Homologs in group_677

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02555 FBDBKF_02555 100.0 Morganella morganii S1 yegD molecular chaperone
EHELCC_03025 EHELCC_03025 100.0 Morganella morganii S2 yegD molecular chaperone
NLDBIP_00435 NLDBIP_00435 100.0 Morganella morganii S4 yegD molecular chaperone
HKOGLL_01640 HKOGLL_01640 100.0 Morganella morganii S5 yegD molecular chaperone
F4V73_RS04980 F4V73_RS04980 87.8 Morganella psychrotolerans yegD molecular chaperone
PMI_RS06125 PMI_RS06125 77.3 Proteus mirabilis HI4320 yegD molecular chaperone

Distribution of the homologs in the orthogroup group_677

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_677

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P36928 0.0 529 56 0 450 3 yegD Uncharacterized chaperone protein YegD Escherichia coli (strain K12)
Q9LCQ5 3.66e-12 72 24 16 425 3 dnaK Chaperone protein DnaK Brevibacillus choshinensis
Q68XG8 1.43e-11 70 25 11 267 3 hscA Chaperone protein HscA homolog Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZDW5 2.12e-11 69 26 12 277 3 hscA Chaperone protein HscA homolog Rickettsia prowazekii (strain Madrid E)
B0K3Y0 3.39e-11 68 25 17 419 3 dnaK Chaperone protein DnaK Thermoanaerobacter sp. (strain X514)
A4J7F3 3.5e-11 68 29 10 258 3 dnaK Chaperone protein DnaK Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
C0ZB48 4.14e-11 68 27 8 257 3 dnaK Chaperone protein DnaK Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q3Z6P1 4.19e-11 68 27 7 258 3 dnaK Chaperone protein DnaK Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B0KA81 4.54e-11 68 25 17 419 3 dnaK Chaperone protein DnaK Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A5FPU4 5.04e-11 68 27 7 258 3 dnaK Chaperone protein DnaK Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q3ZYV1 5.85e-11 68 27 7 258 3 dnaK Chaperone protein DnaK Dehalococcoides mccartyi (strain CBDB1)
A3DF25 6.04e-11 68 28 9 257 3 dnaK Chaperone protein DnaK Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q45551 8.29e-11 67 24 16 438 3 dnaK Chaperone protein DnaK Geobacillus stearothermophilus
Q4UKL3 8.33e-11 67 25 10 275 3 hscA Chaperone protein HscA homolog Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
C4L425 9.14e-11 67 27 8 258 3 dnaK Chaperone protein DnaK Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
B8CXL1 9.9e-11 67 22 16 427 3 dnaK Chaperone protein DnaK Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B8I305 1.09e-10 67 23 15 431 3 dnaK Chaperone protein DnaK Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q8DKR6 1.14e-10 67 29 9 236 3 dnaK1 Chaperone protein dnaK1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A5V5P9 1.25e-10 67 27 11 284 3 dnaK Chaperone protein DnaK Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q1AXX6 1.84e-10 66 27 10 279 3 dnaK Chaperone protein DnaK Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q2RKX4 2.06e-10 66 23 14 424 3 dnaK Chaperone protein DnaK Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A9VHU1 2.33e-10 66 27 9 259 3 dnaK Chaperone protein DnaK Bacillus mycoides (strain KBAB4)
C5D4U1 2.37e-10 66 24 17 438 3 dnaK Chaperone protein DnaK Geobacillus sp. (strain WCH70)
Q5WHG1 2.64e-10 66 26 9 258 3 dnaK Chaperone protein DnaK Shouchella clausii (strain KSM-K16)
B1ILM3 3.15e-10 65 25 12 285 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Okra / Type B1)
B1KZN7 3.6e-10 65 25 12 285 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Loch Maree / Type A3)
A7GHH6 3.73e-10 65 25 12 285 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
C1FVU0 3.73e-10 65 25 12 285 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Kyoto / Type A2)
A5I640 3.73e-10 65 25 12 285 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXL5 3.73e-10 65 25 12 285 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain ATCC 19397 / Type A)
Q8RB68 3.96e-10 65 25 18 419 3 dnaK Chaperone protein DnaK Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B2V2I5 4.22e-10 65 24 14 359 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Alaska E43 / Type E3)
C3L3G7 4.68e-10 65 25 12 285 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain 657 / Type Ba4)
Q6HDK7 5.47e-10 65 26 9 259 3 dnaK Chaperone protein DnaK Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634M7 5.47e-10 65 26 9 259 3 dnaK Chaperone protein DnaK Bacillus cereus (strain ZK / E33L)
Q818E9 5.47e-10 65 26 9 259 3 dnaK Chaperone protein DnaK Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HCU0 5.47e-10 65 26 9 259 3 dnaK Chaperone protein DnaK Bacillus cereus (strain B4264)
C1ESK8 5.47e-10 65 26 9 259 3 dnaK Chaperone protein DnaK Bacillus cereus (strain 03BB102)
B7JN39 5.47e-10 65 26 9 259 3 dnaK Chaperone protein DnaK Bacillus cereus (strain AH820)
Q81LS2 5.47e-10 65 26 9 259 3 dnaK Chaperone protein DnaK Bacillus anthracis
A0RIT3 5.47e-10 65 26 9 259 3 dnaK Chaperone protein DnaK Bacillus thuringiensis (strain Al Hakam)
C3L5R7 5.47e-10 65 26 9 259 3 dnaK Chaperone protein DnaK Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P8M0 5.47e-10 65 26 9 259 3 dnaK Chaperone protein DnaK Bacillus anthracis (strain A0248)
Q56235 5.94e-10 65 25 15 422 1 dnaK Chaperone protein DnaK Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B9IY81 5.97e-10 65 27 10 261 3 dnaK Chaperone protein DnaK Bacillus cereus (strain Q1)
B7HPL3 5.97e-10 65 27 10 261 3 dnaK Chaperone protein DnaK Bacillus cereus (strain AH187)
B7IYG7 5.97e-10 65 26 9 259 3 dnaK Chaperone protein DnaK Bacillus cereus (strain G9842)
Q730M1 6.35e-10 65 27 10 261 3 dnaK Chaperone protein DnaK Bacillus cereus (strain ATCC 10987 / NRS 248)
Q4G366 6.77e-10 64 23 18 445 3 dnaK Chaperone protein dnaK Emiliania huxleyi
Q1IT15 7.48e-10 64 27 13 333 3 dnaK Chaperone protein DnaK Koribacter versatilis (strain Ellin345)
Q72IK5 7.53e-10 64 25 15 422 3 dnaK Chaperone protein DnaK Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q9KD72 1.02e-09 64 25 8 258 3 dnaK Chaperone protein DnaK Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B1I699 1.2e-09 63 24 16 418 3 dnaK Chaperone protein DnaK Desulforudis audaxviator (strain MP104C)
B2TLZ7 1.33e-09 63 24 12 325 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Eklund 17B / Type B)
A8GR49 1.54e-09 63 25 10 275 3 hscA Chaperone protein HscA homolog Rickettsia rickettsii (strain Sheila Smith)
B0BWJ7 1.54e-09 63 25 10 275 3 hscA Chaperone protein HscA homolog Rickettsia rickettsii (strain Iowa)
A5IXT5 1.62e-09 63 25 9 260 3 dnaK Chaperone protein DnaK Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
C3PMP2 1.76e-09 63 25 10 275 3 hscA Chaperone protein HscA homolog Rickettsia africae (strain ESF-5)
Q92J07 1.79e-09 63 25 10 275 3 hscA Chaperone protein HscA homolog Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q2LUH6 2.13e-09 63 27 8 241 3 dnaK Chaperone protein DnaK Syntrophus aciditrophicus (strain SB)
