Homologs in group_1377

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08515 FBDBKF_08515 100.0 Morganella morganii S1 fklB FKBP-type peptidyl-prolyl cis-trans isomerase
EHELCC_13010 EHELCC_13010 100.0 Morganella morganii S2 fklB FKBP-type peptidyl-prolyl cis-trans isomerase
NLDBIP_13350 NLDBIP_13350 100.0 Morganella morganii S4 fklB FKBP-type peptidyl-prolyl cis-trans isomerase
LHKJJB_13205 LHKJJB_13205 100.0 Morganella morganii S3 fklB FKBP-type peptidyl-prolyl cis-trans isomerase
F4V73_RS09740 F4V73_RS09740 96.1 Morganella psychrotolerans - peptidylprolyl isomerase
PMI_RS16845 PMI_RS16845 78.6 Proteus mirabilis HI4320 - peptidylprolyl isomerase

Distribution of the homologs in the orthogroup group_1377

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1377

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9L4 1.26e-121 345 80 0 206 3 fklB FKBP-type 22 kDa peptidyl-prolyl cis-trans isomerase Shigella flexneri
P0A9L3 1.26e-121 345 80 0 206 1 fklB FKBP-type 22 kDa peptidyl-prolyl cis-trans isomerase Escherichia coli (strain K12)
O08437 2.74e-53 174 48 5 210 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Aeromonas hydrophila
Q5ZXE0 2.81e-53 173 45 2 196 1 mip Outer membrane protein MIP Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q70YI1 4.11e-53 172 45 2 196 1 mip Outer membrane protein MIP Legionella pneumophila
A5IGB8 4.11e-53 172 45 2 196 3 mip Outer membrane protein MIP Legionella pneumophila (strain Corby)
P31106 3.03e-52 171 43 3 208 3 mip Outer membrane protein MIP Legionella micdadei
P53605 3.07e-47 157 39 2 205 3 mip Outer membrane protein MIP Legionella longbeachae
Q9JYI8 5.14e-43 148 42 5 212 1 fkpA Probable FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P44760 9.98e-43 146 40 3 210 1 HI_0574 Probable FKBP-type peptidyl-prolyl cis-trans isomerase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P51752 5.67e-41 141 36 2 204 1 mip Peptidyl-prolyl cis-trans isomerase Mip Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q09734 2.25e-35 126 52 1 123 1 MIP Macrophage infectivity potentiator Trypanosoma cruzi
P65764 2.16e-32 120 34 6 218 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P65765 2.16e-32 120 34 6 218 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Escherichia coli O157:H7
P45523 2.18e-32 120 34 6 218 1 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Escherichia coli (strain K12)
Q89A61 1.31e-30 115 31 6 220 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q6CGG3 6.92e-27 103 57 1 89 3 FPR2 FK506-binding protein 2 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q554J3 1.25e-25 98 48 1 103 3 fkbp1 FK506-binding protein 1 Dictyostelium discoideum
P57599 4.64e-24 98 32 6 216 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K943 1.07e-22 95 32 6 211 3 fkpA FKBP-type peptidyl-prolyl cis-trans isomerase FkpA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q6BP84 1.61e-22 91 55 2 87 3 FPR2 FK506-binding protein 2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P32472 1.7e-22 91 54 2 88 1 FPR2 Peptidyl-prolyl cis-trans isomerase FPR2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0CP97 3.16e-22 90 54 2 90 3 FPR2 FK506-binding protein 2 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CP96 3.3e-22 90 54 2 90 3 FPR2 FK506-binding protein 2 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P56989 4.57e-22 89 47 1 99 3 fbp FK506-binding protein Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q41649 8.38e-22 90 47 1 89 1 FKBP15 FK506-binding protein 2 Vicia faba
P0A0W2 1.14e-21 88 45 1 106 1 fbp FK506-binding protein Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q54SR7 1.25e-21 89 50 1 87 3 fkbp2 FK506-binding protein 2 Dictyostelium discoideum
P26883 1.25e-21 88 46 2 106 1 Fkbp1a Peptidyl-prolyl cis-trans isomerase FKBP1A Mus musculus
