Homologs in group_3310

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10780 FBDBKF_10780 100.0 Morganella morganii S1 fimC P pilus assembly protein, chaperone PapD
EHELCC_15115 EHELCC_15115 100.0 Morganella morganii S2 fimC P pilus assembly protein, chaperone PapD
NLDBIP_14945 NLDBIP_14945 100.0 Morganella morganii S4 fimC P pilus assembly protein, chaperone PapD
HKOGLL_13020 HKOGLL_13020 100.0 Morganella morganii S5 fimC P pilus assembly protein, chaperone PapD

Distribution of the homologs in the orthogroup group_3310

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3310

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P21646 1.5e-48 162 36 5 225 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
P33342 4.15e-44 150 36 4 219 2 yehC Probable fimbrial chaperone YehC Escherichia coli (strain K12)
P33128 9.05e-42 145 38 6 224 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
P35757 2.08e-41 144 35 7 223 3 hifB Chaperone protein HifB Haemophilus influenzae
P45991 3.73e-41 143 34 5 226 3 hifB Chaperone protein HifB Haemophilus influenzae
P59590 3.56e-37 133 37 7 221 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P31697 4.18e-37 133 37 7 221 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
P33409 1.06e-34 127 36 5 209 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P62609 8.45e-34 124 35 6 217 1 focC Chaperone protein FocC Escherichia coli
P62610 8.45e-34 124 35 6 217 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P42914 2.22e-31 117 33 7 234 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
P53520 2.63e-27 107 36 6 175 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P25401 3.06e-27 107 32 8 225 1 faeE Chaperone protein FaeE Escherichia coli
P75749 9.46e-26 103 34 7 198 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
Q05433 1.51e-25 103 31 8 225 3 clpE Chaperone protein ClpE Escherichia coli
P37923 3.22e-25 102 33 9 227 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P15319 3.56e-25 102 32 9 227 1 papD Chaperone protein PapD Escherichia coli
Q8X5E4 3.82e-25 101 32 7 220 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
P75856 5.77e-25 101 31 7 220 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
P77599 6.77e-25 101 38 7 181 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P43661 9.07e-25 100 34 6 177 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P25402 9.33e-25 100 30 4 218 3 fanE Chaperone protein FanE Escherichia coli
Q8X5K6 4.59e-24 99 33 3 171 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
P26926 5.63e-23 96 30 4 218 1 caf1M Chaperone protein caf1M Yersinia pestis
P77249 1.75e-20 89 31 6 201 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
P77616 6.56e-19 85 28 9 203 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
P69966 1.52e-17 82 31 6 176 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 1.52e-17 82 31 6 176 3 psaB Chaperone protein PsaB Yersinia pestis
P40876 2.61e-17 80 29 6 224 2 ycbF Uncharacterized fimbrial chaperone YcbF Escherichia coli (strain K12)
P33387 6.94e-16 77 25 4 215 3 sefB Chaperone protein SefB Salmonella enteritidis
P53516 1.22e-15 76 29 3 187 3 afaB Chaperone protein AfaB Escherichia coli
P33407 1.99e-15 76 29 7 191 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P46004 2.84e-14 73 27 5 212 3 aggD Chaperone protein AggD Escherichia coli
P53518 4.63e-14 72 24 7 233 3 cssC Chaperone protein CssC Escherichia coli
P15483 6.78e-14 71 28 4 216 3 None Chaperone protein CS3-1 Escherichia coli
P53519 1.06e-13 71 24 7 233 3 cssC Chaperone protein CssC Escherichia coli
P46738 2.87e-12 67 27 3 187 3 nfaE Chaperone protein NfaE Escherichia coli
P42183 2.56e-07 51 43 3 80 3 prsD Chaperone protein PrsD (Fragment) Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_14400
Feature type CDS
Gene fimC
Product P pilus assembly protein, chaperone PapD
Location 17634 - 18323 (strand: 1)
Length 690 (nucleotides) / 229 (amino acids)

Contig

Accession ZDB_372
Length 141725 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3310
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Protein Sequence

MRTGILIILLLCIQVGYAGVVINTTRVIFPGNQENTEIQLTNSGEMPSLVQSWVDEGDINSSPETSSAPFMVVPPVTRIAGSGGQQLKIRVLKNNLPRDRESVFYLNVVDIPAKTATTGNTLQFALRTRIKLFYRPDDLLQPPDAVPEQISASLSGETLILKNPTPYYFTLSALVSGGDNAPSHISTVMLAPYSESRVAYTGHLSAGESVTLISINDKGRNVRTEKKLN

Flanking regions ( +/- flanking 50bp)

CAGTTCCGCGACTCTGGTTTTTTCCTACAACTGAACCGGTGGAGGACATGATGCGGACAGGCATTCTGATCATTCTGCTCCTGTGCATACAGGTGGGATACGCTGGTGTTGTCATCAATACCACGCGGGTGATTTTTCCGGGCAATCAGGAAAATACAGAAATCCAGCTGACCAACAGCGGGGAAATGCCGTCACTGGTGCAGAGCTGGGTGGATGAGGGGGATATCAATTCCTCGCCGGAAACCAGCAGTGCACCCTTTATGGTGGTACCGCCGGTGACGCGGATTGCAGGGAGCGGCGGACAACAGCTGAAAATCCGTGTTCTGAAAAATAATCTTCCCCGCGACCGGGAATCGGTTTTTTATCTCAATGTGGTGGATATTCCGGCGAAGACGGCCACCACCGGTAATACCCTGCAATTTGCCCTGCGGACACGGATAAAGCTGTTTTACCGGCCGGATGATCTTTTGCAGCCGCCGGATGCAGTCCCGGAACAGATTTCAGCCTCGTTATCAGGAGAAACACTGATTCTGAAAAACCCCACGCCTTACTATTTCACATTATCCGCGCTCGTCTCCGGCGGAGATAATGCGCCGTCACATATCAGCACCGTAATGCTCGCCCCTTATTCAGAGAGCCGGGTGGCATACACCGGGCATTTATCTGCGGGAGAGTCCGTCACGCTGATCAGCATTAATGATAAAGGGCGCAATGTGCGGACAGAGAAAAAGCTGAACTGAGAATGCCGGTCAGGTAATGACCGGCTTTTGCATTACGGGTTGAGTGCATT