Homologs in group_3407

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13545 FBDBKF_13545 100.0 Morganella morganii S1 - hypothetical protein
EHELCC_08550 EHELCC_08550 100.0 Morganella morganii S2 - hypothetical protein
NLDBIP_08875 NLDBIP_08875 100.0 Morganella morganii S4 - hypothetical protein
HKOGLL_05525 HKOGLL_05525 100.0 Morganella morganii S5 - hypothetical protein

Distribution of the homologs in the orthogroup group_3407

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3407

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_05390
Feature type CDS
Gene -
Product hypothetical protein
Location 69472 - 69564 (strand: -1)
Length 93 (nucleotides) / 30 (amino acids)

Contig

Accession ZDB_362
Length 257361 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3407
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Protein Sequence

MEAFALLPLITATIPGGIFFLPVTFMFISV

Flanking regions ( +/- flanking 50bp)

TTATTGATGCTGATTAAAATATATTTAGTGATAACAATGAGGAGTAATTTATGGAAGCTTTTGCTTTATTACCTTTGATTACAGCAACTATTCCCGGCGGTATCTTTTTTCTTCCTGTCACATTTATGTTTATTTCCGTCTGACGGACACTAAGGCAGTTATGTTCCAACTGCCTTTTCCATAAATTAATGGC