Q6FMA3 1.62e-21 88 44 2 110 1 FPR1 FK506-binding protein 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6FSC1 2.35e-21 88 52 2 88 3 FPR2 FK506-binding protein 2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P0A0W3 3.29e-21 87 50 1 89 3 fbp FK506-binding protein Neisseria meningitidis serogroup C
Q38935 4.05e-21 88 47 1 89 2 FKBP15-1 Peptidyl-prolyl cis-trans isomerase FKBP15-1 Arabidopsis thaliana
Q62658 4.5e-21 87 45 2 106 1 Fkbp1a Peptidyl-prolyl cis-trans isomerase FKBP1A Rattus norvegicus
P26623 4.74e-21 90 37 2 143 3 mip Peptidyl-prolyl cis-trans isomerase Mip Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
P20081 5.08e-21 87 47 2 108 1 FPR1 FK506-binding protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P48375 5.46e-21 86 45 2 106 3 Fkbp12 Peptidyl-prolyl cis-trans isomerase Fkbp12 Drosophila melanogaster
Q38936 6.84e-21 88 47 1 89 2 FKBP15-2 Peptidyl-prolyl cis-trans isomerase FKBP15-2 Arabidopsis thaliana
Q6CUZ8 7.11e-21 87 48 2 91 3 FPR2 FK506-binding protein 2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P20080 1.3e-20 86 46 2 107 1 fkr-2 FK506-binding protein 1A Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P62943 1.59e-20 85 45 2 106 1 FKBP1A Peptidyl-prolyl cis-trans isomerase FKBP1A Oryctolagus cuniculus
P62942 1.59e-20 85 45 2 106 1 FKBP1A Peptidyl-prolyl cis-trans isomerase FKBP1A Homo sapiens
P30417 1.75e-20 88 43 2 119 3 fkl Probable FKBP-type 25 kDa peptidyl-prolyl cis-trans isomerase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O42993 2.27e-20 85 45 2 106 3 fkh1 Peptidyl-prolyl cis-trans isomerase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6CX30 2.37e-20 85 46 2 110 3 FPR1 FK506-binding protein 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q6BX45 2.64e-20 85 44 2 104 3 FPR1 FK506-binding protein 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P0C1J3 3.63e-20 84 45 2 106 3 FKBP1 FK506-binding protein 1 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P45878 5e-20 85 52 1 89 1 Fkbp2 Peptidyl-prolyl cis-trans isomerase FKBP2 Mus musculus
Q32PA9 5.5e-20 85 50 3 106 2 FKBP2 Peptidyl-prolyl cis-trans isomerase FKBP2 Bos taurus
P26885 6.37e-20 85 50 3 106 1 FKBP2 Peptidyl-prolyl cis-trans isomerase FKBP2 Homo sapiens
Q9PJK1 9.29e-20 87 37 2 131 3 mip Peptidyl-prolyl cis-trans isomerase Mip Chlamydia muridarum (strain MoPn / Nigg)
P0C1J5 1.04e-19 86 54 2 88 3 FKBP3 FK506-binding protein 2B Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P18203 1.25e-19 83 44 2 106 1 FKBP1A Peptidyl-prolyl cis-trans isomerase FKBP1A Bos taurus
Q754K8 3.01e-19 82 44 2 108 3 FPR1 FK506-binding protein 1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q5VVH2 1.17e-18 80 42 2 106 1 FKBP1C Peptidyl-prolyl cis-trans isomerase FKBP1C Homo sapiens
Q4WLV6 1.64e-18 80 47 1 92 1 fpr1A FK506-binding protein 1A Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
O94746 2.49e-18 79 44 2 106 1 FRR1 FK506-binding protein 1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q6KBA8 2.59e-18 79 45 3 108 3 fprA FK506-binding protein 1A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P0CP94 2.65e-18 79 44 2 106 3 FPR1 FK506-binding protein 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP95 2.65e-18 79 44 2 106 3 FPR1 FK506-binding protein 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q38931 6.06e-18 84 42 2 107 1 FKBP62 Peptidyl-prolyl cis-trans isomerase FKBP62 Arabidopsis thaliana
Q54NB6 6.77e-18 84 38 0 118 1 fkbp4 FK506-binding protein 4 Dictyostelium discoideum
Q9FJL3 9.08e-18 84 43 2 106 1 FKBP65 Peptidyl-prolyl cis-trans isomerase FKBP65 Arabidopsis thaliana
O42123 1.23e-17 78 41 2 106 3 fkbp1a Peptidyl-prolyl cis-trans isomerase FKBP1A Xenopus laevis
Q6CF41 3.83e-17 76 42 2 106 3 FPR1 FK506-binding protein 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
P26884 7.78e-17 79 43 4 110 1 FKBP3 Peptidyl-prolyl cis-trans isomerase FKBP3 Bos taurus
