Homologs in group_3623

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20315 FBDBKF_20315 100.0 Morganella morganii S1 tnp IS1 family ISKpn14 transposase ORF A
EHELCC_19055 EHELCC_19055 100.0 Morganella morganii S2 tnp IS1 family ISKpn14 transposase ORF A
NLDBIP_19530 NLDBIP_19530 100.0 Morganella morganii S4 tnp IS1 family ISKpn14 transposase ORF A
HKOGLL_19410 HKOGLL_19410 100.0 Morganella morganii S5 tnp IS1 family ISKpn14 transposase ORF A

Distribution of the homologs in the orthogroup group_3623

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3623

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ADH2 1.11e-58 177 91 0 91 3 insA Insertion element IS1 protein InsA Shigella sonnei
P0ADH1 1.11e-58 177 91 0 91 3 insA Insertion element IS1 protein InsA Salmonella typhi
P59842 1.11e-58 177 91 0 91 3 insA Insertion element IS1 protein InsA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A0A385XJ53 1.11e-58 177 91 0 91 3 insA9 Insertion element IS1 9 protein InsA Escherichia coli (strain K12)
P0CF13 1.11e-58 177 91 0 91 3 insA8 Insertion element IS1 8 protein InsA Escherichia coli (strain K12)
P0CF12 1.11e-58 177 91 0 91 3 insA6 Insertion element IS1 6 protein InsA Escherichia coli (strain K12)
P0CF11 1.11e-58 177 91 0 91 3 insA5 Insertion element IS1 5 protein InsA Escherichia coli (strain K12)
P0C652 1.11e-58 177 91 0 91 3 None Insertion element IS1 protein InsA Escherichia coli
P0CF07 1.11e-58 177 91 0 91 3 insA1 Insertion element IS1 1 protein InsA Escherichia coli (strain K12)
P0CF10 3.14e-58 176 90 0 91 3 insA4 Insertion element IS1 4 protein InsA Escherichia coli (strain K12)
P0CF09 3.14e-58 176 90 0 91 3 insA3 Insertion element IS1 3 protein InsA Escherichia coli (strain K12)
P0CF06 3.14e-58 176 90 0 91 3 None Insertion element IS1 protein InsA Escherichia coli
P0CF08 3.14e-58 176 90 0 91 3 insA2 Insertion element IS1 2 protein InsA Escherichia coli (strain K12)
P03828 7.39e-58 175 90 0 91 3 insA Insertion element iso-IS1d protein InsA Shigella dysenteriae
P19763 3.89e-56 171 86 0 91 3 insA Insertion element IS1 protein InsA Shigella flexneri
P19767 1.05e-55 169 86 0 91 3 insA7 Insertion element IS1 7 protein InsA Escherichia coli (strain K12)
P03829 3.22e-26 95 46 1 91 3 insA Insertion element iso-IS1N protein InsA Shigella dysenteriae

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_19535
Feature type CDS
Gene tnp
Product IS1 family ISKpn14 transposase ORF A
Location 9581 - 9856 (strand: 1)
Length 276 (nucleotides) / 91 (amino acids)

Contig

Accession ZDB_393
Length 10442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3623
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF03811 InsA N-terminal domain
PF12759 InsA C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3677 Mobilome: prophages, transposons (X) X Transposase InsA

Protein Sequence

MASVSVCCPSCSATEGVMRNGKSTAGHQRYLCSHCRKTWQLTFTYAASQPGTHQKIIDMAMNGVGCRATARLMGVGLNTILRHLKNSGRSQ

Flanking regions ( +/- flanking 50bp)

TGCTACCAACTTGCTGATTTAGTGTATAATGGTGTTTTTGAGGTGCTCCCGTGGCTTCAGTCTCCGTCTGCTGTCCCTCCTGTTCCGCTACTGAAGGCGTGATGCGTAATGGCAAAAGTACTGCCGGGCATCAACGTTATCTCTGCTCTCACTGCCGTAAAACATGGCAGCTCACCTTCACTTATGCCGCTTCTCAGCCCGGTACACACCAGAAAATCATTGATATGGCTATGAACGGCGTCGGTTGCCGTGCCACCGCACGACTAATGGGCGTGGGCCTCAACACCATTTTGCGCCATTTAAAAAACTCAGGCCGCAGTCAGTAACCTCCCGGATACAGCCGGGCAGTGATGTCATTGTCTGTGCGGAGATGGAC