Homologs in group_2770

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07615 FBDBKF_07615 100.0 Morganella morganii S1 rnfC Na+-translocating ferredoxin:NAD+ oxidoreductase RNF, RnfC subunit
EHELCC_13445 EHELCC_13445 100.0 Morganella morganii S2 rnfC Na+-translocating ferredoxin:NAD+ oxidoreductase RNF, RnfC subunit
NLDBIP_13890 NLDBIP_13890 100.0 Morganella morganii S4 rnfC Na+-translocating ferredoxin:NAD+ oxidoreductase RNF, RnfC subunit
HKOGLL_08510 HKOGLL_08510 100.0 Morganella morganii S5 rnfC Na+-translocating ferredoxin:NAD+ oxidoreductase RNF, RnfC subunit
F4V73_RS13505 F4V73_RS13505 94.4 Morganella psychrotolerans - SLBB domain-containing protein

Distribution of the homologs in the orthogroup group_2770

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2770

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9XDM9 0.0 535 62 0 415 1 pduS Cobalamin reductase PduS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B1VB77 8.35e-179 510 61 0 415 1 pduS Cobalamin reductase PduS Citrobacter freundii
D8GR66 1.37e-43 162 31 6 329 2 rnfC Proton-translocating ferredoxin:NAD(+) oxidoreductase complex subunit C Clostridium ljungdahlii (strain ATCC 55383 / DSM 13528 / PETC)
D8GR66 3.91e-06 52 43 2 74 2 rnfC Proton-translocating ferredoxin:NAD(+) oxidoreductase complex subunit C Clostridium ljungdahlii (strain ATCC 55383 / DSM 13528 / PETC)
H6LC32 1.1e-40 154 32 8 343 1 rnfC Na(+)-translocating ferredoxin:NAD(+) oxidoreductase complex subunit C Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
H6LC32 2.59e-05 50 48 1 52 1 rnfC Na(+)-translocating ferredoxin:NAD(+) oxidoreductase complex subunit C Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
D5ARZ1 5.43e-36 142 32 9 339 3 rnfC Ion-translocating oxidoreductase complex subunit C Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q52716 5.43e-36 142 32 9 339 1 rnfC Ion-translocating oxidoreductase complex subunit C Rhodobacter capsulatus
Q1RBG7 5.34e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain UTI89 / UPEC)
B7MVA7 5.34e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O81 (strain ED1a)
B7M9Y3 5.34e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LEQ7 5.37e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain SMS-3-5 / SECEC)
B7M0I6 5.49e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O8 (strain IAI1)
B7L5I2 5.49e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain 55989 / EAEC)
Q3Z1Y4 6.74e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella sonnei (strain Ss046)
B6IB67 7.4e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain SE11)
A7ZM89 7.47e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O139:H28 (strain E24377A / ETEC)
A8A0H2 7.76e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O9:H4 (strain HS)
Q8FH95 7.94e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7URX0 7.99e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P77611 8.2e-32 132 30 9 359 1 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12)
B1IQC5 8.2e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XFU1 8.2e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12 / DH10B)
C4ZY92 8.2e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12 / MC4100 / BW2952)
B7NU04 8.6e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P58324 8.84e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O157:H7
B7NB83 9.09e-32 132 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q32FE4 1.32e-31 131 32 8 312 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella dysenteriae serotype 1 (strain Sd197)
Q0THJ8 1.35e-31 131 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q83RB9 1.44e-31 131 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella flexneri
Q0T4E8 1.44e-31 131 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella flexneri serotype 5b (strain 8401)
B5Z463 2.48e-31 130 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O157:H7 (strain EC4115 / EHEC)
B7LQP1 3.05e-31 130 31 9 358 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A9MRW8 3.43e-31 130 30 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2U2C8 3.69e-31 130 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q4QJQ6 6.15e-31 129 26 10 395 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain 86-028NP)
A1ABH4 6.34e-31 129 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O1:K1 / APEC
