Homologs in group_455

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09930 FBDBKF_09930 100.0 Morganella morganii S1 nagC Sugar kinase of the NBD/HSP70 family, may contain an N-terminal HTH domain
EHELCC_04730 EHELCC_04730 100.0 Morganella morganii S2 nagC Sugar kinase of the NBD/HSP70 family, may contain an N-terminal HTH domain
NLDBIP_04730 NLDBIP_04730 100.0 Morganella morganii S4 nagC Sugar kinase of the NBD/HSP70 family, may contain an N-terminal HTH domain
HKOGLL_12635 HKOGLL_12635 100.0 Morganella morganii S5 nagC Sugar kinase of the NBD/HSP70 family, may contain an N-terminal HTH domain
F4V73_RS00420 F4V73_RS00420 86.1 Morganella psychrotolerans - ROK family protein
PMI_RS02265 PMI_RS02265 72.1 Proteus mirabilis HI4320 - N-acetylglucosamine repressor

Distribution of the homologs in the orthogroup group_455

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_455

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AF23 0.0 572 69 0 402 3 nagC N-acetylglucosamine repressor Shigella flexneri
P0AF20 0.0 572 69 0 402 2 nagC N-acetylglucosamine repressor Escherichia coli (strain K12)
P0AF21 0.0 572 69 0 402 3 nagC N-acetylglucosamine repressor Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AF22 0.0 572 69 0 402 3 nagC N-acetylglucosamine repressor Escherichia coli O157:H7
P50456 3.06e-95 294 39 2 400 1 mlc DNA-binding transcriptional repressor Mlc Escherichia coli (strain K12)
P94490 6.15e-44 160 27 5 380 3 xylR Xylose repressor Bacillus subtilis (strain 168)
P16557 7.62e-42 154 27 4 385 3 xylR Xylose repressor Bacillus spizizenii (strain ATCC 23059 / NRRL B-14472 / W23)
P40981 1.76e-37 143 27 3 393 3 xylR Putative xylose repressor Caldicellulosiruptor sp. (strain Rt8B.4)
Q44406 4.57e-36 139 28 3 393 3 xylR Xylose repressor Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q9KCZ4 6.99e-31 124 30 5 315 3 glcK Glucokinase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9X1I0 1.18e-26 112 28 6 325 1 glk Glucokinase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
D2PPN2 3.82e-25 109 28 6 355 3 Kfla_1900 Cyclobis-(1-6)-alpha-nigerosyl repressor Kribbella flavida (strain DSM 17836 / JCM 10339 / NBRC 14399)
P76586 1.18e-18 90 25 12 352 3 yphH Uncharacterized protein YphH Escherichia coli (strain K12)
P0A4E2 1.2e-17 86 26 6 303 1 glkA Glucokinase Streptomyces lividans
P0A4E1 1.2e-17 86 26 6 303 1 glkA Glucokinase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P64706 1.51e-17 87 28 9 332 3 BQ2027_MB0495 Transcriptional regulator Mb0495 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WKV1 1.51e-17 87 28 9 332 1 Rv0485 Transcriptional regulator Rv0485 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKV0 1.51e-17 87 28 9 332 3 MT0503 Transcriptional regulator MT0503 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q668J9 1.56e-15 80 31 3 180 3 nanK N-acetylmannosamine kinase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CJY6 1.56e-15 80 31 3 180 3 nanK N-acetylmannosamine kinase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZJ5 1.56e-15 80 31 3 180 3 nanK N-acetylmannosamine kinase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCG9 1.56e-15 80 31 3 180 3 nanK N-acetylmannosamine kinase Yersinia pestis
B2K945 1.56e-15 80 31 3 180 3 nanK N-acetylmannosamine kinase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5U9 1.56e-15 80 31 3 180 3 nanK N-acetylmannosamine kinase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FG96 1.56e-15 80 31 3 180 3 nanK N-acetylmannosamine kinase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P26832 1.65e-15 80 24 11 306 3 CPE0188 Uncharacterized protein CPE0188 Clostridium perfringens (strain 13 / Type A)
A4TMJ3 1.65e-15 79 31 3 180 3 nanK N-acetylmannosamine kinase Yersinia pestis (strain Pestoides F)
B1JFW2 1.68e-15 79 31 3 180 3 nanK N-acetylmannosamine kinase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
P54495 2.24e-15 80 25 3 306 1 glcK Glucokinase Bacillus subtilis (strain 168)
Q56198 8.37e-15 78 25 9 317 3 glkA Glucokinase Staphylococcus xylosus