Q4HZB8 8.08e-17 75 42 3 112 3 FPR1 FK506-binding protein 1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
O46638 8.63e-17 78 43 4 110 2 FKBP3 Peptidyl-prolyl cis-trans isomerase FKBP3 Oryctolagus cuniculus
Q62446 1.18e-16 78 42 4 110 1 Fkbp3 Peptidyl-prolyl cis-trans isomerase FKBP3 Mus musculus
Q00688 1.76e-16 77 43 4 110 1 FKBP3 Peptidyl-prolyl cis-trans isomerase FKBP3 Homo sapiens
P68106 2.23e-16 74 38 2 106 1 FKBP1B Peptidyl-prolyl cis-trans isomerase FKBP1B Homo sapiens
P68107 2.23e-16 74 38 2 106 1 FKBP1B Peptidyl-prolyl cis-trans isomerase FKBP1B Bos taurus
Q9Z2I2 4.59e-16 73 38 2 106 1 Fkbp1b Peptidyl-prolyl cis-trans isomerase FKBP1B Mus musculus
Q9VL78 5.05e-16 79 39 2 106 1 Fkbp59 FK506-binding protein 59 Drosophila melanogaster
P97534 5.1e-16 73 38 2 106 1 Fkbp1b Peptidyl-prolyl cis-trans isomerase FKBP1B Rattus norvegicus
Q5ATN7 5.14e-16 74 47 3 91 3 fkbB FK506-binding protein 2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4WHX4 6.07e-16 74 48 3 91 3 fpr2 FK506-binding protein 2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P28870 6.88e-16 73 41 3 115 1 RBP1 FK506-binding protein 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9SCY2 9.91e-16 75 38 4 134 1 FKBP13 Peptidyl-prolyl cis-trans isomerase FKBP13, chloroplastic Arabidopsis thaliana
Q8HYX6 1.12e-15 72 38 2 106 3 FKBP1B Peptidyl-prolyl cis-trans isomerase FKBP1B Oryctolagus cuniculus
Q02790 1.44e-15 77 43 2 101 1 FKBP4 Peptidyl-prolyl cis-trans isomerase FKBP4 Homo sapiens
Q9Z7P3 1.66e-15 75 33 2 142 3 mip Peptidyl-prolyl cis-trans isomerase Mip Chlamydia pneumoniae
P27124 3.44e-15 76 41 3 117 1 FKBP4 Peptidyl-prolyl cis-trans isomerase FKBP4 Oryctolagus cuniculus
P30416 4.37e-15 76 41 3 117 1 Fkbp4 Peptidyl-prolyl cis-trans isomerase FKBP4 Mus musculus
Q9QVC8 5.04e-15 76 47 1 87 1 Fkbp4 Peptidyl-prolyl cis-trans isomerase FKBP4 Rattus norvegicus
Q2U316 6.07e-15 71 40 4 116 3 fpr1 FK506-binding protein 1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q2UPT7 6.5e-15 71 46 3 90 3 fpr2 FK506-binding protein 2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P28725 9.82e-15 70 40 3 106 1 fkbP FK506-binding protein Streptomyces anulatus
Q9TRY0 1.36e-14 74 41 3 117 1 FKBP4 Peptidyl-prolyl cis-trans isomerase FKBP4 Bos taurus
Q7SCN0 1.6e-14 74 40 3 118 3 fkr-4 FK506-binding protein 4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
O60046 1.93e-14 72 44 3 90 1 fkr-5 FK506-binding protein 2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P0C1J6 2.26e-14 73 39 2 111 3 FKBP4 FK506-binding protein 4 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P42458 3e-14 69 43 2 101 3 Cgl0830 Probable FK506-binding protein Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q43207 5.49e-14 73 44 1 89 1 FKBP70 70 kDa peptidyl-prolyl isomerase Triticum aestivum
Q43207 1.06e-05 48 38 4 92 1 FKBP70 70 kDa peptidyl-prolyl isomerase Triticum aestivum
Q43207 0.00021 45 30 4 111 1 FKBP70 70 kDa peptidyl-prolyl isomerase Triticum aestivum
Q8I4V8 7.2e-14 72 37 3 111 1 FKBP35 Peptidyl-prolyl cis-trans isomerase FKBP35 Plasmodium falciparum (isolate 3D7)
Q4IN00 7.36e-14 70 47 3 90 3 FPR2 FK506-binding protein 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q61576 1.1e-13 72 44 1 88 1 Fkbp10 Peptidyl-prolyl cis-trans isomerase FKBP10 Mus musculus
Q61576 2.54e-10 62 36 1 87 1 Fkbp10 Peptidyl-prolyl cis-trans isomerase FKBP10 Mus musculus
Q61576 1.85e-08 57 39 1 87 1 Fkbp10 Peptidyl-prolyl cis-trans isomerase FKBP10 Mus musculus
Q61576 5.83e-08 55 41 2 85 1 Fkbp10 Peptidyl-prolyl cis-trans isomerase FKBP10 Mus musculus
Q4W9R2 1.59e-13 67 40 3 113 3 fpr1B FK506-binding protein 1B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q2YDL5 1.08e-12 67 41 1 87 2 FKBP11 Peptidyl-prolyl cis-trans isomerase FKBP11 Bos taurus
Q96AY3 1.27e-12 69 42 1 87 1 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Homo sapiens
