Homologs in group_2543

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02480 FBDBKF_02480 100.0 Morganella morganii S1 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
EHELCC_02950 EHELCC_02950 100.0 Morganella morganii S2 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
NLDBIP_00510 NLDBIP_00510 100.0 Morganella morganii S4 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
HKOGLL_01565 HKOGLL_01565 100.0 Morganella morganii S5 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
F4V73_RS04855 F4V73_RS04855 74.4 Morganella psychrotolerans - PLP-dependent aminotransferase family protein

Distribution of the homologs in the orthogroup group_2543

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2543

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q01856 3.49e-56 195 32 6 429 3 RHOS4_30730 Uncharacterized HTH-type transcriptional regulator RHOS4_30730 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P96663 1.23e-42 159 27 11 443 3 ydeF Uncharacterized HTH-type transcriptional regulator YdeF Bacillus subtilis (strain 168)
Q796Q6 5.48e-34 136 26 11 474 3 yisV Uncharacterized HTH-type transcriptional regulator YisV Bacillus subtilis (strain 168)
P39389 2.54e-31 128 25 10 472 3 yjiR Uncharacterized HTH-type transcriptional regulator YjiR Escherichia coli (strain K12)
P95957 2.3e-28 119 25 5 334 3 SSO0104 Uncharacterized aminotransferase SSO0104 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q72LL6 7.89e-27 114 25 5 339 1 lysN 2-aminoadipate transaminase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
P96681 8.28e-26 112 22 12 467 3 ydfD Uncharacterized HTH-type transcriptional regulator YdfD Bacillus subtilis (strain 168)
P77730 7.45e-25 109 24 13 445 3 ydcR Uncharacterized HTH-type transcriptional regulator YdcR Escherichia coli (strain K12)
H3ZPL1 1.1e-24 108 25 6 346 1 OCC_04335 Aromatic-amino-acid aminotransferase 1 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
P49309 3.41e-20 96 24 6 380 3 mocR Probable rhizopine catabolism regulatory protein MocR Rhizobium meliloti
O07578 4.82e-19 92 23 14 381 3 yhdI Uncharacterized HTH-type transcriptional regulator YhdI Bacillus subtilis (strain 168)
P96669 7.13e-19 92 22 9 372 3 ydeL Uncharacterized HTH-type transcriptional regulator YdeL Bacillus subtilis (strain 168)
Q8NS92 2.76e-18 90 25 9 370 3 pdxR HTH-type pyridoxine biosynthesis transcriptional regulator PdxR Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
D5AKX9 7.92e-17 85 24 11 434 1 tauR HTH-type transcriptional regulator TauR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q5HJR1 2.32e-16 84 20 12 439 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain COL)
Q2G1P1 2.32e-16 84 20 12 439 1 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKF1 2.32e-16 84 20 12 439 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain USA300)
Q7A875 2.37e-15 81 20 12 439 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain N315)
Q99XA5 2.37e-15 81 20 12 439 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9HUI9 5.81e-15 79 28 9 269 1 aruH Arginine--pyruvate transaminase AruH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O58489 5.26e-14 77 24 6 270 3 aspC Aspartate aminotransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q2YUS3 8.4e-14 76 19 12 439 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain bovine RF122 / ET3-1)
O66630 2.69e-13 74 24 9 298 3 dapL LL-diaminopimelate aminotransferase Aquifex aeolicus (strain VF5)
Q08792 6.27e-13 73 23 9 300 3 ycxD Uncharacterized HTH-type transcriptional regulator YcxD Bacillus subtilis (strain 168)
O94570 1.02e-12 73 25 7 268 3 SPBC1773.13 Aromatic amino acid aminotransferase C1773.13 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9Y7S6 1.19e-12 73 22 12 415 3 SPCC569.07 Aromatic amino acid aminotransferase C569.07 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9WVM8 1.6e-12 72 25 8 251 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Mus musculus