Q9CKB3 3.94e-14 75 27 3 188 1 nanK N-acetylmannosamine kinase Pasteurella multocida (strain Pm70)
A5UB07 2.22e-13 73 25 1 179 3 nanK N-acetylmannosamine kinase Haemophilus influenzae (strain PittEE)
Q4QP43 5.19e-13 72 25 1 179 1 nanK N-acetylmannosamine kinase Haemophilus influenzae (strain 86-028NP)
A5UFU9 7.97e-13 72 25 1 179 3 nanK N-acetylmannosamine kinase Haemophilus influenzae (strain PittGG)
P44541 8.12e-13 72 25 1 179 1 nanK N-acetylmannosamine kinase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P21940 1.13e-12 72 23 14 381 3 xylR Xylose repressor Lactiplantibacillus pentosus
P27159 3.88e-12 70 22 9 331 3 xylR Xylose repressor Staphylococcus xylosus
B7LRJ0 2.35e-11 67 26 6 288 3 nanK N-acetylmannosamine kinase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A8A532 5.27e-11 66 26 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli O9:H4 (strain HS)
B1IQQ7 5.57e-11 66 26 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B4TWI7 1.29e-10 65 24 6 269 3 nanK N-acetylmannosamine kinase Salmonella schwarzengrund (strain CVM19633)
B7LHT0 1.55e-10 65 26 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli (strain 55989 / EAEC)
A7ZSB5 1.82e-10 65 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli O139:H28 (strain E24377A / ETEC)
A1AGB6 1.99e-10 64 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli O1:K1 / APEC
B7MBY4 1.99e-10 64 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8Z3F1 2.4e-10 64 24 6 269 3 nanK N-acetylmannosamine kinase Salmonella typhi
P59437 2.6e-10 64 25 6 285 3 nanK N-acetylmannosamine kinase Shigella flexneri
Q0T068 2.6e-10 64 25 6 285 3 nanK N-acetylmannosamine kinase Shigella flexneri serotype 5b (strain 8401)
Q8FD60 2.83e-10 64 25 6 288 3 nanK1 N-acetylmannosamine kinase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8AQB2 2.86e-10 64 25 6 269 3 nanK N-acetylmannosamine kinase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0TCP4 2.91e-10 64 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P23917 2.96e-10 64 21 3 266 1 mak Fructokinase Escherichia coli (strain K12)
B4T747 3.46e-10 64 24 6 269 3 nanK N-acetylmannosamine kinase Salmonella newport (strain SL254)
B5R0K9 3.46e-10 64 24 6 269 3 nanK N-acetylmannosamine kinase Salmonella enteritidis PT4 (strain P125109)
B5FIR5 3.46e-10 64 24 6 269 3 nanK N-acetylmannosamine kinase Salmonella dublin (strain CT_02021853)
B4TJR0 4.2e-10 63 24 6 269 3 nanK N-acetylmannosamine kinase Salmonella heidelberg (strain SL476)
B6I1U0 4.44e-10 63 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli (strain SE11)
B7NKT3 4.65e-10 63 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YSU9 4.82e-10 63 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9H0 4.82e-10 63 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli O157:H7
B5F7J6 4.96e-10 63 25 6 269 3 nanK N-acetylmannosamine kinase Salmonella agona (strain SL483)
B1LGI7 5.24e-10 63 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli (strain SMS-3-5 / SECEC)
Q8ZLQ8 5.39e-10 63 24 6 269 3 nanK N-acetylmannosamine kinase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BGP2 5.39e-10 63 24 6 269 3 nanK N-acetylmannosamine kinase Salmonella paratyphi A (strain AKU_12601)
Q5PLF2 5.39e-10 63 24 6 269 3 nanK N-acetylmannosamine kinase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RET4 8e-10 63 25 6 269 3 nanK N-acetylmannosamine kinase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9N830 8.08e-10 63 24 6 269 3 nanK N-acetylmannosamine kinase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
P45425 8.54e-10 62 25 6 288 1 nanK N-acetylmannosamine kinase Escherichia coli (strain K12)
B1XHJ5 8.54e-10 62 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli (strain K12 / DH10B)
C4ZSW0 8.54e-10 62 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli (strain K12 / MC4100 / BW2952)
