptional regulator HI_1364 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P30864 5.69e-38 140 31 4 299 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
P37641 2.07e-31 122 30 6 291 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
P67662 3.52e-31 122 28 2 289 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 3.52e-31 122 28 2 289 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 3.52e-31 122 28 2 289 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
P45463 1.25e-30 120 25 3 296 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain K12)
Q0TD46 1.47e-30 120 25 3 296 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8XBK9 1.53e-30 120 25 3 296 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O157:H7
Q1R6S1 2.52e-30 120 25 3 296 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 2.52e-30 120 25 3 296 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P76250 1.24e-29 118 29 5 288 1 dmlR HTH-type transcriptional regulator DmlR Escherichia coli (strain K12)
P77333 7.83e-22 96 25 6 290 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
P72131 5.57e-21 94 27 5 296 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P75836 1.51e-19 90 23 4 284 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
Q01610 4.67e-17 83 25 6 287 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZDG9 7.25e-17 83 22 3 295 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q765S2 8.87e-15 76 28 7 258 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
P45099 6.67e-14 74 28 5 242 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P52696 1.1e-13 73 30 4 141 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
P52660 2.39e-13 72 26 8 249 3 blaA HTH-type transcriptional regulator BlaA Proteus vulgaris
P77559 2.82e-13 72 30 3 155 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
P12529 2.66e-12 69 25 5 257 1 ampR HTH-type transcriptional activator AmpR Citrobacter freundii
P05827 5.29e-12 68 25 8 305 3 ilvY HTH-type transcriptional regulator IlvY Escherichia coli (strain K12)
P44821 9.18e-12 68 29 3 154 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P14145 1.04e-11 67 25 5 254 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
P39592 1.09e-11 68 22 3 250 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
P52666 1.92e-11 67 32 5 159 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
P0A2Q2 3e-11 66 31 1 151 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q3 3e-11 66 31 1 151 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhi
P39647 3.99e-11 66 31 0 119 1 cysL HTH-type transcriptional regulator CysL Bacillus subtilis (strain 168)
P37459 4.05e-11 66 21 9 310 3 sinR Probable HTH-type transcriptional regulator SinR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P24734 4.84e-11 66 26 7 238 1 ampR HTH-type transcriptional activator AmpR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6Z9 5.09e-11 66 23 5 260 3 bauR HTH-type transcriptional activator BauR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O68014 6.38e-11 65 27 11 269 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A0T0V5 7.16e-11 65 29 1 143 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
P07774 1.21e-10 65 23 8 276 1 catM HTH-type transcriptional regulator CatM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q04778 1.27e-10 65 34 0 122 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
P96194 1.82e-10 61 37 0 101 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
P52691 1.99e-10 64 34 4 143 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P94403 2.14e-10 63 27 4 162 3 bsdA HTH-type transcriptional regulator BsdA Bacillus subtilis (strain 168)
Q05840 2.52e-10 63 36 0 93 3 clcR HTH-type transcriptional regulator ClcR Pseudomonas putida
P0ACR0 3.89e-10 63 25 7 272 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 3.89e-10 63 25 7 272 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
P33634 4.63e-10 63 23 10 300 3 yfiE Uncharacterized HTH-type transcriptional regulator YfiE Escherichia coli (strain K12)
Q55459 7.53e-10 62 24 8 295 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P05051 1.07e-09 62 26 11 308 3 ampR HTH-type transcriptional activator AmpR Enterobacter cloacae
P46068 1.12e-09 62 22 5 284 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