B5RAK2 8.07e-31 129 30 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q320Y6 1.03e-30 129 30 9 359 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella boydii serotype 4 (strain Sb227)
B5FIE7 1.23e-30 128 30 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella dublin (strain CT_02021853)
A5UBJ0 1.26e-30 128 27 11 395 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain PittEE)
B4THD4 1.37e-30 128 30 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella heidelberg (strain SL476)
B5F6J0 1.4e-30 128 30 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella agona (strain SL483)
C0Q508 1.43e-30 128 30 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi C (strain RKS4594)
B5QV02 1.54e-30 128 30 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella enteritidis PT4 (strain P125109)
B4TV17 1.64e-30 128 30 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella schwarzengrund (strain CVM19633)
A9N025 1.87e-30 128 30 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5BKB2 2.13e-30 127 29 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi A (strain AKU_12601)
Q5PIB9 2.13e-30 127 29 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T594 2.15e-30 127 30 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella newport (strain SL254)
Q8ZPM2 2.21e-30 127 30 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A7MMK9 7.13e-30 126 30 7 330 3 rnfC Ion-translocating oxidoreductase complex subunit C Cronobacter sakazakii (strain ATCC BAA-894)
A0A0H3AJC2 1.04e-29 125 29 9 339 3 rnfC Ion-translocating oxidoreductase complex subunit C Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KT88 1.06e-29 125 29 9 339 3 rnfC Ion-translocating oxidoreductase complex subunit C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q57PI0 1.4e-29 125 29 8 363 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella choleraesuis (strain SC-B67)
B5XWP9 1.54e-29 125 30 8 337 3 rnfC Ion-translocating oxidoreductase complex subunit C Klebsiella pneumoniae (strain 342)
A8AH10 4.14e-29 124 30 9 358 3 rnfC Ion-translocating oxidoreductase complex subunit C Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P71397 4.68e-29 124 27 11 379 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A6VQ42 1.44e-28 122 28 11 351 3 rnfC Ion-translocating oxidoreductase complex subunit C Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q65U33 2.32e-28 121 28 14 378 3 rnfC Ion-translocating oxidoreductase complex subunit C Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CNP2 4.19e-28 121 29 10 335 3 rnfC Ion-translocating oxidoreductase complex subunit C Pasteurella multocida (strain Pm70)
A1JM81 2.18e-26 115 28 7 311 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B2K4K0 2.21e-26 115 27 10 397 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C7K3 2.46e-26 115 27 10 397 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Antiqua)
Q1CIY9 2.52e-26 115 27 10 397 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8U6 2.52e-26 115 27 10 397 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Angola)
A7FHZ3 2.7e-26 115 27 10 397 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JKN4 3.56e-26 115 27 10 397 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q9HYB8 1.78e-24 110 30 9 346 3 rnfC Ion-translocating oxidoreductase complex subunit C Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
C5BDE7 6.4e-23 105 29 9 313 3 rnfC Ion-translocating oxidoreductase complex subunit C Edwardsiella ictaluri (strain 93-146)
C6DH15 1.4e-21 101 28 8 311 3 rnfC Ion-translocating oxidoreductase complex subunit C Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q7VNT4 1.91e-21 100 25 10 332 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6D4W2 2.86e-21 100 27 8 311 3 rnfC Ion-translocating oxidoreductase complex subunit C Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GE00 4.28e-21 99 28 8 346 3 rnfC Ion-translocating oxidoreductase complex subunit C Serratia proteamaculans (strain 568)
P57215 1.54e-20 97 25 10 319 3 rnfC Ion-translocating oxidoreductase complex subunit C Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B2VEQ3 2.12e-19 94 27 7 311 3 rnfC Ion-translocating oxidoreductase complex subunit C Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q89AW8 4.19e-15 80 23 9 313 3 rnfC Ion-translocating oxidoreductase complex subunit C Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9I0J7 4.91e-13 74 27 11 317 3 nuoF NADH-quinone oxidoreductase subunit F Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O66841 1.36e-12 72 27 7 236 1 nuoF NADH-quinone oxidoreductase subunit F Aquifex aeolicus (strain VF5)