C4K0Z7 2.15e-09 63 25 10 275 3 hscA Chaperone protein HscA homolog Rickettsia peacockii (strain Rustic)
Q8DH10 2.49e-09 63 27 8 259 3 dnaK3 Chaperone protein dnaK3 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A8GMI8 3.19e-09 62 25 11 275 3 hscA Chaperone protein HscA homolog Rickettsia akari (strain Hartford)
B2S0M0 3.37e-09 62 27 11 276 3 dnaK Chaperone protein DnaK Borrelia hermsii (strain HS1 / DAH)
B3DZP7 3.46e-09 62 28 9 237 3 dnaK Chaperone protein DnaK Methylacidiphilum infernorum (isolate V4)
P73098 4.35e-09 62 28 9 257 3 dnaK3 Chaperone protein dnaK3 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1RJ70 4.46e-09 62 25 10 267 3 hscA Chaperone protein HscA homolog Rickettsia bellii (strain RML369-C)
Q06W39 4.57e-09 62 23 12 419 3 dnaK Chaperone protein dnaK Neoporphyra haitanensis
B1YKS9 5.82e-09 62 23 14 424 3 dnaK Chaperone protein DnaK Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q6F149 6.04e-09 62 25 8 262 3 dnaK Chaperone protein DnaK Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
B0TAD7 6.35e-09 61 30 12 260 3 dnaK Chaperone protein DnaK Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q9KWS7 6.87e-09 61 23 17 438 3 dnaK Chaperone protein DnaK Parageobacillus thermoglucosidasius
A0Q1R4 6.88e-09 61 24 10 283 3 dnaK Chaperone protein DnaK Clostridium novyi (strain NT)
B8FGS3 7.08e-09 61 27 11 273 3 dnaK Chaperone protein DnaK Desulfatibacillum aliphaticivorans
A5N6M2 7.25e-09 61 27 14 285 3 dnaK Chaperone protein DnaK Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E041 7.25e-09 61 27 14 285 3 dnaK Chaperone protein DnaK Clostridium kluyveri (strain NBRC 12016)
A6TSM0 8.1e-09 61 27 12 275 3 dnaK Chaperone protein DnaK Alkaliphilus metalliredigens (strain QYMF)
B1H009 8.52e-09 61 27 11 260 3 dnaK Chaperone protein DnaK Endomicrobium trichonymphae
Q1XDH2 8.67e-09 61 25 7 255 3 dnaK Chaperone protein dnaK Neopyropia yezoensis
Q37106 9.11e-09 61 23 17 460 3 dnaK-A Chaperone protein dnaK Cyanophora paradoxa
Q8EUH7 9.46e-09 61 26 9 260 3 dnaK Chaperone protein DnaK Malacoplasma penetrans (strain HF-2)
Q9ZIV1 1.27e-08 60 24 8 257 3 dnaK Chaperone protein DnaK (Fragment) Megasphaera elsdenii
C0QGP6 1.35e-08 60 26 8 268 3 dnaK Chaperone protein DnaK Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B9MJZ1 1.36e-08 60 26 9 257 3 dnaK Chaperone protein DnaK Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q7V3T5 1.41e-08 60 25 11 283 3 dnaK2 Chaperone protein dnaK2 Prochlorococcus marinus (strain MIT 9313)
P96133 1.59e-08 60 22 17 429 3 dnaK Chaperone protein DnaK Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
C4Z1J4 1.71e-08 60 25 8 262 3 dnaK Chaperone protein DnaK Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
P50022 1.75e-08 60 28 10 260 3 dnaK3 Chaperone protein dnaK3 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A4XKA4 1.88e-08 60 26 9 257 3 dnaK Chaperone protein DnaK Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A7GT08 1.96e-08 60 25 9 259 3 dnaK Chaperone protein DnaK Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q9HHB9 2.18e-08 60 23 16 458 3 dnaK Chaperone protein DnaK Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
Q67S54 2.35e-08 60 28 12 260 3 dnaK Chaperone protein DnaK Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A6LRN4 2.36e-08 60 26 13 288 3 dnaK Chaperone protein DnaK Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B0S1F8 2.36e-08 60 29 13 261 3 dnaK Chaperone protein DnaK Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q74H59 2.53e-08 60 25 7 256 3 dnaK Chaperone protein DnaK Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A8ZRW3 2.59e-08 60 24 16 424 3 dnaK Chaperone protein DnaK Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q8YW74 2.62e-08 59 25 12 287 3 dnaK2 Chaperone protein dnaK2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
C6E643 2.63e-08 59 25 6 231 3 dnaK Chaperone protein DnaK Geobacter sp. (strain M21)
Q8DI58 2.63e-08 59 25 14 305 3 dnaK2 Chaperone protein dnaK2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B5RPM1 3.03e-08 59 28 9 235 3 dnaK Chaperone protein DnaK Borrelia recurrentis (strain A1)
B5RM75 3.03e-08 59 28 9 235 3 dnaK Chaperone protein DnaK Borrelia duttonii (strain Ly)
C1F2D2 3.05e-08 59 26 13 338 3 dnaK Chaperone protein DnaK Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q5NPS6 3.12e-08 59 29 14 276 3 dnaK Chaperone protein DnaK Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
P05646 3.15e-08 59 26 11 261 3 dnaK Chaperone protein DnaK Priestia megaterium
Q486F9 3.17e-08 59 26 10 264 3 dnaK1 Chaperone protein DnaK 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8FUN4 3.2e-08 59 29 10 263 3 dnaK Chaperone protein DnaK Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q85FW4 3.44e-08 59 24 13 305 3 dnaK Chaperone protein dnaK Cyanidioschyzon merolae (strain NIES-3377 / 10D)
Q892R0 3.73e-08 59 26 10 257 3 dnaK Chaperone protein DnaK Clostridium tetani (strain Massachusetts / E88)
Q5KWZ7 3.76e-08 59 23 16 438 1 dnaK Chaperone protein DnaK Geobacillus kaustophilus (strain HTA426)
O69268 4.04e-08 59 27 10 258 3 dnaK Chaperone protein DnaK Lysinibacillus sphaericus
Q5N1V0 4.15e-08 59 28 10 260 3 dnaK1 Chaperone protein DnaK 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P17821 4.32e-08 59 27 11 263 3 dnaK Chaperone protein DnaK Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BC31 4.32e-08 59 27 11 263 3 dnaK Chaperone protein DnaK Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
Q3KLV7 4.32e-08 59 27 11 263 3 dnaK Chaperone protein DnaK Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0B7W6 4.32e-08 59 27 11 263 3 dnaK Chaperone protein DnaK Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q01PM8 4.39e-08 59 27 9 237 3 dnaK Chaperone protein DnaK Solibacter usitatus (strain Ellin6076)
P75344 4.42e-08 58 22 13 443 3 dnaK Chaperone protein DnaK Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q2G6N0 4.62e-08 58 28 11 272 3 dnaK Chaperone protein DnaK Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A9KKU0 4.81e-08 58 27 10 261 3 dnaK Chaperone protein DnaK Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q7NDH1 5.19e-08 58 25 8 268 3 dnaK Chaperone protein DnaK Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B1HUD1 5.59e-08 58 27 10 258 3 dnaK Chaperone protein DnaK Lysinibacillus sphaericus (strain C3-41)
Q826F6 5.79e-08 58 26 8 261 3 dnaK2 Chaperone protein dnaK2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
B7J282 5.9e-08 58 27 7 240 2 dnaK Chaperone protein DnaK Borreliella burgdorferi (strain ZS7)
P0C922 5.9e-08 58 27 7 240 2 dnaK Chaperone protein DnaK Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q65H54 5.94e-08 58 26 9 258 3 dnaK Chaperone protein DnaK Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P30722 6.08e-08 58 25 8 259 3 dnaK Chaperone protein dnaK Diacronema lutheri
