Homologs in group_1451

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08615 FBDBKF_08615 100.0 Morganella morganii S1 greA transcription elongation factor GreA
EHELCC_12910 EHELCC_12910 100.0 Morganella morganii S2 greA transcription elongation factor GreA
NLDBIP_13250 NLDBIP_13250 100.0 Morganella morganii S4 greA transcription elongation factor GreA
LHKJJB_13305 LHKJJB_13305 100.0 Morganella morganii S3 greA transcription elongation factor GreA
F4V73_RS09840 F4V73_RS09840 92.4 Morganella psychrotolerans greA transcription elongation factor GreA
PMI_RS16970 PMI_RS16970 84.8 Proteus mirabilis HI4320 greA transcription elongation factor GreA

Distribution of the homologs in the orthogroup group_1451

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1451

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A9R594 1.72e-97 280 84 0 158 3 greA Transcription elongation factor GreA Yersinia pestis bv. Antiqua (strain Angola)
Q8ZBB3 1.72e-97 280 84 0 158 3 greA Transcription elongation factor GreA Yersinia pestis
P64281 1.65e-95 275 84 0 158 3 greA Transcription elongation factor GreA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P64282 1.65e-95 275 84 0 158 3 greA Transcription elongation factor GreA Salmonella typhi
P0A6W8 2.62e-95 275 84 0 158 3 greA Transcription elongation factor GreA Shigella flexneri
P0A6W5 2.62e-95 275 84 0 158 1 greA Transcription elongation factor GreA Escherichia coli (strain K12)
P0A6W6 2.62e-95 275 84 0 158 3 greA Transcription elongation factor GreA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A6W7 2.62e-95 275 84 0 158 3 greA Transcription elongation factor GreA Escherichia coli O157:H7
P57801 1.03e-89 261 77 0 157 3 greA Transcription elongation factor GreA Pasteurella multocida (strain Pm70)
P43881 4.21e-89 259 79 0 158 3 greA Transcription elongation factor GreA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C4K7K9 3.45e-83 244 72 0 157 3 greA Transcription elongation factor GreA Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q1LSK1 1.79e-82 243 70 0 158 3 greA Transcription elongation factor GreA Baumannia cicadellinicola subsp. Homalodisca coagulata
B8D7R9 7.36e-82 241 69 0 155 3 greA Transcription elongation factor GreA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57464 7.36e-82 241 69 0 155 3 greA Transcription elongation factor GreA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9G7 7.36e-82 241 69 0 155 3 greA Transcription elongation factor GreA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q7VL00 1.42e-81 240 80 0 157 3 greA Transcription elongation factor GreA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1ST36 9.25e-80 236 69 0 158 3 greA Transcription elongation factor GreA Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q8K9G6 1.27e-76 228 63 0 155 3 greA Transcription elongation factor GreA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P59489 8.15e-75 223 63 0 155 3 greA Transcription elongation factor GreA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q493U4 2.97e-74 222 64 0 157 3 greA Transcription elongation factor GreA Blochmanniella pennsylvanica (strain BPEN)
A5IAV2 2.63e-73 219 65 0 158 3 greA Transcription elongation factor GreA Legionella pneumophila (strain Corby)
Q5WTH5 1.6e-72 218 65 0 158 3 greA Transcription elongation factor GreA Legionella pneumophila (strain Lens)
Q5ZS95 1.6e-72 218 65 0 158 3 greA Transcription elongation factor GreA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X1R6 1.6e-72 218 65 0 158 3 greA Transcription elongation factor GreA Legionella pneumophila (strain Paris)
B8GNX7 1.88e-71 214 64 0 158 3 greA Transcription elongation factor GreA Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q0A765 5.26e-70 211 65 0 157 3 greA Transcription elongation factor GreA Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1WXX6 2.63e-69 209 64 0 157 3 greA Transcription elongation factor GreA Halorhodospira halophila (strain DSM 244 / SL1)
