Homologs in group_1281

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07110 FBDBKF_07110 100.0 Morganella morganii S1 rarA Replication-associated recombination protein RarA (DNA-dependent ATPase)
EHELCC_03860 EHELCC_03860 100.0 Morganella morganii S2 rarA Replication-associated recombination protein RarA (DNA-dependent ATPase)
NLDBIP_03860 NLDBIP_03860 100.0 Morganella morganii S4 rarA Replication-associated recombination protein RarA (DNA-dependent ATPase)
HKOGLL_09285 HKOGLL_09285 100.0 Morganella morganii S5 rarA Replication-associated recombination protein RarA (DNA-dependent ATPase)
F4V73_RS01295 F4V73_RS01295 96.2 Morganella psychrotolerans - replication-associated recombination protein A
PMI_RS03440 PMI_RS03440 85.5 Proteus mirabilis HI4320 - replication-associated recombination protein A

Distribution of the homologs in the orthogroup group_1281

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1281

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AAZ4 0.0 802 86 0 447 1 rarA Replication-associated recombination protein A Escherichia coli (strain K12)
P0AAZ5 0.0 802 86 0 447 3 rarA Replication-associated recombination protein A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAZ6 0.0 802 86 0 447 3 rarA Replication-associated recombination protein A Escherichia coli O157:H7
P45262 0.0 677 72 1 447 3 rarA Replication-associated recombination protein A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P39918 0.0 515 57 3 437 3 rarA Replication-associated recombination protein A Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P9WQN1 1.72e-105 323 44 4 428 1 Rv2559c Uncharacterized AAA domain-containing protein Rv2559c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQN0 1.72e-105 323 44 4 428 3 MT2636 Uncharacterized AAA domain-containing protein MT2636 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q75JU2 1.05e-102 328 40 3 428 3 wrnip1 ATPase WRNIP1 Dictyostelium discoideum
Q91XU0 9.9e-101 317 42 10 439 1 Wrnip1 ATPase WRNIP1 Mus musculus
Q8CG07 2.4e-100 316 41 9 439 1 Wrnip1 ATPase WRNIP1 Rattus norvegicus
O13984 3.69e-99 308 42 6 414 3 SPAC26H5.02c ATPase WRNIP1 homolog C26H5.02c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q96S55 4.85e-99 313 41 9 439 1 WRNIP1 ATPase WRNIP1 Homo sapiens
O34528 1.35e-95 296 39 3 409 3 yrvN Uncharacterized AAA domain-containing protein YrvN Bacillus subtilis (strain 168)
P40151 8.23e-94 297 40 14 452 1 MGS1 DNA-dependent ATPase MGS1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9WYX8 8.51e-85 274 37 6 421 3 TM_0508 Uncharacterized protein TM_0508 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B9MRB3 2.19e-15 80 39 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A4XJS3 3.35e-15 80 40 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q8K983 2.54e-13 74 26 8 254 3 dnaX DNA polymerase III subunit gamma Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q183N8 1.24e-12 72 36 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridioides difficile (strain 630)
Q8RE97 1.59e-12 72 35 4 124 3 ruvB Holliday junction branch migration complex subunit RuvB Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B0K0L8 1.78e-12 71 37 4 128 3 ruvB Holliday junction branch migration complex subunit RuvB Thermoanaerobacter sp. (strain X514)
B0K956 1.78e-12 71 37 4 128 3 ruvB Holliday junction branch migration complex subunit RuvB Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q8XJ14 2.8e-12 71 30 15 277 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium perfringens (strain 13 / Type A)
Q8RAN2 3.5e-12 70 37 5 135 3 ruvB Holliday junction branch migration complex subunit RuvB Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A7GHT8 4.02e-12 70 33 5 152 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IMF3 4.02e-12 70 33 5 152 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium botulinum (strain Okra / Type B1)
C1FKG1 4.02e-12 70 33 5 152 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium botulinum (strain Kyoto / Type A2)
C3KTD2 4.02e-12 70 33 5 152 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium botulinum (strain 657 / Type Ba4)
Q0TP13 4.33e-12 70 30 15 277 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SRN3 5.06e-12 70 30 15 277 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium perfringens (strain SM101 / Type A)
C0ZAN4 6.17e-12 70 36 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A6TQM5 6.78e-12 70 36 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Alkaliphilus metalliredigens (strain QYMF)
B1L0B2 8.98e-12 69 33 5 152 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium botulinum (strain Loch Maree / Type A3)
A5I6F1 9.14e-12 69 33 5 152 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FY19 9.14e-12 69 33 5 152 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium botulinum (strain ATCC 19397 / Type A)
A3DBU4 1.12e-11 69 29 9 243 3 ruvB Holliday junction branch migration complex subunit RuvB Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q891Z8 1.18e-11 69 35 4 119 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium tetani (strain Massachusetts / E88)
B9LBR4 1.24e-11 69 33 4 136 3 ruvB Holliday junction branch migration complex subunit RuvB Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WHF8 1.24e-11 69 33 4 136 3 ruvB Holliday junction branch migration complex subunit RuvB Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A5N206 1.38e-11 69 33 5 139 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E5Q8 1.38e-11 69 33 5 139 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium kluyveri (strain NBRC 12016)
A8MHI3 1.57e-11 68 28 10 253 3 ruvB Holliday junction branch migration complex subunit RuvB Alkaliphilus oremlandii (strain OhILAs)
B8G5S6 1.62e-11 68 33 4 136 3 ruvB Holliday junction branch migration complex subunit RuvB Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q5SL87 2.15e-11 68 33 8 179 1 ruvB Holliday junction branch migration complex subunit RuvB Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B0JY77 2.21e-11 68 36 4 122 3 ruvB Holliday junction branch migration complex subunit RuvB Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P61537 2.55e-11 68 33 8 179 3 ruvB Holliday junction branch migration complex subunit RuvB Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q1RHZ9 2.77e-11 68 33 4 132 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia bellii (strain RML369-C)
A8GWC4 2.77e-11 68 33 4 132 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia bellii (strain OSU 85-389)
P57892 3e-11 68 29 6 183 3 ruvB Holliday junction branch migration complex subunit RuvB Pasteurella multocida (strain Pm70)
B0TF70 3.96e-11 67 28 12 281 3 ruvB Holliday junction branch migration complex subunit RuvB Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q97GT1 3.99e-11 67 35 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q7VIU8 4.32e-11 67 27 7 229 3 ruvB Holliday junction branch migration complex subunit RuvB Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B9E718 5.03e-11 67 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Macrococcus caseolyticus (strain JCSC5402)
Q56214 6.25e-11 67 35 4 126 1 ruvB Holliday junction branch migration complex subunit RuvB Thermus thermophilus
A7H910 6.82e-11 67 34 4 126 3 ruvB Holliday junction branch migration complex subunit RuvB Anaeromyxobacter sp. (strain Fw109-5)