Q64602 3.71e-12 71 26 13 294 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Rattus norvegicus
Q5E9N4 9.69e-12 70 23 7 295 2 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Bos taurus
P16524 1.49e-11 69 22 8 306 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
Q8N5Z0 2.57e-10 65 23 6 293 1 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Homo sapiens
A7XRY8 3.92e-10 65 24 11 314 1 tdiD Aminotransferase tdiD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O52815 7.41e-10 64 25 9 262 1 hpgT (S)-3,5-dihydroxyphenylglycine transaminase Amycolatopsis orientalis
Q54K00 9.56e-10 63 21 12 373 3 DDB_G0287711 Aromatic amino acid aminotransferase DDB_G0287711 Dictyostelium discoideum
O67781 6.01e-09 61 22 9 310 3 aspC Probable aspartate/prephenate aminotransferase Aquifex aeolicus (strain VF5)
E9L7A5 7.76e-09 61 28 10 215 1 PPA-AT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Petunia hybrida
Q972A2 1.76e-08 59 27 11 251 3 aspC Aspartate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q84CG1 1.88e-08 59 28 5 198 1 vioD Capreomycidine synthase Streptomyces vinaceus
Q56232 3.49e-08 58 24 9 301 1 aspC Aspartate/prephenate aminotransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q8ZKR0 3.87e-08 57 39 0 66 4 STM4068 HTH-type transcriptional repressor STM4068 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q86AG8 4.58e-08 58 20 8 337 3 DDB_G0272014 Aromatic amino acid aminotransferase DDB_G0272014 Dictyostelium discoideum
P31531 4.85e-08 58 24 13 325 2 ACS1 1-aminocyclopropane-1-carboxylate synthase Glycine max
Q3AC10 5.49e-08 58 21 12 345 3 dapL LL-diaminopimelate aminotransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q06402 6e-08 58 21 15 365 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Arabidopsis thaliana
Q3ZXC8 9.9e-08 57 21 8 315 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
A5FRC5 1.34e-07 57 21 8 315 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q9SAR0 1.94e-07 57 23 14 321 1 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Arabidopsis thaliana
O34817 2.43e-07 55 41 0 65 1 nagR HTH-type transcriptional repressor NagR Bacillus subtilis (strain 168)
Q9SNN8 2.81e-07 56 22 16 374 2 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Oryza sativa subsp. japonica
B8CX89 3.29e-07 55 23 11 305 3 dapL LL-diaminopimelate aminotransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
P94426 3.64e-07 55 20 12 379 1 gabR HTH-type transcriptional regulatory protein GabR Bacillus subtilis (strain 168)
Q3Z8H5 4.28e-07 55 21 8 317 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q07262 4.57e-07 55 20 16 358 2 ACS1 1-aminocyclopropane-1-carboxylate synthase Nicotiana tabacum
Q01912 4.64e-07 55 23 15 344 2 ACS5 1-aminocyclopropane-1-carboxylate synthase (Fragment) Vigna radiata var. radiata
P10356 4.78e-07 55 26 7 233 1 YER152C Uncharacterized protein YER152C Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40193 5.8e-07 55 23 12 430 1 ptsJ Vitamin B6 salvage pathway transcriptional repressor PtsJ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O33822 1.27e-06 53 26 7 243 3 aspC Probable aspartate/prephenate aminotransferase Thermus aquaticus
B3ECG2 1.38e-06 53 25 7 186 3 hisC Histidinol-phosphate aminotransferase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
P14909 1.42e-06 53 27 9 209 1 aspC Aspartate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q7NDX4 1.68e-06 53 25 6 207 1 dapL LL-diaminopimelate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9MB95 1.74e-06 53 22 14 319 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Prunus mume