Q0W874 6.38e-08 58 25 11 260 3 dnaK Chaperone protein DnaK Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q661A3 6.39e-08 58 27 7 240 3 dnaK Chaperone protein DnaK Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q12WE6 6.71e-08 58 26 10 261 3 dnaK Chaperone protein DnaK Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q0SMZ0 7.03e-08 58 27 7 240 3 dnaK Chaperone protein DnaK Borreliella afzelii (strain PKo)
A4SYY9 7.07e-08 58 27 10 262 3 hscA Chaperone protein HscA homolog Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B9E6X1 8.04e-08 58 25 9 259 3 dnaK Chaperone protein DnaK Macrococcus caseolyticus (strain JCSC5402)
B3E7W9 8.11e-08 58 24 13 349 3 dnaK Chaperone protein DnaK Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q8TQR2 8.32e-08 58 25 9 259 3 dnaK Chaperone protein DnaK Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A2BZ91 8.89e-08 58 25 10 262 3 dnaK Chaperone protein DnaK Prochlorococcus marinus (strain MIT 9515)
A1ANV0 9.64e-08 58 25 8 255 3 dnaK Chaperone protein DnaK Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B5ZBE9 9.68e-08 58 26 9 260 3 dnaK Chaperone protein DnaK Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q8CP17 9.93e-08 58 27 12 259 3 dnaK Chaperone protein DnaK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P17820 1e-07 58 25 9 258 1 dnaK Chaperone protein DnaK Bacillus subtilis (strain 168)
P0A3J1 1.01e-07 58 25 9 259 3 dnaK Chaperone protein DnaK Lactococcus lactis subsp. cremoris (strain MG1363)
Q8EPW4 1.01e-07 58 27 11 261 3 dnaK Chaperone protein DnaK Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B5EC42 1.04e-07 58 25 6 231 3 dnaK Chaperone protein DnaK Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q02ZQ7 1.04e-07 57 25 9 259 3 dnaK Chaperone protein DnaK Lactococcus lactis subsp. cremoris (strain SK11)
P69377 1.05e-07 57 24 9 282 3 dnaK Chaperone protein dnaK Porphyra umbilicalis
P69376 1.05e-07 57 24 9 282 3 dnaK Chaperone protein dnaK Porphyra purpurea
Q5HNW6 1.06e-07 57 27 12 259 3 dnaK Chaperone protein DnaK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q39PT7 1.21e-07 57 26 9 241 3 dnaK Chaperone protein DnaK Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A7Z6W1 1.29e-07 57 25 9 258 3 dnaK Chaperone protein DnaK Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P0A3J0 1.37e-07 57 25 9 259 3 dnaK Chaperone protein DnaK Lactococcus lactis subsp. lactis (strain IL1403)
Q9PQF2 1.39e-07 57 26 9 260 3 dnaK Chaperone protein DnaK Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIX8 1.39e-07 57 26 9 260 3 dnaK Chaperone protein DnaK Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
P50021 1.4e-07 57 25 7 255 3 dnaK2 Chaperone protein dnaK2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B7GKC8 1.45e-07 57 23 19 441 3 dnaK Chaperone protein DnaK Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q6MNF8 1.49e-07 57 26 8 235 3 dnaK Chaperone protein DnaK Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
P30721 1.66e-07 57 25 11 281 2 dnaK Chaperone protein DnaK Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5N1J4 1.79e-07 57 25 7 255 3 dnaK2 Chaperone protein DnaK 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A5GDC8 1.9e-07 57 26 11 265 3 dnaK Chaperone protein DnaK Geotalea uraniireducens (strain Rf4)
A8GMF9 1.91e-07 57 25 11 281 3 dnaK Chaperone protein DnaK Rickettsia akari (strain Hartford)
A4IR31 1.97e-07 57 22 15 438 3 dnaK Chaperone protein DnaK Geobacillus thermodenitrificans (strain NG80-2)
A1V5M2 2.05e-07 57 23 16 444 3 hscA Chaperone protein HscA homolog Burkholderia mallei (strain SAVP1)
Q62IZ5 2.05e-07 57 23 16 444 3 hscA Chaperone protein HscA homolog Burkholderia mallei (strain ATCC 23344)
A2SAS9 2.05e-07 57 23 16 444 3 hscA Chaperone protein HscA homolog Burkholderia mallei (strain NCTC 10229)
A3ML96 2.05e-07 57 23 16 444 3 hscA Chaperone protein HscA homolog Burkholderia mallei (strain NCTC 10247)
Q8KML6 2.19e-07 57 27 11 261 3 dnaK Chaperone protein DnaK Fructilactobacillus sanfranciscensis
Q9RY23 2.27e-07 57 27 9 234 1 dnaK Chaperone protein DnaK Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A3NBA0 2.28e-07 57 22 15 444 3 hscA Chaperone protein HscA homolog Burkholderia pseudomallei (strain 668)
A3NX33 2.28e-07 57 22 15 444 3 hscA Chaperone protein HscA homolog Burkholderia pseudomallei (strain 1106a)
Q7UZG3 2.39e-07 57 25 11 277 3 dnaK2 Chaperone protein dnaK2 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
P26823 2.42e-07 56 22 14 431 3 dnaK Chaperone protein DnaK Clostridium perfringens (strain 13 / Type A)
Q0TNS7 2.42e-07 56 22 14 431 3 dnaK Chaperone protein DnaK Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q63SN5 2.47e-07 56 22 15 444 3 hscA Chaperone protein HscA homolog Burkholderia pseudomallei (strain K96243)
Q6FCE6 2.51e-07 56 26 11 291 3 hscA Chaperone protein HscA homolog Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q3JQN9 2.67e-07 56 22 15 444 3 hscA Chaperone protein HscA homolog Burkholderia pseudomallei (strain 1710b)
P56836 2.71e-07 56 27 11 262 3 dnaK Chaperone protein DnaK Chlamydia muridarum (strain MoPn / Nigg)
Q0SRE3 2.83e-07 56 22 14 431 3 dnaK Chaperone protein DnaK Clostridium perfringens (strain SM101 / Type A)
B2GBQ5 2.9e-07 56 26 11 260 3 dnaK Chaperone protein DnaK Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A4X148 2.94e-07 56 25 8 257 3 dnaK Chaperone protein DnaK Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q49Y22 3.19e-07 56 24 10 290 3 dnaK Chaperone protein DnaK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q46I76 3.34e-07 56 25 10 260 3 dnaK Chaperone protein DnaK Prochlorococcus marinus (strain NATL2A)
B1XTR3 3.47e-07 56 25 11 269 3 hscA Chaperone protein HscA homolog Polynucleobacter necessarius subsp. necessarius (strain STIR1)
B9LUC7 3.53e-07 56 24 18 459 3 dnaK Chaperone protein DnaK Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q7U3C4 3.67e-07 56 25 10 260 3 dnaK2 Chaperone protein dnaK2 Parasynechococcus marenigrum (strain WH8102)
A8LWM4 3.82e-07 56 25 8 257 3 dnaK Chaperone protein DnaK Salinispora arenicola (strain CNS-205)
A3M561 3.98e-07 56 25 12 297 3 hscA Chaperone protein HscA homolog Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VNV8 4.12e-07 56 28 9 207 3 hscA Chaperone protein HscA homolog Acinetobacter baumannii (strain SDF)
A0AIS4 4.17e-07 56 26 11 261 3 dnaK Chaperone protein DnaK Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B9M357 4.17e-07 56 24 7 255 3 dnaK Chaperone protein DnaK Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q5YNI0 4.25e-07 55 25 11 282 3 dnaK Chaperone protein DnaK Nocardia farcinica (strain IFM 10152)
P0CW12 4.27e-07 55 26 11 260 3 dnaK Chaperone protein DnaK Methanosarcina mazei