A8F5R0 7.45e-11 67 27 9 254 3 ruvB Holliday junction branch migration complex subunit RuvB Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q2RHT7 8.38e-11 66 34 4 135 3 ruvB Holliday junction branch migration complex subunit RuvB Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q1LTF3 8.48e-11 66 27 8 250 3 ruvB Holliday junction branch migration complex subunit RuvB Baumannia cicadellinicola subsp. Homalodisca coagulata
P38629 8.53e-11 66 27 5 210 1 RFC3 Replication factor C subunit 3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0PZV4 8.67e-11 66 29 11 260 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium novyi (strain NT)
B1LAU3 9.48e-11 66 32 6 167 3 ruvB Holliday junction branch migration complex subunit RuvB Thermotoga sp. (strain RQ2)
A5ILH0 9.48e-11 66 32 6 167 3 ruvB Holliday junction branch migration complex subunit RuvB Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q56313 1.01e-10 66 32 6 167 1 ruvB Holliday junction branch migration complex subunit RuvB Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
C5B9T2 1.16e-10 66 27 8 243 3 ruvB Holliday junction branch migration complex subunit RuvB Edwardsiella ictaluri (strain 93-146)
Q2SCL3 1.23e-10 66 35 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Hahella chejuensis (strain KCTC 2396)
B5YKE9 1.29e-10 65 35 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q5QYU5 1.45e-10 65 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B1JLL0 1.74e-10 65 29 8 241 3 ruvB Holliday junction branch migration complex subunit RuvB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66AT9 1.74e-10 65 29 8 241 3 ruvB Holliday junction branch migration complex subunit RuvB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TJK0 1.74e-10 65 29 8 241 3 ruvB Holliday junction branch migration complex subunit RuvB Yersinia pestis (strain Pestoides F)
Q1CJG5 1.74e-10 65 29 8 241 3 ruvB Holliday junction branch migration complex subunit RuvB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZEU5 1.74e-10 65 29 8 241 3 ruvB Holliday junction branch migration complex subunit RuvB Yersinia pestis
B2K324 1.74e-10 65 29 8 241 3 ruvB Holliday junction branch migration complex subunit RuvB Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C814 1.74e-10 65 29 8 241 3 ruvB Holliday junction branch migration complex subunit RuvB Yersinia pestis bv. Antiqua (strain Antiqua)
A7FIC5 1.74e-10 65 29 8 241 3 ruvB Holliday junction branch migration complex subunit RuvB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C0QKP4 2e-10 65 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B2TMZ2 2.11e-10 65 35 4 119 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium botulinum (strain Eklund 17B / Type B)
A9QYX2 2.11e-10 65 28 8 241 3 ruvB Holliday junction branch migration complex subunit RuvB Yersinia pestis bv. Antiqua (strain Angola)
B6IYU2 2.15e-10 65 33 4 139 3 ruvB Holliday junction branch migration complex subunit RuvB Coxiella burnetii (strain CbuG_Q212)
Q83BE0 2.19e-10 65 33 4 139 3 ruvB Holliday junction branch migration complex subunit RuvB Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N9A3 2.19e-10 65 33 4 139 3 ruvB Holliday junction branch migration complex subunit RuvB Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KF39 2.19e-10 65 33 4 139 3 ruvB Holliday junction branch migration complex subunit RuvB Coxiella burnetii (strain Dugway 5J108-111)
B6J507 2.19e-10 65 33 4 139 3 ruvB Holliday junction branch migration complex subunit RuvB Coxiella burnetii (strain CbuK_Q154)
A8EZ44 2.45e-10 65 31 5 141 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia canadensis (strain McKiel)
Q87D00 2.53e-10 65 29 7 233 3 ruvB Holliday junction branch migration complex subunit RuvB Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I4T1 2.53e-10 65 29 7 233 3 ruvB Holliday junction branch migration complex subunit RuvB Xylella fastidiosa (strain M23)
A3D481 2.74e-10 65 35 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q5E699 2.9e-10 65 28 7 232 3 ruvB Holliday junction branch migration complex subunit RuvB Aliivibrio fischeri (strain ATCC 700601 / ES114)
B2V338 3.25e-10 65 35 4 119 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium botulinum (strain Alaska E43 / Type E3)
Q1D2J8 3.35e-10 64 31 11 247 3 ruvB Holliday junction branch migration complex subunit RuvB Myxococcus xanthus (strain DK1622)
A7HJD6 3.43e-10 64 30 6 181 3 ruvB Holliday junction branch migration complex subunit RuvB Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
A6VQA3 3.58e-10 64 25 7 244 3 ruvB Holliday junction branch migration complex subunit RuvB Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A8FUX0 3.59e-10 64 28 7 233 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella sediminis (strain HAW-EB3)
B5FCQ2 3.7e-10 64 27 7 233 3 ruvB Holliday junction branch migration complex subunit RuvB Aliivibrio fischeri (strain MJ11)
Q2LRA8 3.77e-10 64 35 5 128 3 ruvB Holliday junction branch migration complex subunit RuvB Syntrophus aciditrophicus (strain SB)
A7MEA3 4.07e-10 64 28 8 231 3 ruvB Holliday junction branch migration complex subunit RuvB Cronobacter sakazakii (strain ATCC BAA-894)
A8F1F7 4.61e-10 64 30 5 142 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia massiliae (strain Mtu5)
A6LTM7 4.75e-10 64 32 4 135 3 ruvB Holliday junction branch migration complex subunit RuvB Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C4K2D4 5.73e-10 64 28 14 283 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia peacockii (strain Rustic)
Q7M879 5.86e-10 63 35 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A7NNH1 6.01e-10 64 34 4 124 3 ruvB Holliday junction branch migration complex subunit RuvB Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B2TWQ1 6.51e-10 63 30 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7VMI4 6.53e-10 63 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Vibrio atlanticus (strain LGP32)
Q0AX16 6.7e-10 63 36 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A0RN84 6.97e-10 63 33 2 115 3 ruvB Holliday junction branch migration complex subunit RuvB Campylobacter fetus subsp. fetus (strain 82-40)
A8GN97 7e-10 63 31 5 141 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia akari (strain Hartford)
B7LPI4 7.07e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LD11 7.07e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli (strain SMS-3-5 / SECEC)
B7NBL1 7.07e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FGR3 7.07e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX2 7.07e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NS58 7.07e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7USN7 7.07e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q92M92 7.16e-10 63 35 3 125 3 ruvB Holliday junction branch migration complex subunit RuvB Rhizobium meliloti (strain 1021)
Q32HA1 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shigella dysenteriae serotype 1 (strain Sd197)
Q322E6 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shigella boydii serotype 4 (strain Sb227)
Q1RAS4 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli (strain UTI89 / UPEC)
B6IBT9 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli (strain SE11)
P0A812 7.33e-10 63 31 3 115 1 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli (strain K12)
B1J0M8 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A1AC21 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O1:K1 / APEC
A8A160 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O9:H4 (strain HS)