P56913 2.72e-12 72 26 12 323 3 nuoF2 NADH-quinone oxidoreductase subunit F 2 Rhizobium meliloti (strain 1021)
Q8K9Y3 1.08e-11 70 27 6 229 3 nuoF NADH-quinone oxidoreductase subunit F Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P33901 1.26e-11 69 28 7 234 3 nuoF NADH-quinone oxidoreductase subunit F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8TSY4 1.41e-11 69 25 11 298 1 rnfC Ion-translocating oxidoreductase complex subunit C Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P31979 3.01e-11 68 28 7 234 1 nuoF NADH-quinone oxidoreductase subunit F Escherichia coli (strain K12)
Q56222 6.29e-11 67 25 12 320 1 nqo1 NADH-quinone oxidoreductase subunit 1 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P22317 3.08e-10 65 26 7 246 1 hoxF NAD-reducing hydrogenase HoxS subunit alpha Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P57256 7.18e-10 64 25 10 321 3 nuoF NADH-quinone oxidoreductase subunit F Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A8F0M0 1.68e-09 63 25 14 317 3 nuoF NADH-quinone oxidoreductase subunit F Rickettsia massiliae (strain Mtu5)
Q46507 4.65e-09 62 23 12 309 1 hndC NADP-reducing hydrogenase subunit HndC Solidesulfovibrio fructosivorans
Q4UKA6 1.84e-08 60 24 12 317 3 nuoF NADH-quinone oxidoreductase subunit F Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q0MQI5 3.87e-08 58 24 7 237 2 NDUFV1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Gorilla gorilla gorilla
Q0MQI6 4.19e-08 58 25 8 237 2 NDUFV1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Pan troglodytes
Q92JB2 4.21e-08 58 24 13 317 3 nuoF NADH-quinone oxidoreductase subunit F Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8GQT6 4.25e-08 58 24 13 317 2 nuoF NADH-quinone oxidoreductase subunit F Rickettsia rickettsii (strain Sheila Smith)
Q8HXQ9 4.7e-08 58 25 8 237 2 NDUFV1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Macaca fascicularis
P49821 5.18e-08 58 25 8 237 1 NDUFV1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Homo sapiens
A8GM77 5.23e-08 58 24 13 317 3 nuoF NADH-quinone oxidoreductase subunit F Rickettsia akari (strain Hartford)
A8EXI1 7.33e-08 58 24 14 318 3 nuoF NADH-quinone oxidoreductase subunit F Rickettsia canadensis (strain McKiel)
Q91YT0 7.7e-08 58 25 8 237 1 Ndufv1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Mus musculus
Q0MQI4 2.1e-07 56 24 8 237 2 NDUFV1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Pongo pygmaeus
P25708 2.16e-07 56 25 8 237 1 NDUFV1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Bos taurus
Q9ZE33 4.3e-07 55 24 13 317 3 nuoF NADH-quinone oxidoreductase subunit F Rickettsia prowazekii (strain Madrid E)
Q1RHA0 4.95e-07 55 23 9 318 3 nuoF NADH-quinone oxidoreductase subunit F Rickettsia bellii (strain RML369-C)
A8GYE0 4.95e-07 55 23 9 318 3 nuoF NADH-quinone oxidoreductase subunit F Rickettsia bellii (strain OSU 85-389)
Q9XAQ9 5.38e-07 55 23 5 232 3 nuoF NADH-quinone oxidoreductase subunit F Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q68XY3 5.61e-07 55 24 13 317 3 nuoF NADH-quinone oxidoreductase subunit F Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P9WIV7 1.33e-06 54 25 5 236 1 nuoF NADH-quinone oxidoreductase subunit F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIV6 1.33e-06 54 25 5 236 3 nuoF NADH-quinone oxidoreductase subunit F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65568 1.33e-06 54 25 5 236 3 nuoF NADH-quinone oxidoreductase subunit F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O07948 1.54e-06 53 24 7 235 3 nuoF NADH-quinone oxidoreductase subunit F Rhodobacter capsulatus
O52682 0.000261 47 22 12 323 1 hydB Bifurcating [FeFe] hydrogenase beta subunit Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P29913 0.000479 46 22 6 235 1 nqo1 NADH-quinone oxidoreductase chain 1 Paracoccus denitrificans
P56912 0.000798 45 28 1 113 3 nuoF1 NADH-quinone oxidoreductase subunit F 1 Rhizobium meliloti (strain 1021)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_08960
Feature type CDS
Gene rnfC
Product Na+-translocating ferredoxin:NAD+ oxidoreductase RNF, RnfC subunit
Location 128924 - 130276 (strand: -1)
Length 1353 (nucleotides) / 450 (amino acids)
In genomic island -