P67668 1.14e-09 62 36 0 92 3 BQ2027_MB2303C Uncharacterized HTH-type transcriptional regulator Mb2303c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMF3 1.14e-09 62 36 0 92 1 Rv2282c Uncharacterized HTH-type transcriptional regulator Rv2282c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF2 1.14e-09 62 36 0 92 3 MT2340 Uncharacterized HTH-type transcriptional regulator MT2340 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0ACR8 1.25e-09 62 34 0 96 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 1.25e-09 62 34 0 96 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
O33945 1.75e-09 61 30 4 156 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
Q8FK66 1.88e-09 61 26 7 269 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 1.88e-09 61 26 7 269 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P55576 2.01e-09 61 32 2 119 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O34685 2.05e-09 61 31 2 153 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
P0ACR2 2.88e-09 60 22 10 313 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli (strain K12)
P0ACR3 2.88e-09 60 22 10 313 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli O157:H7
Q9S4Y7 3.33e-09 60 26 7 273 3 allS HTH-type transcriptional activator AllS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCH2 3.33e-09 60 26 7 273 3 allS HTH-type transcriptional activator AllS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1RF30 3.79e-09 60 26 7 269 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 3.79e-09 60 26 7 269 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
Q57S50 3.87e-09 60 26 7 273 3 allS HTH-type transcriptional activator AllS Salmonella choleraesuis (strain SC-B67)
Q8Z8R3 6.17e-09 60 26 7 273 3 allS HTH-type transcriptional activator AllS Salmonella typhi
P42427 7.3e-09 58 31 0 92 3 tfdT HTH-type transcriptional regulator TfdT Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A7Z5E4 1.23e-08 58 34 1 123 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P77744 1.27e-08 58 24 4 186 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
P0ACR4 1.64e-08 58 29 1 127 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 1.64e-08 58 29 1 127 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 1.64e-08 58 29 1 127 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
P27111 1.96e-08 58 30 4 152 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
Q5N5I5 3.17e-08 57 23 7 292 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 3.17e-08 57 23 7 292 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P55181 3.27e-08 57 22 9 296 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
P77700 3.48e-08 57 25 7 262 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
P36771 3.55e-08 57 29 5 175 1 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli (strain K12)
Q8X4M5 3.73e-08 57 31 4 152 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
P43161 3.85e-08 57 23 5 211 3 mprR Small neutral protease regulatory protein Streptomyces lividans
Q8VWE6 4.46e-08 57 29 5 175 3 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli O157:H7
Q9L127 4.5e-08 57 23 5 211 3 mprR Small neutral protease regulatory protein Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A1JI47 4.83e-08 57 29 5 168 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JQ39 5.2e-08 57 30 3 147 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 5.2e-08 57 30 3 147 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 5.2e-08 57 30 3 147 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 5.2e-08 57 30 3 147 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 5.2e-08 57 30 3 147 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 5.2e-08 57 30 3 147 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 5.2e-08 57 30 3 147 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 5.2e-08 57 30 3 147 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 5.2e-08 57 30 3 147 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P96725 5.39e-08 57 30 1 120 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
Q44311 5.46e-08 57 30 3 136 3 soxR HTH-type transcriptional regulator SoxR Arthrobacter sp. (strain TE1826)
P74422 5.52e-08 57 31 3 148 3 ntcB Probable nitrogen assimilation transcriptional activator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P52678 6.52e-08 57 46 0 64 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium leprae (strain TN)
P45349 7.82e-08 56 28 0 122 3 metR HTH-type transcriptional regulator MetR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P70785 8.66e-08 56 41 0 68 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