Q96AY3 7.67e-10 61 36 1 87 1 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Homo sapiens
Q96AY3 2.09e-08 57 42 2 85 1 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Homo sapiens
Q96AY3 2.97e-08 56 39 1 87 1 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Homo sapiens
Q93ZG9 1.35e-12 68 41 4 97 1 FKBP53 Peptidyl-prolyl cis-trans isomerase FKBP53 Arabidopsis thaliana
Q86ZF2 1.79e-12 66 43 3 93 3 FPR2 FK506-binding protein 2 Podospora anserina
P54397 1.91e-12 68 43 1 93 1 Fkbp39 39 kDa FK506-binding nuclear protein Drosophila melanogaster
Q9FLB3 2.51e-12 65 44 5 98 2 FKBP15-3 Peptidyl-prolyl cis-trans isomerase FKBP15-3 Arabidopsis thaliana
Q9SCY3 3.8e-12 66 35 3 123 1 PNSL4 Photosynthetic NDH subunit of lumenal location 4, chloroplastic Arabidopsis thaliana
P0C1B0 5.69e-12 67 41 3 96 3 fpr4 FK506-binding protein 4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G0SC91 5.87e-12 67 47 3 87 3 FPR4 FK506-binding protein 4 Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
Q4INZ9 6.77e-12 67 41 3 96 3 FPR4 FK506-binding protein 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P59024 7.16e-12 65 44 4 90 1 Fkbp14 Peptidyl-prolyl cis-trans isomerase FKBP14 Mus musculus
Q2HJ89 7.79e-12 67 40 1 88 2 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Bos taurus
Q2HJ89 3.16e-10 62 37 1 87 2 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Bos taurus
Q2HJ89 2.97e-08 56 39 1 87 2 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Bos taurus
Q2HJ89 2.09e-07 53 41 2 85 2 FKBP10 Peptidyl-prolyl cis-trans isomerase FKBP10 Bos taurus
Q9XSH5 9.12e-12 66 40 1 91 1 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Saimiri boliviensis boliviensis
P0CP98 1.02e-11 66 37 3 119 3 FPR4 FK506-binding protein 4 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP99 1.02e-11 66 37 3 119 3 FPR4 FK506-binding protein 4 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q5R941 1.3e-11 64 44 4 90 2 FKBP14 Peptidyl-prolyl cis-trans isomerase FKBP14 Pongo abelii
Q9NWM8 1.3e-11 64 44 4 90 1 FKBP14 Peptidyl-prolyl cis-trans isomerase FKBP14 Homo sapiens
Q10175 1.43e-11 65 39 3 97 1 SPAC27F1.06c Probable peptidyl-prolyl cis-trans isomerase C27F1.06c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O22870 1.71e-11 64 28 4 194 1 FKBP16-3 Peptidyl-prolyl cis-trans isomerase FKBP16-3, chloroplastic Arabidopsis thaliana
Q66H94 1.83e-11 65 43 1 88 2 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Rattus norvegicus
Q66H94 1.08e-10 63 43 1 87 2 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Rattus norvegicus
Q66H94 3.51e-09 59 36 2 87 2 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Rattus norvegicus
Q66H94 7.9e-09 58 34 1 94 2 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Rattus norvegicus
O95302 2.07e-11 65 43 1 88 1 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Homo sapiens
O95302 3.55e-10 62 31 4 141 1 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Homo sapiens
O95302 3.93e-09 58 34 1 94 1 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Homo sapiens
O95302 5.27e-09 58 41 1 87 1 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Homo sapiens
Q2KJC8 2.16e-11 65 43 1 88 2 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Bos taurus
Q2KJC8 1.26e-09 60 31 4 141 2 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Bos taurus
Q2KJC8 3.03e-09 59 42 1 87 2 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Bos taurus
Q2KJC8 7.48e-09 58 34 1 94 2 FKBP9 Peptidyl-prolyl cis-trans isomerase FKBP9 Bos taurus
Q9Z247 2.6e-11 65 42 1 88 1 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Mus musculus
Q9Z247 8.83e-11 63 43 1 87 1 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Mus musculus
Q9Z247 1.12e-09 60 36 2 87 1 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Mus musculus
Q9Z247 3.61e-09 59 34 1 94 1 Fkbp9 Peptidyl-prolyl cis-trans isomerase FKBP9 Mus musculus