Contig

Accession ZDB_365
Length 192330 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2770
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01512 Respiratory-chain NADH dehydrogenase 51 Kd subunit
PF10531 SLBB domain
PF13375 RnfC Barrel sandwich hybrid domain
PF13534 4Fe-4S dicluster domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4656 Energy production and conversion (C) C Na+-translocating ferredoxin:NAD+ oxidoreductase RNF, RnfC subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K27271 cobalamin reductase - -

Protein Sequence

MSNLMPGLHECGPEIIRQRVQDAGVVGAGGAGFPTHVKLAAQAEIYLVNAAECEPLLQVDQQLAVREADAMIRGLLYAMRATGAKEGIIAIKGKHQTAIDILNARVPDSVRLHILPDVYPAGDEVITIWLATGRRVPPAALPLSVGVVVSNVQTLINVAYAVEQEQAVIHRVLTVNGAVHHPVTVSVPVGTTLREVLALAGGSTISNPAYINGGPMMGKLQTSLDDAVTKTTGGLLVLPDDHILIQRRTRSERTVINQARTVCEQCGMCTELCPRHMIGHELPPHLIVRAVGYEQISAPSAVVAALTCSECAICEAWSCPVEISPMRLNQMLKVKLREEGIRYEGELRPEDPMAQHRMLPVKRLVRRLELTEYMHKAPMTDEIYAPQQVIIPLRQHIGAPAVPVVSEGDNVTAGMLIAAVPEKALGAPVHASISGVVRHIDSSAVTIEKE

Flanking regions ( +/- flanking 50bp)

ATTGCGCAAACGCGGCAGCCGCTACCGGGTAAAACAGGAGGGAAACCGCGATGAGTAATCTGATGCCGGGTCTGCATGAGTGCGGGCCCGAAATCATTCGTCAGCGTGTGCAGGATGCAGGGGTTGTCGGTGCGGGCGGTGCGGGTTTCCCGACCCACGTCAAACTGGCGGCACAGGCGGAAATCTATCTGGTGAATGCGGCTGAATGTGAGCCGCTTTTGCAGGTGGATCAGCAGCTGGCTGTCCGTGAGGCGGATGCGATGATCCGCGGTTTGCTGTATGCGATGCGGGCCACCGGCGCGAAAGAGGGCATTATCGCCATCAAAGGCAAGCATCAGACGGCCATTGATATCCTGAATGCCCGCGTGCCGGATTCTGTCCGTCTGCATATCCTGCCGGATGTTTATCCGGCCGGTGATGAAGTGATCACCATCTGGCTGGCGACCGGCCGCCGGGTCCCGCCTGCGGCACTGCCGCTGTCTGTCGGCGTGGTGGTCAGTAATGTGCAGACGCTGATCAATGTCGCGTATGCCGTTGAACAGGAACAGGCCGTGATACACCGTGTCCTGACGGTGAACGGCGCGGTTCATCATCCTGTTACCGTTTCCGTTCCGGTCGGCACCACACTGCGTGAAGTGCTGGCACTGGCAGGCGGATCCACCATCAGCAACCCGGCGTATATCAACGGCGGGCCGATGATGGGCAAATTACAGACATCCCTTGATGATGCTGTGACCAAAACCACCGGCGGCTTATTAGTCCTGCCGGATGACCATATTTTAATTCAGCGCCGGACCCGTTCGGAGCGCACGGTGATCAACCAGGCGCGTACCGTATGTGAACAGTGCGGCATGTGTACCGAGCTCTGCCCGCGTCATATGATCGGCCACGAACTGCCGCCGCACCTGATTGTTCGCGCGGTGGGGTATGAGCAGATCTCCGCACCGTCAGCCGTTGTTGCGGCACTGACCTGCTCGGAATGTGCGATTTGTGAAGCCTGGTCCTGCCCGGTGGAGATCTCACCGATGCGCCTGAATCAGATGCTGAAAGTGAAGCTGCGCGAAGAAGGGATCCGCTACGAAGGTGAACTGCGCCCGGAAGATCCGATGGCTCAGCACCGCATGCTGCCGGTCAAACGCCTTGTCCGCCGTCTGGAACTGACGGAATACATGCACAAAGCGCCGATGACTGATGAGATCTACGCGCCGCAGCAGGTGATTATCCCGTTACGTCAGCATATCGGTGCCCCGGCGGTACCGGTTGTCAGCGAAGGGGATAACGTCACGGCGGGCATGCTGATCGCCGCTGTCCCGGAAAAAGCACTGGGTGCGCCGGTTCACGCCAGTATCAGCGGTGTGGTTCGCCATATTGACAGCTCGGCTGTCACGATAGAGAAGGAATAACTATGCACAGTGCAATTGCGATGGTGGAACTGTCCAGTATCGCCAAAGGG