P0CW13 4.27e-07 55 26 11 260 3 dnaK Chaperone protein DnaK Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q5PAB8 4.35e-07 55 24 13 325 3 dnaK Chaperone protein DnaK Anaplasma marginale (strain St. Maries)
A8EWT6 4.41e-07 55 25 12 267 3 dnaK Chaperone protein DnaK Aliarcobacter butzleri (strain RM4018)
Q9UXR0 4.5e-07 55 27 12 262 3 dnaK Chaperone protein DnaK Methanosarcina thermophila
B0VD55 4.74e-07 55 25 12 297 3 hscA Chaperone protein HscA homolog Acinetobacter baumannii (strain AYE)
B7I5P9 4.74e-07 55 25 12 297 3 hscA Chaperone protein HscA homolog Acinetobacter baumannii (strain AB0057)
B7H3H4 4.74e-07 55 25 12 297 3 hscA Chaperone protein HscA homolog Acinetobacter baumannii (strain AB307-0294)
Q3IUI0 4.74e-07 55 22 16 434 3 dnaK Chaperone protein DnaK Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
P94695 4.91e-07 55 26 8 234 3 dnaK Chaperone protein DnaK Deinococcus proteolyticus (strain ATCC 35074 / DSM 20540 / JCM 6276 / NBRC 101906 / NCIMB 13154 / VKM Ac-1939 / CCM 2703 / MRP)
A8FFD2 4.92e-07 55 27 10 259 3 dnaK Chaperone protein DnaK Bacillus pumilus (strain SAFR-032)
Q1RHH0 5.08e-07 55 25 10 283 3 dnaK Chaperone protein DnaK Rickettsia bellii (strain RML369-C)
B8DYH6 5.12e-07 55 24 11 281 3 dnaK Chaperone protein DnaK Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
P22358 5.42e-07 55 23 13 423 2 dnaK2 Chaperone protein DnaK2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7NAU6 5.42e-07 55 24 14 356 3 dnaK Chaperone protein DnaK Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
B2HZI1 5.89e-07 55 25 12 297 3 hscA Chaperone protein HscA homolog Acinetobacter baumannii (strain ACICU)
Q7V9G2 6.11e-07 55 24 10 285 3 dnaK2 Chaperone protein dnaK2 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
O87777 6.23e-07 55 26 12 282 2 dnaK Chaperone protein DnaK Latilactobacillus sakei
Q38W93 6.8e-07 55 26 12 282 3 dnaK Chaperone protein DnaK Latilactobacillus sakei subsp. sakei (strain 23K)
Q73Q16 6.85e-07 55 26 11 265 3 dnaK Chaperone protein DnaK Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P19993 7.14e-07 55 25 9 258 1 dnaK Chaperone protein DnaK Mycobacterium leprae (strain TN)
B8ZTB7 7.14e-07 55 25 9 258 3 dnaK Chaperone protein DnaK Mycobacterium leprae (strain Br4923)
Q6MT06 7.35e-07 55 24 9 259 3 dnaK Chaperone protein DnaK Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q01100 7.35e-07 55 25 9 260 3 dnaK Chaperone protein DnaK Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q1BEV1 7.47e-07 55 24 10 282 3 dnaK Chaperone protein DnaK Mycobacterium sp. (strain MCS)
A1UA31 7.47e-07 55 24 10 282 3 dnaK Chaperone protein DnaK Mycobacterium sp. (strain KMS)
A3PTN4 7.47e-07 55 24 10 282 3 dnaK Chaperone protein DnaK Mycobacterium sp. (strain JLS)
Q3A8C2 7.48e-07 55 23 8 279 3 dnaK Chaperone protein DnaK Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A0LWS7 7.52e-07 55 25 10 258 3 dnaK Chaperone protein DnaK Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q7UM31 8.08e-07 55 27 12 262 3 dnaK Chaperone protein DnaK Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A1SPX5 8.15e-07 55 26 9 257 3 dnaK Chaperone protein DnaK Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q2SSB0 8.23e-07 55 24 9 259 3 dnaK Chaperone protein DnaK Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q4L6T0 8.82e-07 55 26 11 259 3 dnaK Chaperone protein DnaK Staphylococcus haemolyticus (strain JCSC1435)
A1T2S3 8.97e-07 55 25 11 282 3 dnaK Chaperone protein DnaK Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A9AGU7 1.08e-06 54 24 11 283 3 hscA Chaperone protein HscA homolog Burkholderia multivorans (strain ATCC 17616 / 249)
Q0BDQ8 1.17e-06 54 23 11 289 3 hscA Chaperone protein HscA homolog Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1MZG6 1.2e-06 54 23 8 281 3 dnaK Chaperone protein DnaK Leuconostoc citreum (strain KM20)
B5YH59 1.22e-06 54 26 10 264 3 dnaK Chaperone protein DnaK Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
O96772 1.23e-06 54 25 9 262 3 HSP70 Mitochondrial-type heat shock protein 70 Encephalitozoon cuniculi (strain GB-M1)
C0ZT86 1.23e-06 54 26 9 258 3 dnaK Chaperone protein DnaK Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q6B8V2 1.26e-06 54 24 7 257 3 dnaK Chaperone protein dnaK Gracilaria tenuistipitata var. liui
Q2YT47 1.36e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q182E8 1.47e-06 54 33 5 132 3 dnaK Chaperone protein DnaK Clostridioides difficile (strain 630)
Q465Y6 1.49e-06 54 26 11 260 3 dnaK Chaperone protein DnaK Methanosarcina barkeri (strain Fusaro / DSM 804)
Q3AF08 1.51e-06 54 25 8 259 3 dnaK Chaperone protein DnaK Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q52701 1.52e-06 54 26 10 272 3 dnaK Chaperone protein DnaK Rhodobacter capsulatus
P64408 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain MW2)
A8Z4B9 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8Y7 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain MSSA476)
Q6GGC0 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain MRSA252)
P99110 1.58e-06 54 25 11 259 1 dnaK Chaperone protein DnaK Staphylococcus aureus (strain N315)
P64407 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHC3 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain Newman)
Q5HFI0 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain COL)
A5ITA8 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain JH9)
Q2FXZ2 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGE3 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain USA300)
A6U252 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain JH1)
A7X2Y1 1.58e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus (strain Mu3 / ATCC 700698)
P45554 1.61e-06 54 25 11 259 3 dnaK Chaperone protein DnaK Staphylococcus aureus
B1MIX5 1.62e-06 54 24 10 282 3 dnaK Chaperone protein DnaK Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
B5YAR3 1.69e-06 53 24 10 261 3 dnaK Chaperone protein DnaK Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q00488 1.7e-06 54 25 9 258 3 dnaK Chaperone protein DnaK Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A9A135 1.73e-06 53 25 11 262 3 dnaK Chaperone protein DnaK Nitrosopumilus maritimus (strain SCM1)
P47547 1.86e-06 53 25 8 265 1 dnaK Chaperone protein DnaK Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A0QQC8 1.92e-06 53 25 11 282 1 dnaK Chaperone protein DnaK Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q6YPM1 1.94e-06 53 27 13 264 3 dnaK Chaperone protein DnaK Onion yellows phytoplasma (strain OY-M)
Q1WUE8 1.94e-06 53 23 18 459 3 dnaK Chaperone protein DnaK Ligilactobacillus salivarius (strain UCC118)
Q9STW6 1.98e-06 53 20 16 466 1 HSP70-6 Heat shock 70 kDa protein 6, chloroplastic Arabidopsis thaliana
Q1BHT5 1.98e-06 53 24 11 288 3 hscA Chaperone protein HscA homolog Burkholderia orbicola (strain AU 1054)