Q58097 1.99e-06 53 21 12 329 1 mfnC (5-formylfuran-3-yl)methyl phosphate transaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B8DJJ6 2.57e-06 53 25 5 204 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A0KKB7 2.62e-06 52 29 8 178 3 hisC Histidinol-phosphate aminotransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q2RK33 3.07e-06 52 24 11 301 1 dapL LL-diaminopimelate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
C6C2Z3 3.38e-06 52 23 8 238 1 Dd703_1457 Aspartate aminotransferase Musicola paradisiaca (strain Ech703)
Q4L4E7 3.78e-06 52 22 11 315 3 hisC Histidinol-phosphate aminotransferase Staphylococcus haemolyticus (strain JCSC1435)
P29535 4.95e-06 52 22 13 298 2 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Solanum lycopersicum
Q3UX83 5.84e-06 52 23 12 296 2 Accsl Probable inactive 1-aminocyclopropane-1-carboxylate synthase-like protein 2 Mus musculus
A4SMP7 6.3e-06 51 30 9 179 3 hisC Histidinol-phosphate aminotransferase Aeromonas salmonicida (strain A449)
O14192 6.59e-06 52 21 7 266 3 SPAC56E4.03 Aromatic amino acid aminotransferase C56E4.03 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P18485 7.9e-06 51 20 15 355 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Solanum lycopersicum
Q9S9U6 1.03e-05 51 22 10 256 1 ACS11 1-aminocyclopropane-1-carboxylate synthase 11 Arabidopsis thaliana
Q492K2 1.36e-05 50 29 9 187 3 hisC Histidinol-phosphate aminotransferase Blochmanniella pennsylvanica (strain BPEN)
Q2YSI3 1.54e-05 50 20 12 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GIR8 1.66e-05 50 20 12 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MRSA252)
C6BUK3 1.87e-05 50 24 13 306 3 dapL LL-diaminopimelate aminotransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q8NXN3 1.93e-05 50 21 13 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MW2)
Q6GBA6 1.93e-05 50 21 13 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MSSA476)
A1BGB4 2.21e-05 50 26 7 186 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A4SE60 2.25e-05 50 25 5 172 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
D4AU29 2.62e-05 50 24 15 357 3 swnA Aminotransferase swnA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q824A4 2.93e-05 49 23 9 223 3 dapL LL-diaminopimelate aminotransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q00379 3.6e-05 49 20 15 350 2 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Cucurbita pepo
E9F8L8 3.71e-05 49 26 9 240 1 swnA Aminotransferase swnA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
B3QP11 3.92e-05 49 23 5 172 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
P13669 4.85e-05 48 34 0 67 1 mngR Mannosyl-D-glycerate transport/metabolism system repressor MngR Escherichia coli (strain K12)
A8YZZ5 5.02e-05 48 21 13 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300 / TCH1516)
P67725 5.02e-05 48 21 13 335 1 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain N315)
P67724 5.02e-05 48 21 13 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF32 5.02e-05 48 21 13 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Newman)
Q5HHU9 5.02e-05 48 21 13 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain COL)
A5IQS7 5.02e-05 48 21 13 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH9)
Q2G087 5.02e-05 48 21 13 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIR7 5.02e-05 48 21 13 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300)
A6TZK2 5.02e-05 48 21 13 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH1)
A7WZL0 5.02e-05 48 21 13 335 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
P96847 5.07e-05 48 26 7 196 1 aspB Valine--pyruvate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8GYY0 5.2e-05 49 22 8 226 2 ACS12 Probable aminotransferase ACS12 Arabidopsis thaliana
B4SGL8 5.44e-05 48 24 6 172 3 hisC Histidinol-phosphate aminotransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