Q9HV46 4.38e-67 204 63 0 158 3 greA Transcription elongation factor GreA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q607B0 1.67e-66 202 60 0 158 3 greA Transcription elongation factor GreA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q87LZ2 2.58e-66 202 65 1 158 3 greA Transcription elongation factor GreA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B0TYL2 7.54e-66 201 63 0 155 3 greA Transcription elongation factor GreA Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q8D2W9 3.65e-65 199 54 0 158 3 greA Transcription elongation factor GreA Wigglesworthia glossinidia brevipalpis
Q31H97 4.12e-65 199 58 0 158 3 greA Transcription elongation factor GreA Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q8PLD9 6.81e-65 198 60 0 154 3 greA Transcription elongation factor GreA Xanthomonas axonopodis pv. citri (strain 306)
Q87EB7 1.48e-64 197 60 0 154 3 greA Transcription elongation factor GreA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I844 1.48e-64 197 60 0 154 3 greA Transcription elongation factor GreA Xylella fastidiosa (strain M23)
Q1QCJ2 1.84e-64 197 62 0 157 3 greA Transcription elongation factor GreA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9PEC0 2.37e-64 197 60 0 154 3 greA Transcription elongation factor GreA Xylella fastidiosa (strain 9a5c)
A5WDP3 4.53e-64 196 62 0 157 3 greA Transcription elongation factor GreA Psychrobacter sp. (strain PRwf-1)
Q9L4D3 5.05e-64 196 59 0 154 3 greA Transcription elongation factor GreA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0U568 9.63e-64 195 60 0 154 3 greA Transcription elongation factor GreA Xylella fastidiosa (strain M12)
A4IZ52 1.54e-63 195 62 0 155 3 greA Transcription elongation factor GreA Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NFC6 1.54e-63 195 62 0 155 3 greA Transcription elongation factor GreA Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0BKZ4 1.54e-63 195 62 0 155 3 greA Transcription elongation factor GreA Francisella tularensis subsp. holarctica (strain OSU18)
A0Q5P2 1.54e-63 195 62 0 155 3 greA Transcription elongation factor GreA Francisella tularensis subsp. novicida (strain U112)
B2SDF5 1.54e-63 195 62 0 155 3 greA Transcription elongation factor GreA Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A2C7 1.54e-63 195 62 0 155 3 greA Transcription elongation factor GreA Francisella tularensis subsp. holarctica (strain LVS)
A7NDI1 1.54e-63 195 62 0 155 3 greA Transcription elongation factor GreA Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q14GS9 1.54e-63 195 62 0 155 3 greA Transcription elongation factor GreA Francisella tularensis subsp. tularensis (strain FSC 198)
Q4FTJ2 1.56e-63 194 61 0 157 3 greA Transcription elongation factor GreA Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q3J822 8.41e-63 193 57 0 157 3 greA Transcription elongation factor GreA Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q9KU89 8.89e-63 192 65 1 158 3 greA Transcription elongation factor GreA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1AXD2 9.93e-61 187 57 0 158 3 greA Transcription elongation factor GreA Ruthia magnifica subsp. Calyptogena magnifica
Q8DBW9 1.22e-60 187 63 1 157 3 greA Transcription elongation factor GreA Vibrio vulnificus (strain CMCP6)
B0VSL8 5.42e-60 186 63 0 146 3 greA Transcription elongation factor GreA Acinetobacter baumannii (strain SDF)
Q0AMQ6 8.87e-60 185 57 1 157 3 greA Transcription elongation factor GreA Maricaulis maris (strain MCS10)