B1XHC8 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli (strain K12 / DH10B)
C4ZQE4 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli (strain K12 / MC4100 / BW2952)
B7M2F1 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O8 (strain IAI1)
B7MVZ1 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O81 (strain ED1a)
B5YR05 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A813 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O157:H7
B7L7R3 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli (strain 55989 / EAEC)
B7MBR9 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZMY4 7.33e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83KR5 7.39e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shigella flexneri
Q0T3U6 7.39e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shigella flexneri serotype 5b (strain 8401)
Q3Z2L8 7.81e-10 63 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shigella sonnei (strain Ss046)
A8FFR2 8.14e-10 63 33 4 136 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus pumilus (strain SAFR-032)
O74111 8.42e-10 63 24 8 300 3 RFC3 Replication factor C subunit 3 Blastobotrys adeninivorans
A8GRW7 8.54e-10 63 30 5 141 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia rickettsii (strain Sheila Smith)
A4WBL8 8.7e-10 63 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Enterobacter sp. (strain 638)
B8CNY1 8.78e-10 63 30 6 193 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella piezotolerans (strain WP3 / JCM 13877)
Q5HAK4 8.83e-10 63 32 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Ehrlichia ruminantium (strain Welgevonden)
Q5FG39 8.83e-10 63 32 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Ehrlichia ruminantium (strain Gardel)
A8AFI1 9.27e-10 63 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B3CMH5 9.29e-10 63 31 3 129 3 ruvB Holliday junction branch migration complex subunit RuvB Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q92I87 9.51e-10 63 30 5 141 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PNA6 9.6e-10 63 30 5 141 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia africae (strain ESF-5)
A5CW96 9.69e-10 63 31 4 145 3 ruvB Holliday junction branch migration complex subunit RuvB Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B6EGJ4 9.76e-10 63 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Aliivibrio salmonicida (strain LFI1238)
A5IC73 1.01e-09 63 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Legionella pneumophila (strain Corby)
Q5X4Y6 1.01e-09 63 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Legionella pneumophila (strain Paris)
Q483C4 1.01e-09 63 34 4 115 3 ruvB Holliday junction branch migration complex subunit RuvB Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5WWK4 1.01e-09 63 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Legionella pneumophila (strain Lens)
Q5ZV64 1.05e-09 63 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
O26342 1.1e-09 63 26 8 254 1 rfcL Replication factor C large subunit Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q2NTI8 1.17e-09 63 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Sodalis glossinidius (strain morsitans)
A2C563 1.19e-09 63 27 11 256 3 ruvB Holliday junction branch migration complex subunit RuvB Prochlorococcus marinus (strain NATL1A)
Q3AND8 1.31e-09 63 28 10 263 3 ruvB Holliday junction branch migration complex subunit RuvB Synechococcus sp. (strain CC9605)
Q4ULW6 1.32e-09 63 30 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
C4K7I4 1.36e-09 62 32 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q46IJ6 1.37e-09 63 27 11 256 3 ruvB Holliday junction branch migration complex subunit RuvB Prochlorococcus marinus (strain NATL2A)
A1S6N8 1.45e-09 62 34 4 128 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A9KP49 1.5e-09 62 30 3 139 3 ruvB Holliday junction branch migration complex subunit RuvB Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q817W4 1.6e-09 62 32 2 121 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B1YJR1 1.7e-09 62 36 4 119 3 ruvB Holliday junction branch migration complex subunit RuvB Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B8EK46 1.75e-09 62 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
C0R250 1.8e-09 62 29 4 147 3 ruvB Holliday junction branch migration complex subunit RuvB Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q87QU7 1.99e-09 62 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A8H545 2.07e-09 62 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1JRJ5 2.07e-09 62 28 8 241 3 ruvB Holliday junction branch migration complex subunit RuvB Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q11DH7 2.2e-09 62 34 4 121 3 ruvB Holliday junction branch migration complex subunit RuvB Chelativorans sp. (strain BNC1)
Q30PX6 2.24e-09 62 26 7 236 3 ruvB Holliday junction branch migration complex subunit RuvB Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
B9KZ09 2.29e-09 62 35 5 128 3 ruvB Holliday junction branch migration complex subunit RuvB Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A6UCT7 2.35e-09 62 34 4 131 3 ruvB Holliday junction branch migration complex subunit RuvB Sinorhizobium medicae (strain WSM419)
Q3ABY0 2.39e-09 62 31 5 138 3 ruvB Holliday junction branch migration complex subunit RuvB Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B0U2E3 2.42e-09 62 29 7 233 3 ruvB Holliday junction branch migration complex subunit RuvB Xylella fastidiosa (strain M12)
B0TSA7 2.43e-09 62 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella halifaxensis (strain HAW-EB4)
A8GFI7 2.43e-09 62 30 3 124 3 ruvB Holliday junction branch migration complex subunit RuvB Serratia proteamaculans (strain 568)
Q9PC79 2.51e-09 62 29 7 233 3 ruvB Holliday junction branch migration complex subunit RuvB Xylella fastidiosa (strain 9a5c)
Q6HDA6 2.53e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634C4 2.53e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus cereus (strain ZK / E33L)
Q24UN7 2.53e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Desulfitobacterium hafniense (strain Y51)
B8FQV5 2.53e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A5UVZ9 2.68e-09 62 34 4 124 3 ruvB Holliday junction branch migration complex subunit RuvB Roseiflexus sp. (strain RS-1)
A5D3G1 2.7e-09 62 31 13 245 3 ruvB Holliday junction branch migration complex subunit RuvB Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B9IYZ4 2.7e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus cereus (strain Q1)
Q6LT48 2.78e-09 62 30 3 131 3 ruvB Holliday junction branch migration complex subunit RuvB Photobacterium profundum (strain SS9)
B7HQH9 2.8e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus cereus (strain AH187)
P61528 2.8e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus cereus (strain ATCC 10987 / NRS 248)
B0UVK4 2.91e-09 62 29 6 181 3 ruvB Holliday junction branch migration complex subunit RuvB Histophilus somni (strain 2336)
Q0I1M3 2.91e-09 62 29 6 181 3 ruvB Holliday junction branch migration complex subunit RuvB Histophilus somni (strain 129Pt)
A0RJ26 2.92e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus thuringiensis (strain Al Hakam)
Q81LG9 2.98e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus anthracis
C3L6U9 2.98e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9A7 2.98e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus anthracis (strain A0248)
C1ESW4 3.06e-09 62 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus cereus (strain 03BB102)