B2U1W2 9.62e-10 62 27 9 292 3 nanK N-acetylmannosamine kinase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A9MNY9 1.2e-09 62 24 7 270 3 nanK N-acetylmannosamine kinase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q9Y223 1.22e-09 63 25 5 208 1 GNE Bifunctional UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase Homo sapiens
B7UJV5 1.24e-09 62 25 6 288 3 nanK N-acetylmannosamine kinase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A3MUZ0 1.42e-09 62 26 5 198 1 Pcal_1032 Glucokinase Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
Q4QP08 7.19e-09 60 22 7 268 3 nagK N-acetyl-D-glucosamine kinase Haemophilus influenzae (strain 86-028NP)
Q91WG8 1.17e-08 60 24 5 208 1 Gne Bifunctional UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase Mus musculus
O35826 1.19e-08 60 24 5 208 1 Gne Bifunctional UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase Rattus norvegicus
Q93LQ8 1.23e-08 59 24 9 270 1 bglK Beta-glucoside kinase Klebsiella pneumoniae
P32718 1.44e-08 59 24 10 275 1 alsK D-allose kinase Escherichia coli (strain K12)
P55455 2.05e-08 59 24 3 203 3 NGR_a03650 Uncharacterized protein y4fQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9KRV2 2.89e-08 58 22 6 261 3 nagK N-acetyl-D-glucosamine kinase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P44554 3.23e-08 58 22 7 268 3 nagK N-acetyl-D-glucosamine kinase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7TQ49 4.65e-08 58 24 5 208 1 GNE Bifunctional UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase Cricetulus griseus
P43468 6.59e-08 57 25 3 151 3 scrK Fructokinase Pediococcus pentosaceus
Q9CMX5 2.38e-07 55 22 2 207 3 nagK N-acetyl-D-glucosamine kinase Pasteurella multocida (strain Pm70)
Q8FDU8 3.05e-07 55 29 2 117 3 nanK2 N-acetylmannosamine kinase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O05510 4.99e-07 54 25 7 216 1 gmuE Putative fructokinase Bacillus subtilis (strain 168)
Q8D612 5.94e-07 54 27 3 147 3 nanK N-acetylmannosamine kinase Vibrio vulnificus (strain CMCP6)
Q7MD31 2.07e-06 52 28 1 112 3 nanK N-acetylmannosamine kinase Vibrio vulnificus (strain YJ016)
A1JL75 3.97e-06 52 25 4 167 3 nagK N-acetyl-D-glucosamine kinase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q0I4A5 4.59e-06 51 22 5 209 3 nagK N-acetyl-D-glucosamine kinase Histophilus somni (strain 129Pt)
Q65SC6 4.69e-06 51 20 6 264 3 nagK N-acetyl-D-glucosamine kinase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
G0FS68 4.71e-06 51 27 9 272 1 rifN Kanosamine kinase Amycolatopsis mediterranei (strain S699)
Q8FIM5 1.03e-05 50 22 7 271 3 nagK N-acetyl-D-glucosamine kinase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q669P5 1.51e-05 50 23 4 212 3 nagK N-acetyl-D-glucosamine kinase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K721 1.51e-05 50 23 4 212 3 nagK N-acetyl-D-glucosamine kinase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JI57 1.58e-05 50 23 4 212 3 nagK N-acetyl-D-glucosamine kinase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FH52 1.78e-05 50 23 4 212 3 nagK N-acetyl-D-glucosamine kinase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B7VNU4 2.86e-05 49 22 3 209 3 nagK N-acetyl-D-glucosamine kinase Vibrio atlanticus (strain LGP32)
Q6D662 4.28e-05 48 21 5 271 3 nagK N-acetyl-D-glucosamine kinase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1CI48 0.000186 46 26 2 142 3 nagK N-acetyl-D-glucosamine kinase Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WGE8 0.000186 46 26 2 142 3 nagK N-acetyl-D-glucosamine kinase Yersinia pestis
Q1C6R0 0.000186 46 26 2 142 3 nagK N-acetyl-D-glucosamine kinase Yersinia pestis bv. Antiqua (strain Antiqua)
Q7MKQ9 0.000191 46 23 4 209 3 nagK N-acetyl-D-glucosamine kinase Vibrio vulnificus (strain YJ016)
Q8D9M7 0.000191 46 23 4 209 1 nagK N-acetyl-D-glucosamine kinase Vibrio vulnificus (strain CMCP6)
Q87PK8 0.000284 46 25 5 209 3 nagK N-acetyl-D-glucosamine kinase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_13900
Feature type CDS
Gene nagC
Product Sugar kinase of the NBD/HSP70 family, may contain an N-terminal HTH domain
Location 59335 - 60570 (strand: -1)
Length 1236 (nucleotides) / 411 (amino acids)
In genomic island -