A0K8P6 1.98e-06 53 24 11 288 3 hscA Chaperone protein HscA homolog Burkholderia cenocepacia (strain HI2424)
B1JV00 2e-06 53 24 11 288 3 hscA Chaperone protein HscA homolog Burkholderia orbicola (strain MC0-3)
Q7VC04 2.08e-06 53 26 8 259 3 dnaK1 Chaperone protein dnaK1 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A0QLZ6 2.17e-06 53 25 9 258 3 dnaK Chaperone protein DnaK Mycobacterium avium (strain 104)
Q47TI0 2.23e-06 53 25 8 254 3 dnaK Chaperone protein DnaK Thermobifida fusca (strain YX)
A9WQR3 2.28e-06 53 22 15 430 3 dnaK Chaperone protein DnaK Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q05647 2.36e-06 53 23 17 434 3 dnaK Chaperone protein DnaK Erysipelothrix rhusiopathiae
Q9TLT1 2.4e-06 53 25 10 263 3 dnaK Chaperone protein dnaK Cyanidium caldarium
Q8T869 2.51e-06 53 25 7 237 1 bip2 Luminal-binding protein 2 Dictyostelium discoideum
A5CX56 2.62e-06 53 28 11 236 3 dnaK Chaperone protein DnaK Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B4EDS3 2.64e-06 53 23 11 288 3 hscA Chaperone protein HscA homolog Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B8DE38 2.65e-06 53 25 12 285 3 dnaK Chaperone protein DnaK Listeria monocytogenes serotype 4a (strain HCC23)
Q39EU4 2.67e-06 53 24 11 288 3 hscA Chaperone protein HscA homolog Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q71ZJ7 2.67e-06 53 26 11 261 3 dnaK Chaperone protein DnaK Listeria monocytogenes serotype 4b (strain F2365)
C1KVC0 2.67e-06 53 26 11 261 3 dnaK Chaperone protein DnaK Listeria monocytogenes serotype 4b (strain CLIP80459)
Q92BN8 2.72e-06 53 25 12 285 3 dnaK Chaperone protein DnaK Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A6GXZ1 2.75e-06 53 23 16 356 3 dnaK Chaperone protein DnaK Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
P0DJM2 2.87e-06 53 26 11 261 3 dnaK Chaperone protein DnaK Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
G2K046 2.87e-06 53 26 11 261 3 dnaK Chaperone protein DnaK Listeria monocytogenes serotype 1/2a (strain 10403S)
Q9LTX9 2.88e-06 53 21 9 282 2 HSP70-7 Heat shock 70 kDa protein 7, chloroplastic Arabidopsis thaliana
P48209 3.01e-06 53 28 12 262 3 dnaK Chaperone protein DnaK Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B1YT24 3.01e-06 53 23 11 289 3 hscA Chaperone protein HscA homolog Burkholderia ambifaria (strain MC40-6)
Q6MB26 3.03e-06 53 26 8 260 3 dnaK Chaperone protein DnaK Protochlamydia amoebophila (strain UWE25)
Q5N0G0 3.06e-06 53 24 11 265 3 dnaK3 Chaperone protein DnaK 3 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q03MR6 3.08e-06 53 24 9 259 3 dnaK Chaperone protein DnaK Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M1T8 3.08e-06 53 24 9 259 3 dnaK Chaperone protein DnaK Streptococcus thermophilus (strain CNRZ 1066)
A0B747 3.16e-06 53 24 9 262 3 dnaK Chaperone protein DnaK Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q7NZ33 3.22e-06 53 25 12 291 3 hscA Chaperone protein HscA homolog Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9ZEJ0 3.33e-06 53 26 11 260 3 dnaK Chaperone protein DnaK Metamycoplasma hominis
Q05981 3.35e-06 53 27 8 258 2 dnaK Chaperone protein DnaK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YE76 3.35e-06 53 27 8 258 3 dnaK Chaperone protein DnaK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57AD7 3.35e-06 53 27 8 258 3 dnaK Chaperone protein DnaK Brucella abortus biovar 1 (strain 9-941)
Q8FXX2 3.41e-06 53 27 8 258 3 dnaK Chaperone protein DnaK Brucella suis biovar 1 (strain 1330)
A5FGL1 3.45e-06 53 25 11 262 3 dnaK Chaperone protein DnaK Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
O52064 3.46e-06 53 27 11 262 3 dnaK Chaperone protein DnaK Mannheimia haemolytica
Q5M6D1 3.55e-06 53 24 9 259 3 dnaK Chaperone protein DnaK Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q6KIH7 3.56e-06 53 25 10 259 3 dnaK Chaperone protein DnaK Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
A4T112 3.65e-06 53 25 11 282 3 dnaK Chaperone protein DnaK Mycolicibacterium gilvum (strain PYR-GCK)
Q2SXE0 3.75e-06 53 23 11 289 3 hscA Chaperone protein HscA homolog Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q04EE1 3.8e-06 53 26 13 258 3 dnaK Chaperone protein DnaK Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
B8DRD6 3.82e-06 53 26 11 261 3 dnaK Chaperone protein DnaK Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B6YRF7 3.86e-06 53 26 12 261 3 dnaK Chaperone protein DnaK Azobacteroides pseudotrichonymphae genomovar. CFP2
P29215 3.89e-06 53 23 7 257 3 dnaK Chaperone protein dnaK Guillardia theta
A4VT29 4.37e-06 52 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus suis (strain 05ZYH33)
A4VZB5 4.37e-06 52 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus suis (strain 98HAH33)
A1B4E9 4.55e-06 52 26 11 271 3 dnaK Chaperone protein DnaK Paracoccus denitrificans (strain Pd 1222)
A0PLQ1 4.66e-06 52 25 9 258 3 dnaK Chaperone protein DnaK Mycobacterium ulcerans (strain Agy99)
Q1MPW1 4.82e-06 52 26 11 262 3 dnaK Chaperone protein DnaK Lawsonia intracellularis (strain PHE/MN1-00)
Q044A9 4.91e-06 52 24 11 284 3 dnaK Chaperone protein DnaK Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P49463 4.92e-06 52 25 10 260 3 dnaK Chaperone protein dnaK Trieres chinensis
Q68XI2 5.01e-06 52 26 13 284 3 dnaK Chaperone protein DnaK Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4UJK7 5.01e-06 52 26 13 284 3 dnaK Chaperone protein DnaK Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9ZEJ6 5.03e-06 52 26 8 257 3 dnaK1 Chaperone protein dnaK1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A6SXE9 5.3e-06 52 23 12 268 3 hscA Chaperone protein HscA homolog Janthinobacterium sp. (strain Marseille)
Q6AMQ3 5.3e-06 52 25 12 268 3 dnaK Chaperone protein DnaK Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A7ZEB5 5.5e-06 52 24 16 339 3 dnaK Chaperone protein DnaK Campylobacter concisus (strain 13826)
Q02028 5.63e-06 52 22 9 262 2 HSP70 Stromal 70 kDa heat shock-related protein, chloroplastic Pisum sativum
B9DNK0 5.83e-06 52 26 11 259 3 dnaK Chaperone protein DnaK Staphylococcus carnosus (strain TM300)
Q88PK4 5.83e-06 52 26 12 267 3 hscA Chaperone protein HscA homolog Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8YUA6 5.96e-06 52 27 12 261 3 dnaK3 Chaperone protein dnaK3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B2GGP0 6.43e-06 52 25 10 259 3 dnaK Chaperone protein DnaK Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q4AAR4 6.49e-06 52 25 9 260 3 dnaK Chaperone protein DnaK Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q9ZDX9 6.51e-06 52 26 12 279 3 dnaK Chaperone protein DnaK Rickettsia prowazekii (strain Madrid E)
B9L8Z0 6.79e-06 52 26 8 207 3 dnaK Chaperone protein DnaK Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q54215 6.93e-06 52 25 7 231 3 dnaK Chaperone protein DnaK Streptomyces griseus