P52658 9.35e-08 56 22 5 249 3 ampR HTH-type transcriptional activator AmpR Citrobacter koseri
P52693 1.1e-07 56 26 2 141 3 ntcB Probable nitrogen assimilation transcriptional activator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4G384 1.44e-07 55 28 1 149 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
P23841 2.15e-07 55 25 4 158 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
P03030 2.28e-07 55 26 2 164 3 lysR Transcriptional activator protein LysR Escherichia coli (strain K12)
Q46M57 3.38e-07 54 33 0 93 1 tfdR HTH-type transcriptional regulator TdfR Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46M54 3.64e-07 54 33 0 93 1 tfdS HTH-type transcriptional regulator TfdS Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P42722 3.69e-07 54 26 3 152 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P0A9F6 3.86e-07 54 22 2 247 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 3.86e-07 54 22 2 247 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 3.86e-07 54 22 2 247 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
P45461 5.32e-07 53 21 9 313 3 ampR HTH-type transcriptional activator AmpR Yersinia enterocolitica
O32186 7.29e-07 53 30 1 119 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
P0DV33 7.9e-07 53 23 2 143 1 admX HTH-type transcriptional regulator AdmX Serratia plymuthica
P20668 8.04e-07 53 28 0 119 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
P39376 8.08e-07 53 23 5 273 1 yjiE HTH-type transcriptional regulator YjiE Escherichia coli (strain K12)
O32255 8.24e-07 53 27 2 129 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
P52669 9.22e-07 53 41 0 73 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
O07906 1.23e-06 52 26 1 118 3 yraN Uncharacterized HTH-type transcriptional regulator YraN Bacillus subtilis (strain 168)
P25544 1.27e-06 52 25 4 152 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
Q57083 1.43e-06 52 25 1 145 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
P52595 1.55e-06 52 23 6 293 3 cbbR HTH-type transcriptional regulator CbbR Rhodospirillum rubrum
A0R8S0 1.56e-06 52 35 0 82 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
A5F9F9 1.58e-06 52 22 9 299 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P0C6D1 1.67e-06 52 22 9 299 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P52665 1.98e-06 50 31 1 101 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
O87883 2.19e-06 50 32 2 140 3 oxyR Probable hydrogen peroxide-inducible genes activator (Fragment) Mycobacterium xenopi
P44418 2.41e-06 52 32 0 73 3 oxyR Hydrogen peroxide-inducible genes activator Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9X725 2.61e-06 52 34 0 73 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
Q9HWH8 2.64e-06 51 30 1 120 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q47005 2.66e-06 52 28 4 154 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
P52662 2.68e-06 52 29 1 122 3 pecT HTH-type transcriptional regulator PecT Dickeya dadantii (strain 3937)
P52667 2.69e-06 52 30 0 120 3 estR HTH-type transcriptional regulator EstR Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P71318 2.96e-06 51 34 0 73 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
P39127 3.22e-06 51 20 8 294 3 citR HTH-type transcriptional regulator CitR Bacillus subtilis (strain 168)
P77309 3.31e-06 51 27 1 121 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
P0ACQ4 3.72e-06 51 34 0 73 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 3.72e-06 51 34 0 73 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 3.72e-06 51 34 0 73 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
Q6B936 4e-06 51 29 0 123 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
P52683 4.45e-06 51 27 2 131 3 smeR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Serratia marcescens
O35038 4.82e-06 51 25 1 127 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
P16931 4.83e-06 51 25 2 138 3 dgdR HTH-type transcriptional regulator DgdR Burkholderia cepacia
P42507 4.96e-06 50 28 3 141 3 hvrB AhcY transcriptional activator HvrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P52685 5.86e-06 50 24 1 157 3 mauR Mau operon transcriptional activator Paracoccus denitrificans
Q08597 6.53e-06 50 26 3 173 3 nac Nitrogen assimilation regulatory protein nac Klebsiella aerogenes