Q6M981 2.94e-11 61 41 2 99 3 fkr-3 FK506-binding protein 1B Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q4PIN7 3.31e-11 64 32 4 148 3 FPR4 FK506-binding protein 4 Ustilago maydis (strain 521 / FGSC 9021)
Q9XSI2 3.38e-11 65 40 1 89 2 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Saguinus oedipus
Q9D1M7 3.88e-11 63 39 1 87 1 Fkbp11 Peptidyl-prolyl cis-trans isomerase FKBP11 Mus musculus
Q9XT11 4.85e-11 64 38 1 91 2 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Aotus nancymaae
Q64378 5.48e-11 64 39 1 91 1 Fkbp5 Peptidyl-prolyl cis-trans isomerase FKBP5 Mus musculus
Q13451 6.82e-11 63 35 2 112 1 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Homo sapiens
Q5RF88 7.79e-11 63 35 2 112 2 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Pongo abelii
Q9NYL4 9.36e-11 62 37 1 87 1 FKBP11 Peptidyl-prolyl cis-trans isomerase FKBP11 Homo sapiens
Q4WMV5 9.86e-11 63 36 3 106 3 fpr4 FK506-binding protein 4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q2UN37 2.13e-10 62 36 3 106 3 fpr4 FK506-binding protein 4 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q26486 2.49e-10 62 35 3 106 2 FKBP46 46 kDa FK506-binding nuclear protein Spodoptera frugiperda
Q95L05 2.69e-10 62 34 2 112 2 FKBP5 Peptidyl-prolyl cis-trans isomerase FKBP5 Chlorocebus aethiops
Q54Y27 2.88e-10 62 32 2 114 3 fkbp6 FK506-binding protein 6 Dictyostelium discoideum
P0C1J7 5.05e-10 61 36 2 108 3 FKBP5 FK506-binding protein 5 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q6FKH7 2.28e-09 59 37 3 109 3 FPR3 FK506-binding protein 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O74191 2.82e-09 59 33 3 109 1 fkbp39 FK506-binding protein 39 kDa Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6FK71 2.12e-08 56 32 3 118 3 FPR4 FK506-binding protein 4 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6C4C9 4.86e-08 55 34 3 107 3 FPR3 FK506-binding protein 3 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q54G21 5.43e-08 55 38 3 99 1 fkbp5 FK506-binding protein 5 Dictyostelium discoideum
F4J9Q6 5.95e-08 55 35 4 112 1 FKBP43 Peptidyl-prolyl cis-trans isomerase FKBP43 Arabidopsis thaliana
P38911 6.12e-08 55 33 3 119 1 FPR3 Peptidyl-prolyl cis-trans isomerase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0CY37 7.66e-08 52 37 3 110 3 FKBP3 FK506-binding protein 1B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q8LGG0 9.27e-08 52 38 4 110 1 FKBP12 Peptidyl-prolyl cis-trans isomerase FKBP12 Arabidopsis thaliana
Q54N80 1.2e-07 53 37 2 88 2 fkbp3 FK506-binding protein 3 Dictyostelium discoideum
Q06205 2.82e-07 53 32 3 119 1 FPR4 FK506-binding protein 4 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9Y680 3.27e-07 52 35 5 125 1 FKBP7 Peptidyl-prolyl cis-trans isomerase FKBP7 Homo sapiens
Q5RET2 4.73e-07 52 39 4 93 2 FKBP7 Peptidyl-prolyl cis-trans isomerase FKBP7 Pongo abelii
Q9SR70 6.3e-07 51 31 5 148 1 FKBP16-4 Peptidyl-prolyl cis-trans isomerase FKBP16-4, chloroplastic Arabidopsis thaliana
Q9M2S7 8.08e-07 50 39 2 84 1 FKBP20-1 Peptidyl-prolyl cis-trans isomerase FKBP20-1 Arabidopsis thaliana
Q756V1 1.72e-06 51 35 3 96 3 FPR3 FK506-binding protein 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q6CWE8 7.97e-06 49 34 3 96 3 FPR3 FK506-binding protein 3 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
O75344 1.96e-05 47 33 3 110 1 FKBP6 Inactive peptidyl-prolyl cis-trans isomerase FKBP6 Homo sapiens
Q59VR3 2.3e-05 47 32 3 96 3 FPR3 FK506-binding protein 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
F6PHZ6 0.000155 45 31 3 110 1 FKBP6 Inactive peptidyl-prolyl cis-trans isomerase FKBP6 Equus caballus
A6QQ71 0.000197 44 31 3 110 2 FKBP6 Inactive peptidyl-prolyl cis-trans isomerase FKBP6 Bos taurus
Q6BSE7 0.000401 43 30 3 96 3 FPR3 FK506-binding protein 3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q75LS8 0.000659 42 43 0 46 5 FKBP9P1 Putative FK506-binding protein 9-like protein Homo sapiens