Q1J1C7 3.14e-09 62 34 4 126 3 ruvB Holliday junction branch migration complex subunit RuvB Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q92BI2 3.18e-09 62 35 4 128 3 ruvB Holliday junction branch migration complex subunit RuvB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8CS91 3.19e-09 62 29 2 131 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNR0 3.19e-09 62 29 2 131 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A6VXD3 3.25e-09 62 34 4 131 3 ruvB Holliday junction branch migration complex subunit RuvB Marinomonas sp. (strain MWYL1)
C0R4X2 3.48e-09 61 30 3 129 3 ruvB Holliday junction branch migration complex subunit RuvB Wolbachia sp. subsp. Drosophila simulans (strain wRi)
A9VIP6 3.57e-09 61 35 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus mycoides (strain KBAB4)
A7GTA2 3.7e-09 61 35 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B8EA75 3.72e-09 61 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella baltica (strain OS223)
A9L3H7 3.79e-09 61 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella baltica (strain OS195)
A6WNQ2 3.79e-09 61 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella baltica (strain OS185)
B9KDF4 3.87e-09 61 31 3 124 3 ruvB Holliday junction branch migration complex subunit RuvB Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q081N9 3.94e-09 61 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella frigidimarina (strain NCIMB 400)
Q15RN6 3.95e-09 61 28 9 246 3 ruvB Holliday junction branch migration complex subunit RuvB Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q2W2A5 3.95e-09 61 33 4 121 3 ruvB Holliday junction branch migration complex subunit RuvB Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A7N1I0 4e-09 61 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Vibrio campbellii (strain ATCC BAA-1116)
B3R0J0 4.1e-09 61 29 6 141 3 ruvB Holliday junction branch migration complex subunit RuvB Phytoplasma mali (strain AT)
B4ETP8 4.19e-09 61 29 3 131 3 ruvB Holliday junction branch migration complex subunit RuvB Proteus mirabilis (strain HI4320)
Q2GHE3 4.22e-09 61 32 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
P61539 4.33e-09 61 30 3 129 3 ruvB Holliday junction branch migration complex subunit RuvB Wolbachia pipientis wMel
Q8EEF3 4.34e-09 61 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A7H1X6 4.44e-09 61 33 3 118 3 ruvB Holliday junction branch migration complex subunit RuvB Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
B4UFY1 4.45e-09 61 26 8 239 3 ruvB Holliday junction branch migration complex subunit RuvB Anaeromyxobacter sp. (strain K)
Q2IPJ5 4.45e-09 61 26 8 239 3 ruvB Holliday junction branch migration complex subunit RuvB Anaeromyxobacter dehalogenans (strain 2CP-C)
B8JF05 4.45e-09 61 26 8 239 3 ruvB Holliday junction branch migration complex subunit RuvB Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q2GLG1 4.53e-09 61 29 5 143 3 ruvB Holliday junction branch migration complex subunit RuvB Anaplasma phagocytophilum (strain HZ)
P61532 4.6e-09 61 27 17 358 3 ruvB Holliday junction branch migration complex subunit RuvB Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B9DNE4 4.68e-09 61 30 4 139 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus carnosus (strain TM300)
Q0HUZ1 4.75e-09 61 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella sp. (strain MR-7)
Q9X719 4.81e-09 61 34 2 119 3 ruvB Holliday junction branch migration complex subunit RuvB Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A6QC28 4.83e-09 61 26 9 282 3 ruvB Holliday junction branch migration complex subunit RuvB Sulfurovum sp. (strain NBC37-1)
B4R9Z2 4.88e-09 61 31 5 136 3 ruvB Holliday junction branch migration complex subunit RuvB Phenylobacterium zucineum (strain HLK1)
A4Y6S9 4.88e-09 61 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A0AIY1 4.95e-09 61 35 4 128 3 ruvB Holliday junction branch migration complex subunit RuvB Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A1RJQ2 4.97e-09 61 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella sp. (strain W3-18-1)
A7ZEM1 4.98e-09 61 29 4 134 3 ruvB Holliday junction branch migration complex subunit RuvB Campylobacter concisus (strain 13826)
B8DHL6 5.04e-09 61 35 4 128 3 ruvB Holliday junction branch migration complex subunit RuvB Listeria monocytogenes serotype 4a (strain HCC23)
Q65UP0 5.09e-09 61 26 10 274 3 ruvB Holliday junction branch migration complex subunit RuvB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0HIZ1 5.2e-09 61 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella sp. (strain MR-4)
Q12N10 5.24e-09 61 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A0KWL9 5.34e-09 61 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella sp. (strain ANA-3)
A6WY76 5.44e-09 61 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A5GQ68 5.53e-09 61 31 8 187 3 ruvB Holliday junction branch migration complex subunit RuvB Synechococcus sp. (strain RCC307)
B7HE54 5.66e-09 61 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus cereus (strain B4264)
Q8FZ02 5.79e-09 61 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Brucella suis biovar 1 (strain 1330)
A9WWH9 5.79e-09 61 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VS58 5.79e-09 61 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9M7K0 5.79e-09 61 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57BH8 5.79e-09 61 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Brucella abortus biovar 1 (strain 9-941)
Q2YRD2 5.79e-09 61 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Brucella abortus (strain 2308)
B2S7D9 5.79e-09 61 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Brucella abortus (strain S19)
Q8YIV5 5.84e-09 61 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0REW5 5.84e-09 61 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Brucella melitensis biotype 2 (strain ATCC 23457)
Q89A95 5.85e-09 61 23 7 249 3 dnaX DNA polymerase III subunit gamma Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B7IIT2 5.86e-09 60 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus cereus (strain G9842)
A7Z768 6.06e-09 60 33 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A3QEP3 6.1e-09 60 34 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q49Y79 6.45e-09 60 31 3 119 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A5UAH8 6.91e-09 60 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Haemophilus influenzae (strain PittEE)
Q4QNM6 6.91e-09 60 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Haemophilus influenzae (strain 86-028NP)
A1U1B9 7.02e-09 60 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B3E468 7.28e-09 60 34 4 135 3 ruvB Holliday junction branch migration complex subunit RuvB Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q82XP4 7.45e-09 60 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7W4T6 7.5e-09 60 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9KDI8 7.69e-09 60 33 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P44631 7.7e-09 60 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3YRD9 7.86e-09 60 31 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Ehrlichia canis (strain Jake)
C0Q2F5 7.89e-09 60 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella paratyphi C (strain RKS4594)
B4SVE4 7.89e-09 60 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella newport (strain SL254)