O84395 5.56e-05 48 27 10 178 1 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KLW3 5.56e-05 48 27 10 178 3 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
P22405 5.71e-05 48 42 0 66 4 korA Protein KorA Streptomyces lividans
P37821 6.25e-05 48 20 11 321 1 ACS-1 1-aminocyclopropane-1-carboxylate synthase Malus domestica
P27486 6.39e-05 48 22 15 329 2 ACS2 1-aminocyclopropane-1-carboxylate synthase Dianthus caryophyllus
Q67Y55 6.61e-05 48 27 7 189 2 At4g28420 Probable aminotransferase TAT1 Arabidopsis thaliana
Q8KD01 7.08e-05 48 22 6 194 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P23279 7.55e-05 48 20 15 350 1 ACC1A 1-aminocyclopropane-1-carboxylate synthase 1 Cucurbita pepo
O31665 7.69e-05 48 22 9 272 1 mtnE L-glutamine--4-(methylsulfanyl)-2-oxobutanoate aminotransferase Bacillus subtilis (strain 168)
Q9PK04 8.92e-05 48 25 9 178 3 dapL LL-diaminopimelate aminotransferase Chlamydia muridarum (strain MoPn / Nigg)
Q58786 9.02e-05 48 23 15 307 1 dapL LL-diaminopimelate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q30ZX9 9.15e-05 48 22 12 304 3 dapL LL-diaminopimelate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
P77434 0.00012 47 23 12 257 1 alaC Glutamate-pyruvate aminotransferase AlaC Escherichia coli (strain K12)
B0BC25 0.000146 47 26 9 174 3 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7W0 0.000146 47 26 9 174 3 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q4J8X2 0.000148 47 24 3 200 3 aspC Aspartate aminotransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P53090 0.000152 47 22 7 288 1 ARO8 Aromatic/aminoadipate aminotransferase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O87320 0.000184 47 24 14 287 3 aatC Putative aminotransferase AatC Rhizobium meliloti (strain 1021)
Q9V0L2 0.000194 47 23 16 337 3 aspC Aspartate aminotransferase Pyrococcus abyssi (strain GE5 / Orsay)
Q9ZQI7 0.000197 47 26 8 176 1 ALD1 Aminotransferase ALD1, chloroplastic Arabidopsis thaliana
Q3B3L3 0.000257 46 24 5 172 3 hisC Histidinol-phosphate aminotransferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
P54590 0.000327 43 33 0 69 4 yhcF Uncharacterized HTH-type transcriptional regulator YhcF Bacillus subtilis (strain 168)
Q04296 0.000342 45 35 0 76 4 SCO4628 Uncharacterized HTH-type transcriptional regulator SCO4628 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q253K9 0.000368 46 25 9 167 3 dapL LL-diaminopimelate aminotransferase Chlamydia felis (strain Fe/C-56)
C6DF75 0.000376 46 25 7 227 3 hisC Histidinol-phosphate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A3CNT7 0.000431 45 24 4 170 3 hisC Histidinol-phosphate aminotransferase Streptococcus sanguinis (strain SK36)
Q3J7H2 0.000502 45 25 9 233 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q1RA52 0.000666 45 25 7 197 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain UTI89 / UPEC)
Q8FG51 0.000666 45 25 7 197 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TG66 0.000666 45 25 7 197 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q5L6M0 0.000705 45 22 14 286 3 dapL LL-diaminopimelate aminotransferase Chlamydia abortus (strain DSM 27085 / S26/3)
B7UT58 0.00074 45 25 7 197 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5XPE6 0.000741 45 27 9 193 3 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae (strain 342)
Q3A7R3 0.000842 45 28 6 176 3 hisC Histidinol-phosphate aminotransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q3Z0G4 0.000867 45 26 8 202 3 hisC Histidinol-phosphate aminotransferase Shigella sonnei (strain Ss046)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_01525
Feature type CDS
Gene aRO8
Product DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
Location 291314 - 292651 (strand: 1)
Length 1338 (nucleotides) / 445 (amino acids)