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_11825
Feature type CDS
Gene fklB
Product FKBP-type peptidyl-prolyl cis-trans isomerase
Location 79652 - 80272 (strand: -1)
Length 621 (nucleotides) / 206 (amino acids)

Contig

Accession ZDB_689
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1377
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00254 FKBP-type peptidyl-prolyl cis-trans isomerase
PF01346 Domain amino terminal to FKBP-type peptidyl-prolyl isomerase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0545 Posttranslational modification, protein turnover, chaperones (O) O FKBP-type peptidyl-prolyl cis-trans isomerase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03773 FKBP-type peptidyl-prolyl cis-trans isomerase FklB [EC:5.2.1.8] - -

Protein Sequence

MTQPTFDTMEAQASYGIGLQIGQQLQESGLSGLVPEAILAGITDALENNQPAVAVDVLHRALREMHERADAVRNEKQAELVKDGMRFLEENAKKEGVSTTESGLQFSVINQGDGAIPARTDRVRVHYTGRLIDGTVFDSSVQRGQPAEFPVNGVIAGWIEALTLMPVGSKWELYIPSNLAYGERGAGAAIPPYSTLVFEVELLEIL

Flanking regions ( +/- flanking 50bp)

ACATCCTGCTGTTATGCTTGTCCGTCTTACTTATTACTCAGGTATCTCTCATGACACAACCGACTTTTGACACGATGGAAGCACAGGCAAGCTACGGAATCGGCTTACAAATCGGCCAGCAATTACAGGAATCCGGACTGAGCGGATTAGTACCGGAAGCTATTCTGGCCGGTATCACCGACGCACTGGAAAATAACCAGCCGGCTGTGGCGGTGGATGTTCTGCATCGTGCCCTGCGTGAAATGCATGAGCGTGCTGATGCTGTCCGCAATGAAAAACAGGCTGAACTGGTCAAAGACGGCATGCGTTTCCTGGAAGAAAACGCGAAGAAAGAAGGCGTTTCCACCACTGAAAGCGGCCTGCAGTTCTCTGTCATTAATCAGGGTGACGGCGCTATCCCGGCCCGCACTGACCGTGTCCGTGTTCACTACACCGGCCGTCTGATCGACGGTACTGTGTTTGACAGCTCTGTACAGCGCGGCCAGCCGGCAGAATTCCCGGTAAACGGCGTGATCGCAGGCTGGATTGAAGCACTGACCCTGATGCCGGTCGGCTCCAAATGGGAACTGTATATCCCGAGCAACCTGGCTTACGGCGAGCGCGGTGCCGGTGCGGCAATCCCGCCGTACAGCACACTGGTATTCGAAGTGGAGCTGCTGGAGATCCTGTAATCTCTCTTTGTCAACAATAACAGAATATGCGAAATGGCCGGTTTTCACCG