B4T7Z2 7.89e-09 60 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella heidelberg (strain SL476)
Q57NA3 7.89e-09 60 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella choleraesuis (strain SC-B67)
B5XQ05 7.89e-09 60 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Klebsiella pneumoniae (strain 342)
Q7VTT6 7.99e-09 60 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A9MND7 8.1e-09 60 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A6Q1X7 8.28e-09 60 27 5 183 3 ruvB Holliday junction branch migration complex subunit RuvB Nitratiruptor sp. (strain SB155-2)
Q7U9W7 8.38e-09 60 31 8 184 3 ruvB Holliday junction branch migration complex subunit RuvB Parasynechococcus marenigrum (strain WH8102)
Q1QWF8 8.39e-09 60 35 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A6TB30 8.4e-09 60 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q7WGB3 8.43e-09 60 32 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q220I3 8.78e-09 60 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B9LZC4 9.01e-09 60 27 18 351 3 ruvB Holliday junction branch migration complex subunit RuvB Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q3A230 9.18e-09 60 32 4 134 3 ruvB Holliday junction branch migration complex subunit RuvB Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q8DGR1 9.22e-09 60 27 8 240 3 ruvB Holliday junction branch migration complex subunit RuvB Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B1KGX9 9.29e-09 60 29 9 235 3 ruvB Holliday junction branch migration complex subunit RuvB Shewanella woodyi (strain ATCC 51908 / MS32)
Q7VKV5 1e-08 60 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7MJ78 1.01e-08 60 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Vibrio vulnificus (strain YJ016)
Q6FYP6 1.04e-08 60 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Bartonella quintana (strain Toulouse)
Q4A9R6 1.05e-08 60 29 2 123 3 ruvB Holliday junction branch migration complex subunit RuvB Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q4A7W4 1.05e-08 60 29 2 123 3 ruvB Holliday junction branch migration complex subunit RuvB Mesomycoplasma hyopneumoniae (strain 7448)
Q600N3 1.05e-08 60 29 2 123 3 ruvB Holliday junction branch migration complex subunit RuvB Mesomycoplasma hyopneumoniae (strain 232)
Q3Z8V1 1.06e-08 60 35 5 130 3 ruvB Holliday junction branch migration complex subunit RuvB Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q1IHV6 1.11e-08 60 32 3 123 3 ruvB Holliday junction branch migration complex subunit RuvB Koribacter versatilis (strain Ellin345)
Q7V910 1.12e-08 60 32 5 142 3 ruvB Holliday junction branch migration complex subunit RuvB Prochlorococcus marinus (strain MIT 9313)
Q67Q97 1.15e-08 60 29 9 237 3 ruvB Holliday junction branch migration complex subunit RuvB Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q0AJA3 1.18e-08 60 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3B0J1 1.2e-08 60 34 4 119 3 ruvB Holliday junction branch migration complex subunit RuvB Synechococcus sp. (strain CC9902)
P43746 1.2e-08 60 25 10 281 3 dnaX DNA polymerase III subunit tau/gamma Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4L6Y6 1.22e-08 60 25 6 238 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus haemolyticus (strain JCSC1435)
A2C638 1.23e-08 60 32 5 142 3 ruvB Holliday junction branch migration complex subunit RuvB Prochlorococcus marinus (strain MIT 9303)
C4L523 1.24e-08 60 35 6 128 3 ruvB Holliday junction branch migration complex subunit RuvB Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q30YX7 1.26e-08 60 30 5 152 3 ruvB Holliday junction branch migration complex subunit RuvB Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B2SYK2 1.28e-08 60 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q2YT89 1.28e-08 60 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain bovine RF122 / ET3-1)
P66759 1.3e-08 60 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain MW2)
Q6G8S8 1.3e-08 60 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain MSSA476)
P66758 1.3e-08 60 26 6 200 1 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain N315)
P66757 1.3e-08 60 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ITG5 1.3e-08 60 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain JH9)
A6U2A9 1.3e-08 60 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain JH1)
A7X357 1.3e-08 60 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q1MC52 1.34e-08 60 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q13UC0 1.34e-08 60 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Paraburkholderia xenovorans (strain LB400)
Q65GP6 1.36e-08 59 32 4 134 3 ruvB Holliday junction branch migration complex subunit RuvB Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q6D4A2 1.38e-08 59 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A3MZ06 1.4e-08 59 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q2KVY2 1.44e-08 60 32 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Bordetella avium (strain 197N)
A4J537 1.45e-08 59 33 4 130 3 ruvB Holliday junction branch migration complex subunit RuvB Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A8Z2G9 1.47e-08 59 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain USA300 / TCH1516)
Q6GG63 1.47e-08 59 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain MRSA252)
A6QHI3 1.47e-08 59 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain Newman)
Q5HFC2 1.47e-08 59 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain COL)
Q2FXT4 1.47e-08 59 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG86 1.47e-08 59 26 6 200 3 ruvB Holliday junction branch migration complex subunit RuvB Staphylococcus aureus (strain USA300)
Q2GDJ0 1.5e-08 59 29 4 134 3 ruvB Holliday junction branch migration complex subunit RuvB Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
B5ZP80 1.52e-08 59 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B3PYZ5 1.53e-08 59 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Rhizobium etli (strain CIAT 652)
A4VSD3 1.57e-08 59 32 5 153 3 ruvB Holliday junction branch migration complex subunit RuvB Streptococcus suis (strain 05ZYH33)
A4VYM0 1.57e-08 59 32 5 153 3 ruvB Holliday junction branch migration complex subunit RuvB Streptococcus suis (strain 98HAH33)
A7I1C5 1.57e-08 59 28 2 121 3 ruvB Holliday junction branch migration complex subunit RuvB Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q609L0 1.61e-08 59 27 9 244 3 ruvB Holliday junction branch migration complex subunit RuvB Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5GT33 1.61e-08 59 31 3 129 3 ruvB Holliday junction branch migration complex subunit RuvB Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q3ZWZ9 1.7e-08 59 35 5 128 3 ruvB Holliday junction branch migration complex subunit RuvB Dehalococcoides mccartyi (strain CBDB1)
A5FRK7 1.7e-08 59 35 5 128 3 ruvB Holliday junction branch migration complex subunit RuvB Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
C6DFF2 1.71e-08 59 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q8U9K6 1.72e-08 59 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Agrobacterium fabrum (strain C58 / ATCC 33970)
B2USM3 1.73e-08 59 27 3 136 3 ruvB Holliday junction branch migration complex subunit RuvB Helicobacter pylori (strain Shi470)
Q5PBM1 1.74e-08 59 29 5 143 3 ruvB Holliday junction branch migration complex subunit RuvB Anaplasma marginale (strain St. Maries)
A9IYK5 1.76e-08 59 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Bartonella tribocorum (strain CIP 105476 / IBS 506)