Q1IWL4 6.98e-06 52 27 8 234 3 dnaK Chaperone protein DnaK Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
B3EKT9 7.23e-06 52 26 10 262 3 dnaK Chaperone protein DnaK Chlorobium phaeobacteroides (strain BS1)
O67118 7.5e-06 52 21 13 421 3 dnaK Chaperone protein DnaK Aquifex aeolicus (strain VF5)
C1CZH9 7.61e-06 52 26 8 234 3 dnaK Chaperone protein DnaK Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
B1VMF3 7.82e-06 52 25 7 231 3 dnaK Chaperone protein DnaK Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
O05714 8.11e-06 52 25 7 257 3 dnaK Chaperone protein DnaK Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8FM78 8.4e-06 52 26 9 257 3 dnaK Chaperone protein DnaK Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q03QU1 8.47e-06 52 27 12 261 3 dnaK Chaperone protein DnaK Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q3APD2 8.58e-06 52 24 10 277 3 dnaK Chaperone protein DnaK Chlorobium chlorochromatii (strain CaD3)
C4LGV8 8.81e-06 52 24 10 259 3 dnaK Chaperone protein DnaK Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
B2UKV6 9.07e-06 52 24 6 237 3 dnaK Chaperone protein DnaK Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q2SMM8 9.22e-06 51 25 18 369 3 dnaK Chaperone protein DnaK Hahella chejuensis (strain KCTC 2396)
Q9HRY2 1.07e-05 51 22 13 425 3 dnaK Chaperone protein DnaK Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R3H4 1.07e-05 51 22 13 425 3 dnaK Chaperone protein DnaK Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q15WH0 1.08e-05 51 24 9 281 3 hscA Chaperone protein HscA homolog Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B0T138 1.17e-05 51 27 14 285 3 dnaK Chaperone protein DnaK Caulobacter sp. (strain K31)
A8AVA8 1.26e-05 51 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
C5BQ33 1.32e-05 51 25 22 372 3 dnaK Chaperone protein DnaK Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q82EX9 1.33e-05 51 27 8 235 3 dnaK1 Chaperone protein dnaK1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P83784 1.37e-05 51 27 12 274 1 SSC1 Heat shock protein SSC1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
B8J402 1.43e-05 51 26 12 262 3 dnaK Chaperone protein DnaK Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
P50023 1.47e-05 51 26 11 265 3 dnaK Chaperone protein DnaK Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
A3PNM1 1.52e-05 51 26 11 274 3 dnaK Chaperone protein DnaK Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
P20442 1.57e-05 51 27 14 279 2 dnaK Chaperone protein DnaK Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q74IT6 1.59e-05 50 23 11 284 3 dnaK Chaperone protein DnaK Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q4A8U5 1.59e-05 50 25 9 260 3 dnaK Chaperone protein DnaK Mesomycoplasma hyopneumoniae (strain 7448)
Q49539 1.59e-05 50 25 9 260 3 dnaK Chaperone protein DnaK Mesomycoplasma hyopneumoniae (strain 232)
B5XHZ0 1.64e-05 50 26 12 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M49 (strain NZ131)
P0C0C5 1.66e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes
Q48RR3 1.66e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RCW6 1.66e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J578 1.66e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M4 (strain MGAS10750)
P68837 1.66e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XAD6 1.66e-05 50 26 13 261 1 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0C0C6 1.66e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M1
P0CY99 1.71e-05 50 27 7 235 3 dnaK Chaperone protein DnaK Cutibacterium acnes (strain DSM 16379 / KPA171202)
P0CY98 1.71e-05 50 27 7 235 3 dnaK Chaperone protein DnaK Cutibacterium acnes
B2HPS1 1.79e-05 50 25 9 258 3 dnaK Chaperone protein DnaK Mycobacterium marinum (strain ATCC BAA-535 / M)
Q0RBC4 1.82e-05 50 25 9 255 3 dnaK Chaperone protein DnaK Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q5NYT1 1.83e-05 50 24 10 280 3 hscA Chaperone protein HscA homolog Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A8YVQ3 1.84e-05 50 23 18 422 3 dnaK Chaperone protein DnaK Lactobacillus helveticus (strain DPC 4571)
Q8NLY6 1.92e-05 50 26 9 257 3 dnaK Chaperone protein DnaK Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QHJ0 2e-05 50 26 9 257 3 dnaK Chaperone protein DnaK Corynebacterium glutamicum (strain R)
Q0AKB1 2.04e-05 50 26 14 276 3 dnaK Chaperone protein DnaK Maricaulis maris (strain MCS10)
Q28VY3 2.05e-05 50 26 11 270 3 dnaK Chaperone protein DnaK Jannaschia sp. (strain CCS1)
C0M7T9 2.06e-05 50 26 13 263 3 dnaK Chaperone protein DnaK Streptococcus equi subsp. equi (strain 4047)
B9DVF3 2.08e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B2G6W3 2.1e-05 50 24 9 257 3 dnaK Chaperone protein DnaK Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJE7 2.1e-05 50 24 9 257 3 dnaK Chaperone protein DnaK Limosilactobacillus reuteri (strain DSM 20016)
P50020 2.12e-05 50 24 11 265 3 dnaK1 Chaperone protein dnaK1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q1IEI8 2.13e-05 50 25 10 266 3 hscA Chaperone protein HscA homolog Pseudomonas entomophila (strain L48)
P0A3J4 2.13e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus agalactiae
P0A3J3 2.13e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A3J2 2.13e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus agalactiae serotype III (strain NEM316)
Q3K3T2 2.13e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1JKD6 2.15e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JA83 2.15e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M12 (strain MGAS2096)
A0RPW7 2.22e-05 50 23 14 339 3 dnaK Chaperone protein DnaK Campylobacter fetus subsp. fetus (strain 82-40)
Q1JFC8 2.23e-05 50 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M2 (strain MGAS10270)
C0ME86 2.25e-05 50 26 13 263 3 dnaK Chaperone protein DnaK Streptococcus equi subsp. zooepidemicus (strain H70)
B3R475 2.27e-05 50 24 10 265 3 hscA Chaperone protein HscA homolog Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q03WI2 2.32e-05 50 24 7 257 3 dnaK Chaperone protein DnaK Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
P0DB71 2.37e-05 50 26 12 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB70 2.37e-05 50 26 12 261 3 dnaK Chaperone protein DnaK Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9JUF4 2.56e-05 50 25 11 275 3 hscA Chaperone protein HscA homolog Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P9WMJ9 2.59e-05 50 25 9 258 1 dnaK Chaperone protein DnaK Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMJ8 2.59e-05 50 25 9 258 3 dnaK Chaperone protein DnaK Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5TZ77 2.59e-05 50 25 9 258 3 dnaK Chaperone protein DnaK Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AK26 2.59e-05 50 25 9 258 3 dnaK Chaperone protein DnaK Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KFH2 2.59e-05 50 25 9 258 1 dnaK Chaperone protein DnaK Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A5C0 2.59e-05 50 25 9 258 3 dnaK Chaperone protein DnaK Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9JS04 2.67e-05 50 25 11 275 3 hscA Chaperone protein HscA homolog Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A4G782 2.72e-05 50 23 13 317 3 hscA Chaperone protein HscA homolog Herminiimonas arsenicoxydans