P0A9G1 7.03e-06 50 21 6 254 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 7.03e-06 50 21 6 254 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 7.03e-06 50 21 6 254 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
P52677 8.54e-06 50 41 0 67 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium avium
P27102 8.72e-06 50 41 0 70 3 tcbR HTH-type transcriptional regulator TcbR Pseudomonas sp. (strain P51)
Q8RQM5 9.47e-06 50 37 1 67 3 lysG Lysine export transcriptional regulatory protein LysG Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q81IX0 9.55e-06 50 32 3 131 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P0A4T7 9.7e-06 50 31 0 83 3 pcaQ HTH-type transcriptional regulator PcaQ Rhizobium radiobacter
P0A4T6 9.7e-06 50 31 0 83 3 pcaQ HTH-type transcriptional regulator PcaQ Agrobacterium fabrum (strain C58 / ATCC 33970)
Q85G62 1.01e-05 50 27 0 124 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
B4SYF7 1.01e-05 50 28 4 169 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
B4TNR5 1.08e-05 50 28 4 169 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)
P0A2Q0 1.09e-05 49 28 4 169 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 1.09e-05 49 28 4 169 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 1.09e-05 49 28 4 169 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 1.09e-05 49 28 4 169 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 1.09e-05 49 28 4 169 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 1.09e-05 49 28 4 169 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TAZ8 1.09e-05 49 28 4 169 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5EZ22 1.09e-05 49 28 4 169 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
B5FN59 1.1e-05 49 28 4 169 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
Q9X5P2 1.12e-05 50 36 1 83 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
Q6HPH4 1.16e-05 49 32 3 131 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63H01 1.31e-05 49 32 3 131 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 1.31e-05 49 32 3 131 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81VJ1 1.44e-05 49 32 3 131 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
P52661 1.47e-05 49 22 5 201 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
O06703 1.47e-05 49 29 2 103 3 bbuR HTH-type transcriptional regulator BbuR Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P0DUU5 1.52e-05 49 34 1 87 1 aceR HTH-type transcriptional regulator AceR Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
P67660 1.56e-05 49 33 0 83 1 yhaJ Probable HTH-type transcriptional regulator YhaJ Escherichia coli (strain K12)
P67661 1.56e-05 49 33 0 83 1 yhaJ HTH-type transcriptional regulator YhaJ Escherichia coli O157:H7
P52676 1.72e-05 49 23 2 134 3 nmcR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Enterobacter cloacae
B2TU26 2.09e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7NF72 2.17e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P20667 2.25e-05 48 33 5 127 3 catR HTH-type transcriptional regulator CatR Pseudomonas putida
P76369 2.29e-05 48 20 7 270 3 yeeY Uncharacterized HTH-type transcriptional regulator YeeY Escherichia coli (strain K12)
Q3YVK2 2.34e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 2.34e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 2.34e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 2.34e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 2.34e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 2.34e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 2.34e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 2.34e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 2.34e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 2.34e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7UMM1 2.34e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NU32 2.36e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q329U3 2.51e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B6I4A0 2.51e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7M5B2 2.51e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 2.51e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 2.51e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 2.51e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 2.51e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
P94632 2.6e-05 48 25 11 272 1 lysG Lysine export transcriptional regulatory protein LysG Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A2CI69 2.69e-05 48 32 2 134 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