B9KHQ5 1.78e-08 59 29 5 143 3 ruvB Holliday junction branch migration complex subunit RuvB Anaplasma marginale (strain Florida)
Q07H98 1.81e-08 59 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Rhodopseudomonas palustris (strain BisA53)
Q2K4J8 1.88e-08 59 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B2VJ95 1.94e-08 59 26 9 267 3 ruvB Holliday junction branch migration complex subunit RuvB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C3LNE8 2.06e-08 59 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Vibrio cholerae serotype O1 (strain M66-2)
Q9KR02 2.06e-08 59 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O14003 2.11e-08 59 23 6 210 1 rfc3 Replication factor C subunit 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A5F760 2.12e-08 59 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8Y6Z8 2.25e-08 59 34 4 128 3 ruvB Holliday junction branch migration complex subunit RuvB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8EPQ6 2.36e-08 59 34 4 128 3 ruvB Holliday junction branch migration complex subunit RuvB Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7N547 2.38e-08 59 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8ZUH7 2.41e-08 59 32 6 155 3 ruvB Holliday junction branch migration complex subunit RuvB Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B0SUN9 2.42e-08 59 31 4 129 3 ruvB Holliday junction branch migration complex subunit RuvB Caulobacter sp. (strain K31)
P66755 2.45e-08 58 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66756 2.45e-08 58 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella typhi
B4TYR7 2.45e-08 58 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella schwarzengrund (strain CVM19633)
B5BH61 2.45e-08 58 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella paratyphi A (strain AKU_12601)
A9MUX4 2.45e-08 58 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIA7 2.45e-08 58 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5FSN8 2.45e-08 58 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella dublin (strain CT_02021853)
B5F3J7 2.45e-08 58 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Salmonella agona (strain SL483)
B2SGL0 2.55e-08 59 30 3 124 3 ruvB Holliday junction branch migration complex subunit RuvB Francisella tularensis subsp. mediasiatica (strain FSC147)
C5CIU4 2.69e-08 58 28 8 239 3 ruvB Holliday junction branch migration complex subunit RuvB Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
A7GZP9 2.76e-08 58 29 2 121 3 ruvB Holliday junction branch migration complex subunit RuvB Campylobacter curvus (strain 525.92)
A3PFA5 2.77e-08 58 29 12 266 3 ruvB Holliday junction branch migration complex subunit RuvB Prochlorococcus marinus (strain MIT 9301)
A1W0X9 2.77e-08 58 32 3 118 3 ruvB Holliday junction branch migration complex subunit RuvB Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PMT7 2.77e-08 58 32 3 118 1 ruvB Holliday junction branch migration complex subunit RuvB Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q71ZD8 2.84e-08 58 34 4 128 3 ruvB Holliday junction branch migration complex subunit RuvB Listeria monocytogenes serotype 4b (strain F2365)
C1KVH9 2.84e-08 58 34 4 128 3 ruvB Holliday junction branch migration complex subunit RuvB Listeria monocytogenes serotype 4b (strain CLIP80459)
Q124Q6 2.87e-08 58 30 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Polaromonas sp. (strain JS666 / ATCC BAA-500)
P61536 2.96e-08 58 32 3 123 3 ruvB Holliday junction branch migration complex subunit RuvB Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6G5R1 2.98e-08 58 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
B3QHS4 3.07e-08 58 32 3 123 3 ruvB Holliday junction branch migration complex subunit RuvB Rhodopseudomonas palustris (strain TIE-1)
Q3IIJ2 3.11e-08 58 33 4 115 3 ruvB Holliday junction branch migration complex subunit RuvB Pseudoalteromonas translucida (strain TAC 125)
B0C2D5 3.17e-08 58 34 5 123 3 ruvB Holliday junction branch migration complex subunit RuvB Acaryochloris marina (strain MBIC 11017)
C5D5E8 3.22e-08 58 34 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Geobacillus sp. (strain WCH70)
B2UFL1 3.32e-08 58 27 9 240 3 ruvB Holliday junction branch migration complex subunit RuvB Ralstonia pickettii (strain 12J)
Q88V03 3.61e-08 58 33 4 151 3 ruvB Holliday junction branch migration complex subunit RuvB Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q048Y7 3.61e-08 58 34 6 147 3 ruvB Holliday junction branch migration complex subunit RuvB Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G941 3.61e-08 58 34 6 147 3 ruvB Holliday junction branch migration complex subunit RuvB Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A4IXW0 3.69e-08 58 30 3 124 3 ruvB Holliday junction branch migration complex subunit RuvB Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NG44 3.69e-08 58 30 3 124 3 ruvB Holliday junction branch migration complex subunit RuvB Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0BLU4 3.69e-08 58 30 3 124 3 ruvB Holliday junction branch migration complex subunit RuvB Francisella tularensis subsp. holarctica (strain OSU18)
A0Q6B4 3.69e-08 58 30 3 124 3 ruvB Holliday junction branch migration complex subunit RuvB Francisella tularensis subsp. novicida (strain U112)
Q2A3C8 3.69e-08 58 30 3 124 3 ruvB Holliday junction branch migration complex subunit RuvB Francisella tularensis subsp. holarctica (strain LVS)
A7NCA9 3.69e-08 58 30 3 124 3 ruvB Holliday junction branch migration complex subunit RuvB Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q14HJ6 3.69e-08 58 30 3 124 3 ruvB Holliday junction branch migration complex subunit RuvB Francisella tularensis subsp. tularensis (strain FSC 198)
Q115Z7 3.76e-08 58 33 5 123 3 ruvB Holliday junction branch migration complex subunit RuvB Trichodesmium erythraeum (strain IMS101)
Q68WZ0 3.89e-08 58 27 13 287 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia typhi (strain ATCC VR-144 / Wilmington)
O32055 3.95e-08 58 32 4 125 1 ruvB Holliday junction branch migration complex subunit RuvB Bacillus subtilis (strain 168)
Q2SZ55 3.96e-08 58 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A6H1G3 4.14e-08 58 30 4 136 3 ruvB Holliday junction branch migration complex subunit RuvB Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A1KU52 4.35e-08 58 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JZ86 4.35e-08 58 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9LZC3 4.35e-08 58 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Neisseria meningitidis serogroup C (strain 053442)
Q3JES3 4.53e-08 58 30 4 125 3 ruvB Holliday junction branch migration complex subunit RuvB Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A7I4H6 4.54e-08 58 28 5 184 3 ruvB Holliday junction branch migration complex subunit RuvB Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q9ZDE5 4.61e-08 58 27 11 267 3 ruvB Holliday junction branch migration complex subunit RuvB Rickettsia prowazekii (strain Madrid E)
A8FN42 4.62e-08 58 32 3 118 3 ruvB Holliday junction branch migration complex subunit RuvB Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q3SGT3 4.8e-08 58 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Thiobacillus denitrificans (strain ATCC 25259)
Q0IDW1 4.83e-08 58 29 8 187 3 ruvB Holliday junction branch migration complex subunit RuvB Synechococcus sp. (strain CC9311)