A1VFG6 2.82e-05 50 26 11 263 3 dnaK Chaperone protein DnaK Nitratidesulfovibrio vulgaris (strain DP4)
Q72DW8 2.82e-05 50 26 11 263 3 dnaK Chaperone protein DnaK Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
C3PJM6 2.83e-05 50 27 7 176 3 dnaK Chaperone protein DnaK Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q3B577 2.92e-05 50 25 10 277 3 dnaK Chaperone protein DnaK Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A5CM86 2.97e-05 50 25 10 259 3 dnaK Chaperone protein DnaK Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q824B2 3.07e-05 50 24 10 277 3 dnaK Chaperone protein DnaK Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A3CQC2 3.13e-05 50 26 14 263 3 dnaK Chaperone protein DnaK Streptococcus sanguinis (strain SK36)
B0RBI1 3.13e-05 50 25 10 259 3 dnaK Chaperone protein DnaK Clavibacter sepedonicus
C1D4P9 3.21e-05 50 26 10 263 3 hscA Chaperone protein HscA homolog Laribacter hongkongensis (strain HLHK9)
C4K110 3.28e-05 50 26 13 279 3 dnaK Chaperone protein DnaK Rickettsia peacockii (strain Rustic)
Q18GZ4 3.28e-05 50 25 12 261 3 dnaK Chaperone protein DnaK Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
P43736 3.56e-05 50 29 15 265 3 dnaK Chaperone protein DnaK Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QJW4 3.56e-05 50 29 15 265 3 dnaK Chaperone protein DnaK Haemophilus influenzae (strain 86-028NP)
Q55154 3.71e-05 50 25 11 260 3 dnaK1 Chaperone protein dnaK1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3IYM7 3.79e-05 49 26 11 274 3 dnaK Chaperone protein DnaK Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q253K1 3.85e-05 49 26 9 263 3 dnaK Chaperone protein DnaK Chlamydia felis (strain Fe/C-56)
A6VNB1 3.85e-05 49 26 21 365 3 dnaK Chaperone protein DnaK Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C3K275 4e-05 49 25 8 262 3 dnaK Chaperone protein DnaK Pseudomonas fluorescens (strain SBW25)
P16474 4.03e-05 49 25 11 274 1 KAR2 Endoplasmic reticulum chaperone BiP Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8RH05 4.06e-05 49 25 10 261 3 dnaK Chaperone protein DnaK Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B4SSQ6 4.22e-05 49 24 20 370 3 dnaK Chaperone protein DnaK Stenotrophomonas maltophilia (strain R551-3)
Q5FFM4 4.27e-05 49 26 19 358 3 dnaK Chaperone protein DnaK Ehrlichia ruminantium (strain Gardel)
A7ZVV7 4.36e-05 49 27 20 360 3 dnaK Chaperone protein DnaK Escherichia coli O9:H4 (strain HS)
B4SDA0 4.52e-05 49 27 10 239 3 dnaK Chaperone protein DnaK Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
C4XQ63 4.55e-05 49 25 8 260 3 dnaK Chaperone protein DnaK Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q3KIA0 4.76e-05 49 24 15 360 3 dnaK Chaperone protein DnaK Pseudomonas fluorescens (strain Pf0-1)
Q05558 4.78e-05 49 27 9 235 3 dnaK Chaperone protein DnaK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A6LM32 4.79e-05 49 27 12 261 3 dnaK Chaperone protein DnaK Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q3Z601 4.84e-05 49 27 20 360 3 dnaK Chaperone protein DnaK Shigella sonnei (strain Ss046)
Q32KA5 4.84e-05 49 27 20 360 3 dnaK Chaperone protein DnaK Shigella dysenteriae serotype 1 (strain Sd197)
Q326K7 4.84e-05 49 27 20 360 3 dnaK Chaperone protein DnaK Shigella boydii serotype 4 (strain Sb227)
Q1RGI8 4.84e-05 49 27 20 360 3 dnaK Chaperone protein DnaK Escherichia coli (strain UTI89 / UPEC)
P0A6Y8 4.84e-05 49 27 20 360 1 dnaK Chaperone protein DnaK Escherichia coli (strain K12)
B1IRG0 4.84e-05 49 27 20 360 3 dnaK Chaperone protein DnaK Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6Y9 4.84e-05 49 27 20 360 3 dnaK Chaperone protein DnaK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLX5 4.84e-05 49 27 20 360 3 dnaK Chaperone protein DnaK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A766 4.84e-05 49 27 20 360 3 dnaK Chaperone protein DnaK Escherichia coli O1:K1 / APEC
P0A6Z0 4.84e-05 49 27 20 360 3 dnaK Chaperone protein DnaK Escherichia coli O157:H7
A7ZHA4 4.84e-05 49 27 20 360 3 dnaK Chaperone protein DnaK Escherichia coli O139:H28 (strain E24377A / ETEC)
B2IMB5 4.91e-05 49 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain CGSP14)
C1CQ18 5e-05 49 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain Taiwan19F-14)
C1CJ06 5e-05 49 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain P1031)
Q8CWT3 5e-05 49 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B1IA52 5e-05 49 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain Hungary19A-6)
C1C5N7 5e-05 49 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain 70585)
Q04LY0 5e-05 49 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A7I2D4 5.04e-05 49 23 16 339 3 dnaK Chaperone protein DnaK Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q7MN85 5.05e-05 49 26 21 365 3 dnaK Chaperone protein DnaK Vibrio vulnificus (strain YJ016)
Q8DF66 5.05e-05 49 26 21 365 3 dnaK Chaperone protein DnaK Vibrio vulnificus (strain CMCP6)
A5UBQ1 5.13e-05 49 29 15 265 3 dnaK Chaperone protein DnaK Haemophilus influenzae (strain PittEE)
C1CCQ8 5.26e-05 49 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain JJA)
P95829 5.26e-05 49 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZLY9 5.26e-05 49 26 13 261 3 dnaK Chaperone protein DnaK Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
O51883 5.6e-05 49 27 3 134 3 hscA Chaperone protein HscA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q6L0S7 5.82e-05 49 26 11 265 3 dnaK Chaperone protein DnaK Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
B6JCI3 5.91e-05 49 25 8 258 3 dnaK Chaperone protein DnaK Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A0M353 5.92e-05 49 25 9 264 3 dnaK Chaperone protein DnaK Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A4WW89 5.95e-05 49 26 11 274 3 dnaK Chaperone protein DnaK Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A0L4Z2 5.96e-05 49 25 14 278 3 dnaK Chaperone protein DnaK Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q835R7 6.16e-05 49 26 12 260 3 dnaK Chaperone protein DnaK Enterococcus faecalis (strain ATCC 700802 / V583)
Q8KEP3 6.21e-05 49 25 11 279 3 dnaK Chaperone protein DnaK Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q98QY7 6.34e-05 48 23 10 260 3 dnaK Chaperone protein DnaK Mycoplasmopsis pulmonis (strain UAB CTIP)
Q92J36 6.57e-05 48 24 14 285 3 dnaK Chaperone protein DnaK Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PMM7 6.57e-05 48 24 14 285 3 dnaK Chaperone protein DnaK Rickettsia africae (strain ESF-5)