Contig

Accession ZDB_359
Length 392768 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2543
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II
PF00392 Bacterial regulatory proteins, gntR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1167 Transcription (K)
Amino acid transport and metabolism (E)		 KE DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain

Protein Sequence

MATPRYKQYVDTLAARIRNGELAAGTQLPTHRAFAAQEGLSLVTASRVYQELINQGLVSGETGRGTFVRDISLLPVTGIECDVTPAMYDLNFIYPEVTEQTALLRHTLRRLSMSGHLESLLHYLPHAGRHQERVVVADHLKLRGFSAVDPDTVVMVSGAQHGLASVVLSMFSPGDVIAADALTYPGFKALAQTCHIELVPVPVTPEGPDLAALAQLCRQRKIRGYFTMPTLHNPLGWVMDLTSRRKLISLARENRFFLIEDGSYAFLQKPAPAPLAELAPDITFYVTGFSKNIATGLRVGLIVAPPEYIAELEKIIRITTWNTPALMTGIVREWLEQGEAEKLEQKKRRDAKARQKIVSRIFADLPHIAHPAGYFLWIPLPENVRCDAVISRLRAANIAVSPAESYAVTRDIPQAIRVAVSTLPYDDLGSALMTVRDTITYLMDL

Flanking regions ( +/- flanking 50bp)

AGTAATGCGGATAATTATGACAATCAAAAAATTGTCATGGATACATTTGTATGGCAACGCCACGTTATAAACAGTACGTCGATACCCTTGCAGCCCGTATCCGTAACGGTGAACTGGCGGCCGGAACACAATTGCCGACTCATCGTGCTTTTGCGGCTCAGGAAGGGCTGTCATTAGTGACAGCGTCACGTGTGTATCAGGAACTGATCAATCAGGGGCTGGTCAGTGGTGAAACCGGACGGGGAACATTTGTCAGAGATATCAGTTTATTACCGGTTACCGGTATTGAATGTGATGTCACTCCGGCAATGTATGACCTTAACTTTATCTATCCGGAAGTCACGGAACAGACCGCATTACTGCGCCACACGCTGCGCCGGTTATCCATGAGCGGCCATCTGGAAAGTTTGCTGCATTACCTGCCTCACGCCGGGCGGCATCAGGAGAGGGTTGTTGTTGCTGATCACCTGAAGTTGCGTGGTTTTTCTGCCGTTGACCCGGATACTGTTGTCATGGTCAGCGGAGCCCAGCACGGTCTGGCCTCTGTTGTACTGAGCATGTTCAGCCCCGGTGATGTAATTGCGGCGGATGCACTGACTTATCCCGGCTTTAAAGCACTGGCACAAACCTGTCATATCGAATTAGTTCCGGTGCCGGTTACCCCGGAGGGCCCTGATTTGGCGGCACTGGCACAATTATGCCGTCAGCGGAAAATCCGCGGCTATTTCACCATGCCGACACTGCATAATCCGCTCGGCTGGGTGATGGATCTGACATCCCGCAGGAAGCTGATAAGTCTGGCCCGGGAAAACCGTTTTTTTCTGATAGAAGACGGCTCCTATGCTTTTCTGCAGAAACCGGCGCCGGCTCCGCTGGCAGAACTGGCACCGGATATCACATTTTATGTCACCGGATTTTCCAAAAATATCGCCACCGGCCTGCGGGTCGGATTAATTGTTGCGCCTCCGGAATATATTGCTGAGCTGGAAAAAATCATCCGCATCACCACCTGGAACACACCGGCACTGATGACCGGTATTGTCCGTGAGTGGCTGGAGCAGGGAGAAGCCGAAAAACTGGAGCAGAAAAAGCGCCGCGATGCCAAAGCCCGGCAAAAAATAGTCAGCCGGATTTTTGCTGATTTACCCCATATCGCACATCCGGCCGGTTATTTTTTGTGGATCCCGCTACCGGAAAATGTACGCTGCGATGCGGTTATCAGCCGCCTGAGAGCGGCCAACATTGCCGTCAGTCCTGCAGAGTCTTATGCCGTAACCCGCGATATCCCGCAGGCTATCCGTGTGGCTGTCAGCACACTGCCGTATGATGACCTGGGATCCGCACTGATGACGGTCAGAGACACCATTACCTATCTGATGGATTTATGATGTTATGAAAAGCATTCACGAATGGCATGACCGGCACTATACCGTAACAA