Q03ER0 4.88e-08 58 30 10 260 3 ruvB Holliday junction branch migration complex subunit RuvB Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B9JRX1 4.93e-08 58 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q0C5W2 5.05e-08 58 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Hyphomonas neptunium (strain ATCC 15444)
Q5FLX2 5.07e-08 58 33 4 128 3 ruvB Holliday junction branch migration complex subunit RuvB Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q21HN6 5.09e-08 58 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
P06710 5.28e-08 58 26 9 246 1 dnaX DNA polymerase III subunit tau Escherichia coli (strain K12)
A1UR84 5.3e-08 58 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q5HT48 5.34e-08 58 32 3 118 3 ruvB Holliday junction branch migration complex subunit RuvB Campylobacter jejuni (strain RM1221)
Q9JUB0 5.35e-08 58 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B4RLV8 5.35e-08 58 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Neisseria gonorrhoeae (strain NCCP11945)
Q5F8L2 5.35e-08 58 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q045Q2 5.44e-08 58 32 4 139 3 ruvB Holliday junction branch migration complex subunit RuvB Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
A1WZ65 5.47e-08 58 31 3 130 3 ruvB Holliday junction branch migration complex subunit RuvB Halorhodospira halophila (strain DSM 244 / SL1)
P61533 5.54e-08 58 32 4 139 3 ruvB Holliday junction branch migration complex subunit RuvB Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
B2UPI9 5.64e-08 58 28 8 240 3 ruvB Holliday junction branch migration complex subunit RuvB Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q17WP7 5.71e-08 58 27 3 136 3 ruvB Holliday junction branch migration complex subunit RuvB Helicobacter acinonychis (strain Sheeba)
B7K9M6 5.73e-08 58 32 4 122 3 ruvB Holliday junction branch migration complex subunit RuvB Gloeothece citriformis (strain PCC 7424)
Q04YY5 5.8e-08 58 29 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
B7K1K0 5.9e-08 58 33 4 121 3 ruvB Holliday junction branch migration complex subunit RuvB Rippkaea orientalis (strain PCC 8801 / RF-1)
B5EAH3 6.11e-08 57 34 7 144 3 ruvB Holliday junction branch migration complex subunit RuvB Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B5ZAF5 6.14e-08 57 27 3 136 3 ruvB Holliday junction branch migration complex subunit RuvB Helicobacter pylori (strain G27)
A1ARF8 6.14e-08 57 31 6 138 3 ruvB Holliday junction branch migration complex subunit RuvB Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q1CUB7 6.19e-08 57 27 3 136 3 ruvB Holliday junction branch migration complex subunit RuvB Helicobacter pylori (strain HPAG1)
C6E1S8 6.39e-08 57 34 7 144 3 ruvB Holliday junction branch migration complex subunit RuvB Geobacter sp. (strain M21)
B8H454 6.43e-08 57 28 4 139 3 ruvB Holliday junction branch migration complex subunit RuvB Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A3G8 6.43e-08 57 28 4 139 3 ruvB Holliday junction branch migration complex subunit RuvB Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9ZM57 6.48e-08 57 27 3 136 3 ruvB Holliday junction branch migration complex subunit RuvB Helicobacter pylori (strain J99 / ATCC 700824)
B6JKW4 6.9e-08 57 27 3 136 3 ruvB Holliday junction branch migration complex subunit RuvB Helicobacter pylori (strain P12)
B3ER84 7.03e-08 57 29 8 231 3 ruvB Holliday junction branch migration complex subunit RuvB Amoebophilus asiaticus (strain 5a2)
P74876 7.68e-08 58 25 10 286 3 dnaX DNA polymerase III subunit tau Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q98F76 7.72e-08 57 33 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0ALX9 7.82e-08 57 31 5 141 3 ruvB Holliday junction branch migration complex subunit RuvB Maricaulis maris (strain MCS10)
A6SUQ4 7.89e-08 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Janthinobacterium sp. (strain Marseille)
Q8F7Y2 8.15e-08 57 30 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P61534 8.15e-08 57 30 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q2GBA2 8.19e-08 57 30 5 152 3 ruvB Holliday junction branch migration complex subunit RuvB Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
O25699 8.26e-08 57 28 2 121 3 ruvB Holliday junction branch migration complex subunit RuvB Helicobacter pylori (strain ATCC 700392 / 26695)
A4G1U9 8.55e-08 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Herminiimonas arsenicoxydans
A9NF62 8.6e-08 57 32 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Acholeplasma laidlawii (strain PG-8A)
Q04UI9 8.6e-08 57 29 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q1QCY5 8.66e-08 57 33 3 117 3 ruvB Holliday junction branch migration complex subunit RuvB Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A1VJK5 8.69e-08 57 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Polaromonas naphthalenivorans (strain CJ2)
B6ITI4 8.74e-08 57 31 3 123 3 ruvB Holliday junction branch migration complex subunit RuvB Rhodospirillum centenum (strain ATCC 51521 / SW)
Q63QX5 8.77e-08 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia pseudomallei (strain K96243)
A3NDF6 8.77e-08 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia pseudomallei (strain 668)
Q3JNS5 8.77e-08 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia pseudomallei (strain 1710b)
A3NZ67 8.77e-08 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia pseudomallei (strain 1106a)
A1V064 8.77e-08 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia mallei (strain SAVP1)
Q62HA9 8.77e-08 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia mallei (strain ATCC 23344)
A2S594 8.77e-08 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia mallei (strain NCTC 10229)
A3MP72 8.77e-08 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia mallei (strain NCTC 10247)
Q1GYS6 8.92e-08 57 31 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q4FTT9 9.06e-08 57 33 3 117 3 ruvB Holliday junction branch migration complex subunit RuvB Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A1VC44 9.36e-08 57 29 4 152 3 ruvB Holliday junction branch migration complex subunit RuvB Nitratidesulfovibrio vulgaris (strain DP4)
P61531 9.36e-08 57 29 4 152 3 ruvB Holliday junction branch migration complex subunit RuvB Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q88NJ0 9.53e-08 57 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P60374 9.9e-08 57 24 6 216 3 rfcS Replication factor C small subunit Nanoarchaeum equitans (strain Kin4-M)
A8YTI2 9.92e-08 57 32 5 143 3 ruvB Holliday junction branch migration complex subunit RuvB Lactobacillus helveticus (strain DPC 4571)
A5VZU7 1.01e-07 57 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0U0B6 1.01e-07 57 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A8EVP9 1.04e-07 57 31 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Aliarcobacter butzleri (strain RM4018)
B0KTJ2 1.07e-07 57 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Pseudomonas putida (strain GB-1)
A3DNV9 1.07e-07 57 23 6 221 3 rfcS Replication factor C small subunit Staphylothermus marinus (strain ATCC 43588 / DSM 3639 / JCM 9404 / F1)
A4JBL2 1.18e-07 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q93LP2 1.18e-07 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia cepacia
O26343 1.24e-07 57 24 5 216 1 rfcS Replication factor C small subunit Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q2IS53 1.29e-07 57 31 3 123 3 ruvB Holliday junction branch migration complex subunit RuvB Rhodopseudomonas palustris (strain HaA2)