Q1H365 6.84e-05 48 24 11 263 3 hscA Chaperone protein HscA homolog Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q0KCG7 6.96e-05 48 23 12 263 3 hscA Chaperone protein HscA homolog Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A1U614 7.04e-05 48 27 22 363 3 dnaK Chaperone protein DnaK Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q0I3V2 7.27e-05 48 27 20 361 3 dnaK Chaperone protein DnaK Histophilus somni (strain 129Pt)
B0UWR4 7.39e-05 48 27 20 361 3 dnaK Chaperone protein DnaK Histophilus somni (strain 2336)
B8F7S6 7.51e-05 48 27 10 265 3 dnaK Chaperone protein DnaK Glaesserella parasuis serovar 5 (strain SH0165)
O69298 7.53e-05 48 24 17 336 3 dnaK Chaperone protein DnaK Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B3H2X7 7.57e-05 48 28 15 265 3 dnaK Chaperone protein DnaK Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q1GKS3 7.62e-05 48 26 11 271 3 dnaK Chaperone protein DnaK Ruegeria sp. (strain TM1040)
Q6G1F9 7.63e-05 48 26 9 263 3 dnaK Chaperone protein DnaK Bartonella quintana (strain Toulouse)
A8GR22 7.82e-05 48 24 14 285 3 dnaK Chaperone protein DnaK Rickettsia rickettsii (strain Sheila Smith)
B0BWH1 7.82e-05 48 24 14 285 3 dnaK Chaperone protein DnaK Rickettsia rickettsii (strain Iowa)
A0T0X1 7.83e-05 48 24 10 260 3 dnaK Chaperone protein dnaK Thalassiosira pseudonana
A3N3K0 7.91e-05 48 28 15 265 3 dnaK Chaperone protein DnaK Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BTI7 7.91e-05 48 28 15 265 3 dnaK Chaperone protein DnaK Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q5F8E8 7.99e-05 48 24 9 258 3 hscA Chaperone protein HscA homolog Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A7GXU4 8.01e-05 48 23 16 339 3 dnaK Chaperone protein DnaK Campylobacter curvus (strain 525.92)
P64409 8.54e-05 48 26 11 258 3 dnaK Chaperone protein DnaK Tropheryma whipplei (strain Twist)
P64410 8.54e-05 48 26 11 258 3 dnaK Chaperone protein DnaK Tropheryma whipplei (strain TW08/27)
Q8GH79 8.61e-05 48 25 9 262 3 dnaK Chaperone protein DnaK Chlamydia abortus (strain DSM 27085 / S26/3)
Q6G554 8.77e-05 48 26 9 263 3 dnaK Chaperone protein DnaK Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q473J2 8.87e-05 48 24 10 263 3 hscA Chaperone protein HscA homolog Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
O06942 8.9e-05 48 25 12 261 2 dnaK Chaperone protein DnaK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A1UUC3 8.93e-05 48 26 9 263 3 dnaK Chaperone protein DnaK Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q89A16 9.26e-05 48 23 9 257 3 hscA Chaperone protein HscA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P27542 9.48e-05 48 30 2 130 3 dnaK Chaperone protein DnaK Chlamydia pneumoniae
Q7V1H4 9.59e-05 48 25 7 259 3 dnaK1 Chaperone protein dnaK1 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q5HAY1 9.73e-05 48 26 19 358 3 dnaK Chaperone protein DnaK Ehrlichia ruminantium (strain Welgevonden)
Q16D45 9.77e-05 48 25 9 269 3 dnaK Chaperone protein DnaK Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q3SW76 9.9e-05 48 24 7 262 3 dnaK Chaperone protein DnaK Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P57870 0.000101 48 26 19 362 3 dnaK Chaperone protein DnaK Pasteurella multocida (strain Pm70)
Q5LWJ6 0.000103 48 25 11 271 3 dnaK Chaperone protein DnaK Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1IF59 0.000105 48 24 15 360 3 dnaK Chaperone protein DnaK Pseudomonas entomophila (strain L48)
B2URT8 0.000105 48 24 18 340 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain Shi470)
B6JPL0 0.000105 48 24 18 340 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain P12)
B3QMB2 0.000107 48 25 11 279 3 dnaK Chaperone protein DnaK Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
P55994 0.000107 48 24 18 340 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain ATCC 700392 / 26695)
B5Z9P0 0.000112 48 24 18 340 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain G27)
B8H6Q1 0.000112 48 23 10 282 3 dnaK Chaperone protein DnaK Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
C3K1M1 0.000113 48 25 9 264 3 hscA Chaperone protein HscA homolog Pseudomonas fluorescens (strain SBW25)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_01600
Feature type CDS
Gene yegD
Product molecular chaperone
Location 309217 - 310569 (strand: -1)
Length 1353 (nucleotides) / 450 (amino acids)

Contig

Accession ZDB_359
Length 392768 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_677
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00012 Hsp70 protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0443 Posttranslational modification, protein turnover, chaperones (O) O Molecular chaperone DnaK (HSP70)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04046 hypothetical chaperone protein - -

Protein Sequence

MFIGFDYGTSNCSVAVMKEGTPVLLPLEGDNVYIPSTLCAPTRESVSEHLFRHRDILPSDNTGEQLLRRSIAFNREESIELVPEDVLFGQAALELYLNDPRDVYYVKSPKSFLGASGLHDVQISFFEDLVCAMMANIKSQAERSTQETITETVIGRPVNFHGLGGETANQQAEAILLRAAKRAGFQQITFQFEPVAAGLEYESVLNTDQTVLVVDIGGGTTDCSLIRMGPGYRGQADRTGSLLAHSGQRVGGNDLDIYLAFKQLMPLFGMNSRAASGIEMPLMQFWNPIAINNVEAQKEFYSRQNLTLLQQLKRDAAEPEKLLRLLEVYNQSLGYSIVRRAEEAKIALSASPEYRAAIRLLSETLETDISAAEMEESISSPKDKMISLVNDAVQQGGATPDAIFITGGSGRSLVLCRAIEAQLPGIPVVRGNDFGSVTAGLARWGEICFK

Flanking regions ( +/- flanking 50bp)

TGCGGTAAAGTTTCCGGCTTTTTTCCGGCATGGCAAACAGCGGAGGCATTATGTTTATTGGTTTTGATTACGGAACATCCAACTGCTCAGTGGCAGTGATGAAAGAGGGCACTCCGGTGTTATTACCGCTGGAGGGGGATAACGTCTATATTCCGTCCACGCTGTGTGCACCGACACGCGAATCCGTTTCCGAACACTTATTCCGTCACCGCGATATTCTGCCGTCGGATAATACCGGCGAACAGTTATTACGCCGTTCTATCGCCTTTAACCGTGAAGAAAGTATTGAGCTGGTGCCGGAGGATGTTTTGTTCGGCCAGGCCGCGCTGGAGCTCTATCTTAATGATCCGCGTGACGTGTATTACGTCAAATCCCCGAAATCCTTTCTCGGTGCTTCCGGGCTGCATGATGTGCAAATCAGCTTCTTTGAGGATCTGGTCTGCGCCATGATGGCGAATATCAAATCTCAGGCAGAGCGTTCAACACAGGAAACCATCACCGAAACGGTGATCGGCAGACCGGTTAACTTCCACGGATTGGGTGGTGAAACCGCCAATCAGCAGGCGGAGGCCATTCTTCTGCGGGCGGCAAAACGTGCCGGTTTTCAGCAGATTACCTTTCAGTTTGAACCGGTGGCGGCCGGGCTGGAATATGAGTCGGTACTGAATACGGATCAGACGGTGCTGGTGGTGGATATCGGCGGCGGTACCACCGACTGCTCACTCATCCGCATGGGGCCGGGCTACCGGGGTCAGGCCGATCGCACCGGCAGTCTGCTGGCACACAGCGGGCAGCGGGTCGGCGGAAACGATCTTGATATCTATCTGGCCTTTAAACAGCTGATGCCGCTGTTCGGGATGAACAGCCGCGCGGCTTCCGGTATCGAAATGCCGCTGATGCAATTCTGGAACCCGATCGCCATTAATAATGTGGAAGCACAGAAAGAGTTCTACTCCCGTCAGAATCTCACACTGTTACAGCAACTGAAGCGGGATGCGGCAGAGCCGGAAAAACTGCTGCGCCTGCTGGAAGTGTATAACCAGAGCCTGGGCTACAGCATTGTCCGCCGGGCGGAAGAGGCAAAAATCGCGCTTTCCGCCTCACCGGAGTATCGTGCGGCAATCCGCCTGCTCAGTGAAACGCTGGAAACAGACATCAGCGCGGCTGAAATGGAAGAATCGATTTCCTCCCCGAAAGATAAAATGATTTCCCTGGTGAATGATGCAGTGCAGCAGGGCGGCGCAACACCGGATGCTATCTTTATCACCGGCGGTTCAGGCCGTTCACTGGTGTTATGCCGCGCGATTGAGGCACAATTACCGGGTATTCCGGTGGTCAGAGGAAACGATTTCGGCTCGGTAACCGCCGGTCTGGCACGCTGGGGCGAAATTTGTTTTAAATAAACTTGCAACAGACCGGTCGGTCTATTAAAGTATTGTCATGAACAAACACA