Contig

Accession ZDB_371
Length 143607 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_455
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00480 ROK family
PF01047 MarR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1940 Carbohydrate transport and metabolism (G)
Transcription (K)
GK Sugar kinase of the NBD/HSP70 family, may contain an N-terminal HTH domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02565 N-acetylglucosamine repressor - -

Protein Sequence

MGNGIPQIGNIDLVKQLNGAVVYRLIDRSGPISRIQIAEQSQLAPASVTKITRQLLERGLIKEVDQQASTGGRRAISIISEHRAFQTIGVRLGRHDATIALFDLSGRALEEETCPLEATSQADAEAKLIALIDNFRQTHQRRIRELIAIAVILPGLVDPDLGIVRYMPHITVSDWPLTENLHHHFKLPCYAGHDIRSLALAEHYFGATRDCADSLLVRIHRGAGAGIIINNQILLNRRGNLGEIGHIQIDPLGERCHCGNFGCLETVASDAAIETRVKHQLAQGFESELTPDNCSIRAICRAANRGDALAAEVIKQVGNSLGKAIAITINLFNPQKVVIAGEITAAENVLLPALQSCINTQSLKNFREDLPVVISQLPPNSAIGAFALIKRAMLYGELLLHVLENKPDTAE

Flanking regions ( +/- flanking 50bp)

GACAATCGTTAACGGGAATGTGGTCCATACATCATGAGTAAAAGACGCCGATGGGTAACGGAATTCCGCAGATAGGTAATATTGATTTAGTCAAACAGCTGAACGGGGCGGTGGTTTACCGCCTGATAGACCGTTCCGGCCCGATTTCACGCATTCAGATTGCCGAACAAAGTCAGCTGGCACCCGCCAGCGTGACCAAAATTACCCGTCAGCTTCTTGAGCGCGGCCTGATAAAAGAGGTGGATCAGCAGGCATCCACCGGCGGACGCCGCGCTATCTCCATTATTTCCGAGCACCGCGCCTTCCAGACTATCGGCGTGCGTCTCGGCCGCCATGATGCCACTATCGCACTGTTTGATCTCAGCGGACGGGCGCTCGAAGAAGAGACCTGTCCCCTGGAAGCCACTTCTCAGGCAGATGCGGAAGCTAAACTCATTGCGCTGATCGACAACTTCAGACAGACGCACCAGCGCCGCATCCGCGAGCTTATCGCTATTGCGGTGATACTGCCCGGACTGGTCGATCCGGATCTCGGTATTGTGCGCTATATGCCTCACATTACTGTCAGTGACTGGCCGCTGACTGAAAATCTTCATCACCATTTTAAACTGCCGTGCTATGCCGGCCATGATATCCGCAGCCTCGCGCTGGCCGAACACTATTTCGGCGCCACGCGCGATTGCGCGGATTCCCTGCTGGTGCGTATTCACCGGGGGGCCGGGGCGGGGATCATTATCAACAATCAGATCCTGCTGAACCGGCGTGGTAATCTCGGCGAAATCGGCCATATTCAGATAGATCCGCTCGGCGAACGCTGCCACTGCGGAAACTTCGGCTGTCTGGAAACAGTCGCGTCGGATGCCGCCATTGAAACCCGGGTAAAACACCAGCTGGCTCAGGGATTTGAGAGTGAACTGACGCCGGATAACTGCTCCATCCGGGCCATCTGCCGTGCCGCTAACCGGGGGGATGCTCTCGCGGCAGAAGTGATAAAACAGGTCGGTAATTCCCTCGGAAAAGCCATTGCCATCACAATAAACCTGTTTAACCCGCAAAAAGTGGTGATTGCCGGTGAGATAACCGCCGCTGAAAATGTGCTGCTCCCTGCTCTGCAAAGCTGCATAAATACGCAGTCGCTGAAAAATTTCCGCGAGGATCTGCCGGTGGTGATTTCACAGCTGCCGCCGAACTCCGCTATCGGGGCATTTGCCCTGATAAAACGGGCGATGCTGTACGGTGAACTGCTGCTGCATGTTCTGGAAAATAAACCGGATACGGCGGAATAATCCGCCACCGGATAAATGCGTCAACTCCGTGATTTTATCCTGTTTTTTGT