A5G9Y2 1.29e-07 57 32 4 134 3 ruvB Holliday junction branch migration complex subunit RuvB Geotalea uraniireducens (strain Rf4)
B4ST32 1.33e-07 57 33 3 117 3 ruvB Holliday junction branch migration complex subunit RuvB Stenotrophomonas maltophilia (strain R551-3)
Q3SP14 1.35e-07 57 32 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q39XN6 1.4e-07 56 32 5 132 3 ruvB Holliday junction branch migration complex subunit RuvB Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A6LN82 1.43e-07 56 28 9 229 3 ruvB Holliday junction branch migration complex subunit RuvB Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q0BI83 1.43e-07 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A5WFF6 1.43e-07 56 33 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Psychrobacter sp. (strain PRwf-1)
B4EES7 1.45e-07 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B1YTD9 1.47e-07 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia ambifaria (strain MC40-6)
Q1BZ36 1.49e-07 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia orbicola (strain AU 1054)
B1JVV3 1.49e-07 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia orbicola (strain MC0-3)
A0K4L4 1.49e-07 57 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia cenocepacia (strain HI2424)
A5EXH6 1.62e-07 56 31 3 126 3 ruvB Holliday junction branch migration complex subunit RuvB Dichelobacter nodosus (strain VCS1703A)
A5ERJ9 1.63e-07 56 31 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q4UXL7 1.65e-07 56 28 7 183 3 ruvB Holliday junction branch migration complex subunit RuvB Xanthomonas campestris pv. campestris (strain 8004)
B2FRN4 1.68e-07 56 33 3 117 3 ruvB Holliday junction branch migration complex subunit RuvB Stenotrophomonas maltophilia (strain K279a)
Q39JJ1 1.7e-07 56 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q5LNT8 1.73e-07 56 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q2S3F9 1.74e-07 56 29 3 134 3 ruvB Holliday junction branch migration complex subunit RuvB Salinibacter ruber (strain DSM 13855 / M31)
A8AUH0 1.74e-07 56 32 4 134 3 ruvB Holliday junction branch migration complex subunit RuvB Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q1LRB7 1.77e-07 56 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A7HUZ8 1.81e-07 56 29 3 140 3 ruvB Holliday junction branch migration complex subunit RuvB Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A4SJ26 1.9e-07 56 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Aeromonas salmonicida (strain A449)
C1D9W9 1.91e-07 56 26 8 245 3 ruvB Holliday junction branch migration complex subunit RuvB Laribacter hongkongensis (strain HLHK9)
Q57396 1.93e-07 56 33 5 124 2 ruvB Holliday junction branch migration complex subunit RuvB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B8GUJ4 1.97e-07 56 32 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q8E7U6 1.99e-07 56 29 4 153 3 ruvB Holliday junction branch migration complex subunit RuvB Streptococcus agalactiae serotype III (strain NEM316)
Q3K3X8 1.99e-07 56 29 4 153 3 ruvB Holliday junction branch migration complex subunit RuvB Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5WHR5 2.09e-07 56 34 5 126 3 ruvB Holliday junction branch migration complex subunit RuvB Shouchella clausii (strain KSM-K16)
Q8E2D9 2.1e-07 56 29 4 153 3 ruvB Holliday junction branch migration complex subunit RuvB Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q5H2A4 2.12e-07 56 28 7 183 3 ruvB Holliday junction branch migration complex subunit RuvB Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2STK0 2.12e-07 56 28 7 183 3 ruvB Holliday junction branch migration complex subunit RuvB Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P575 2.12e-07 56 28 7 183 3 ruvB Holliday junction branch migration complex subunit RuvB Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q130V3 2.13e-07 56 31 3 123 3 ruvB Holliday junction branch migration complex subunit RuvB Rhodopseudomonas palustris (strain BisB5)
Q04GA1 2.14e-07 56 34 3 121 3 ruvB Holliday junction branch migration complex subunit RuvB Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q7NQC5 2.2e-07 56 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8PHV2 2.27e-07 56 28 7 183 3 ruvB Holliday junction branch migration complex subunit RuvB Xanthomonas axonopodis pv. citri (strain 306)
A0LXR1 2.35e-07 56 28 4 138 3 ruvB Holliday junction branch migration complex subunit RuvB Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q5KWR0 2.48e-07 55 33 4 123 3 ruvB Holliday junction branch migration complex subunit RuvB Geobacillus kaustophilus (strain HTA426)
C4LBN0 2.48e-07 55 31 3 115 3 ruvB Holliday junction branch migration complex subunit RuvB Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_09690
Feature type CDS
Gene rarA
Product Replication-associated recombination protein RarA (DNA-dependent ATPase)
Location 94892 - 96235 (strand: -1)
Length 1344 (nucleotides) / 447 (amino acids)
In genomic island -

Contig

Accession ZDB_366
Length 191897 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1281
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00004 ATPase family associated with various cellular activities (AAA)
PF12002 MgsA AAA+ ATPase C terminal
PF16193 AAA C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2256 Replication, recombination and repair (L) L Replication-associated recombination protein RarA (DNA-dependent ATPase)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07478 putative ATPase - -

Protein Sequence

MTNFSLDFSQNDYQPLAARMRPGTLEQYIGQTHLLAEGKPLPRAIRAGQLHSMILWGPPGTGKTTLAEVIGHYADADIERLSAVTSGVKEIREAIERARQNRNLGRRTILFVDEVHRFNKSQQDAFLPHIEDGTVTFIGATTENPSFELNSALLSRARVYLLKSLSPEDIEAVLIQALNDSERGLGGQNIVLPDETRKLLAELVAGDARRSLNVLEMMADMAETGADGKRVLTTELLKEVSGERSARFDNKGDRYYDLISALHKSVRGSAPDAALYWYARIITAGGDPLYVARRLLAIASEDVGNADPRAMQVAISAWDCFTRVGPAEGERAIAQAIVYLACAPKSNAVYTAFKAAMRDAKEGRDYDVPEHLRNAPTKLMKEMGLGKEYRYAHDETNAYAAGEVYFPPEMRDTRYYFPANRGMEGKIGEKLAWLAEQDQNSPIKRYR

Flanking regions ( +/- flanking 50bp)

TACACCGCCGAAGGGGGTTACGCTGGACGATCAGCGGCAATGAGGCGTCAGTGACTAATTTTTCTCTCGATTTTTCGCAAAACGATTACCAGCCTCTGGCCGCTAGAATGCGGCCGGGGACACTGGAACAGTACATCGGACAGACTCACCTGCTGGCAGAGGGCAAACCGCTGCCGCGGGCTATCCGCGCCGGACAGCTCCACTCCATGATTCTGTGGGGACCGCCGGGCACCGGGAAAACCACCCTGGCGGAAGTGATCGGCCACTATGCGGATGCGGATATAGAGCGTCTGTCCGCCGTGACCTCCGGGGTAAAAGAGATCCGCGAAGCTATCGAGCGGGCGCGTCAGAACCGTAATCTGGGGCGCCGCACCATTCTGTTTGTGGATGAGGTACACCGCTTCAATAAAAGCCAGCAGGATGCATTTCTGCCGCATATTGAGGATGGTACAGTCACCTTTATCGGTGCCACCACCGAAAACCCGTCATTTGAACTCAACTCCGCACTGTTATCCCGCGCCCGTGTTTATCTGCTCAAATCCCTGTCACCGGAAGATATCGAAGCGGTTCTGATTCAGGCGCTGAATGATTCTGAGCGCGGACTGGGCGGACAAAATATCGTCCTGCCGGATGAGACCCGTAAACTGCTGGCCGAACTGGTCGCCGGTGATGCCCGCCGTTCGCTGAATGTGCTGGAAATGATGGCGGATATGGCCGAAACCGGTGCTGACGGCAAACGTGTTCTGACCACAGAACTGCTGAAGGAAGTCAGCGGGGAACGCAGCGCCCGCTTTGATAACAAAGGCGACCGCTACTACGACCTGATTTCCGCACTGCACAAGTCAGTGCGCGGCTCGGCACCGGATGCCGCACTCTACTGGTATGCCCGGATTATCACCGCAGGCGGGGATCCGCTCTATGTGGCGCGTCGTCTGCTGGCGATTGCATCAGAAGATGTCGGTAATGCGGATCCGCGCGCCATGCAGGTCGCCATTTCAGCGTGGGACTGCTTTACCCGTGTGGGACCGGCGGAAGGTGAGCGGGCGATTGCCCAGGCGATTGTTTATCTCGCCTGTGCACCGAAAAGTAACGCCGTTTACACCGCCTTCAAAGCGGCGATGCGTGATGCAAAAGAAGGGCGGGATTATGACGTGCCGGAGCATCTGCGCAACGCGCCGACCAAACTGATGAAAGAAATGGGGCTCGGCAAAGAGTACCGTTACGCCCATGACGAAACGAATGCGTATGCTGCCGGAGAAGTCTATTTTCCGCCTGAAATGCGTGATACCCGTTACTATTTTCCGGCAAACCGGGGCATGGAAGGAAAAATCGGCGAGAAACTCGCCTGGCTTGCTGAGCAGGATCAAAATAGCCCGATAAAACGCTACCGTTAATGCCGCTGTTGCGGTAAGGTGTGAAATGTAAGAATAGGTAAATGGCTTAA