B7LUJ5 2.73e-05 48 30 5 151 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P34818 2.73e-05 48 23 3 249 3 trpI HTH-type transcriptional regulator TrpI Pseudomonas syringae pv. syringae
Q1R4H3 2.75e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 2.75e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 2.75e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 2.75e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 2.75e-05 48 33 1 101 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
P73123 2.85e-05 48 29 0 123 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A4QH19 3.95e-05 48 33 3 126 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
Q8KA72 4.36e-05 48 22 8 262 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P49518 5.41e-05 47 25 1 151 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
O19892 5.97e-05 47 27 0 125 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
P0A2Q4 7.89e-05 47 21 4 253 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 7.89e-05 47 21 4 253 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
P52684 9.68e-05 47 23 1 160 3 mauR Malonate utilization transcriptional regulator Klebsiella pneumoniae
Q88JX7 0.000113 47 38 1 77 3 galR HTH-type transcriptional regulator GalR Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P52044 0.000133 46 30 1 85 3 ygfI Uncharacterized HTH-type transcriptional regulator YgfI Escherichia coli (strain K12)
P9WMF5 0.000181 46 42 1 66 1 lysG HTH-type transcriptional regulator LysG Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF4 0.000181 46 42 1 66 3 lysG HTH-type transcriptional regulator LysG Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67666 0.000181 46 42 1 66 3 lysG HTH-type transcriptional regulator LysG Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P71025 0.000187 46 29 0 75 3 czcR HTH-type transcriptional regulator CzcR Bacillus subtilis (strain 168)
O69055 0.000196 45 45 0 46 3 ptxE Putative HTH-type transcriptional regulator protein PtxE (Fragment) Stutzerimonas stutzeri
P94387 0.000307 45 27 0 97 3 ycgK Uncharacterized HTH-type transcriptional regulator YcgK Bacillus subtilis (strain 168)
Q00678 0.000318 45 21 1 150 3 nocR Regulatory protein NocR Agrobacterium fabrum (strain C58 / ATCC 33970)
P25545 0.000323 45 21 5 197 3 cbbR HTH-type transcriptional regulator CbbR Xanthobacter flavus
P35112 0.00033 45 21 1 150 3 nocR Regulatory protein NocR Agrobacterium tumefaciens (strain T37)
P94678 0.001 43 34 0 69 1 tsaR HTH-type transcriptional regulator TsaR Comamonas testosteroni

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_00300
Feature type CDS
Gene lysR
Product DNA-binding transcriptional regulator, LysR family
Location 58151 - 59140 (strand: 1)
Length 990 (nucleotides) / 329 (amino acids)

Contig

Accession ZDB_519
Length 680340 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2564
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MLINKNTFAFKAKIDSYAIFRHLELFIKIVECNSFSGAARKLNVTPSSVSRGLQQLEEQLGVVLLKRTTRNFILTEAGRYLLQRAQQLLTDLDDSLVNTASFYQHAQGQLKITCSIAFGVCHLMRLYSEYREINPQVSLSVDLNDALINLNETDFDIALRITSHPPENFALRKLCNINWIYCGSRHYFEQNGIPQSPADIARHNCLINPNIPDTWRMNDKDGVAYPLAINNMIEVNSSLGLLEAARCHQGIVCLPTYMLGNYIDNGELLPVLLDYNPKTTPFALYALYSPAHTHAPKIRTFIDFLADKLPLDPPWDSWMYQDRAGSSPA

Flanking regions ( +/- flanking 50bp)

AAACCATTGTTATAGTAAGGGGTAACACGCAGGCTGAACAGGGCACGACTATGCTAATAAATAAAAACACTTTTGCGTTTAAAGCAAAAATTGACAGCTACGCGATTTTTCGCCATCTGGAGCTGTTTATCAAAATTGTGGAGTGCAACAGTTTCAGCGGTGCGGCACGAAAACTCAATGTAACACCGTCGTCTGTCAGCCGTGGCTTACAGCAGCTGGAAGAGCAGCTCGGTGTGGTTCTGCTGAAACGAACCACCCGCAATTTTATCCTGACTGAAGCCGGACGTTATTTATTGCAGAGGGCGCAACAGTTACTGACAGATCTCGATGACTCATTAGTGAATACGGCGAGTTTTTATCAGCACGCACAGGGACAGCTAAAAATAACCTGTTCAATTGCCTTCGGCGTCTGCCATTTAATGCGGCTTTACAGCGAATACCGGGAAATAAATCCGCAGGTCAGCTTATCCGTTGATCTGAACGATGCATTAATTAATTTAAATGAAACTGACTTTGATATTGCATTGCGTATTACCAGTCATCCGCCGGAAAATTTTGCATTACGAAAACTATGCAATATAAATTGGATCTATTGCGGCAGCCGTCATTATTTTGAACAAAACGGGATCCCGCAGTCACCGGCGGATATTGCCCGGCACAATTGTTTAATTAATCCGAATATTCCGGACACCTGGCGGATGAATGATAAAGACGGTGTAGCCTATCCGCTGGCGATCAACAATATGATTGAGGTCAACAGCAGCCTGGGATTACTGGAGGCGGCGCGCTGTCATCAGGGGATTGTCTGCCTGCCGACCTATATGCTGGGAAATTATATTGATAACGGTGAATTATTGCCGGTATTACTGGATTACAATCCGAAAACCACGCCGTTCGCGCTCTATGCTCTTTACAGCCCGGCGCACACCCATGCCCCGAAAATCCGCACCTTTATTGATTTCCTGGCGGATAAGCTGCCGCTTGACCCGCCGTGGGACAGCTGGATGTATCAGGACAGAGCAGGGAGTTCCCCGGCATAAACATAATAGGTTTCAGTCACGTCATGGCCGCCCCAGTCATAGGCTTGTGC