Q87WP5 1.31e-59 185 58 0 158 3 greA Transcription elongation factor GreA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B8H1V7 9.52e-59 182 56 1 158 3 greA Transcription elongation factor GreA Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A4I3 9.52e-59 182 56 1 158 3 greA Transcription elongation factor GreA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q88DU7 3.2e-58 181 55 0 158 3 greA Transcription elongation factor GreA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9JTT4 5.24e-58 181 56 0 158 3 greA Transcription elongation factor GreA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JYU3 4.01e-57 178 55 0 158 3 greA Transcription elongation factor GreA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B9KLF5 1.09e-56 177 56 1 158 3 greA Transcription elongation factor GreA Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A3PGS3 1.09e-56 177 56 1 158 3 greA Transcription elongation factor GreA Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q4FPG2 1.46e-56 177 54 0 158 3 greA Transcription elongation factor GreA Pelagibacter ubique (strain HTCC1062)
B0SZ84 1.63e-56 177 54 1 158 3 greA Transcription elongation factor GreA Caulobacter sp. (strain K31)
A4WVE8 1.7e-56 177 56 1 158 3 greA Transcription elongation factor GreA Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A1AZ46 1.98e-56 176 56 1 158 3 greA Transcription elongation factor GreA Paracoccus denitrificans (strain Pd 1222)
Q0C4H1 2.16e-56 176 56 1 157 3 greA Transcription elongation factor GreA Hyphomonas neptunium (strain ATCC 15444)
B4RH54 3.61e-56 176 55 1 158 3 greA Transcription elongation factor GreA Phenylobacterium zucineum (strain HLK1)
Q8XZ82 7.27e-56 175 55 0 158 3 greA Transcription elongation factor GreA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5LXA4 1.44e-55 174 56 1 157 3 greA Transcription elongation factor GreA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A5CVW9 1.49e-55 174 53 0 157 3 greA Transcription elongation factor GreA Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A0LC15 3.12e-55 174 52 1 155 3 greA Transcription elongation factor GreA Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q11GG5 3.79e-55 173 54 1 157 3 greA Transcription elongation factor GreA Chelativorans sp. (strain BNC1)
B3E3H5 1.91e-54 172 52 1 154 3 greA Transcription elongation factor GreA Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B2IHJ7 5.96e-54 170 53 1 157 3 greA Transcription elongation factor GreA Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q98I49 6.1e-54 170 51 1 158 3 greA Transcription elongation factor GreA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A1UTG0 6.37e-54 170 51 1 158 3 greA Transcription elongation factor GreA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q3J5L0 9.83e-54 169 56 1 153 3 greA Transcription elongation factor GreA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A1WH11 1.66e-53 169 53 0 157 3 greA Transcription elongation factor GreA Verminephrobacter eiseniae (strain EF01-2)
A1AS07 2.16e-53 169 50 1 155 3 greA Transcription elongation factor GreA Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B4UCU9 2.75e-53 169 51 1 158 3 greA Transcription elongation factor GreA Anaeromyxobacter sp. (strain K)
P64272 2.79e-53 169 52 1 158 3 greA Transcription elongation factor GreA Brucella suis biovar 1 (strain 1330)
B0CHU1 2.79e-53 169 52 1 158 3 greA Transcription elongation factor GreA Brucella suis (strain ATCC 23445 / NCTC 10510)
P64271 2.79e-53 169 52 1 158 3 greA Transcription elongation factor GreA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0REE0 2.79e-53 169 52 1 158 3 greA Transcription elongation factor GreA Brucella melitensis biotype 2 (strain ATCC 23457)
A9M6H1 2.79e-53 169 52 1 158 3 greA Transcription elongation factor GreA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57C09 2.79e-53 169 52 1 158 3 greA Transcription elongation factor GreA Brucella abortus biovar 1 (strain 9-941)
Q2YRN8 2.79e-53 169 52 1 158 3 greA Transcription elongation factor GreA Brucella abortus (strain 2308)
B2S6W5 2.79e-53 169 52 1 158 3 greA Transcription elongation factor GreA Brucella abortus (strain S19)
Q28V47 3.75e-53 168 53 1 158 3 greA Transcription elongation factor GreA Jannaschia sp. (strain CCS1)
Q8UDE5 4.91e-53 168 52 1 157 3 greA Transcription elongation factor GreA Agrobacterium fabrum (strain C58 / ATCC 33970)
A1VN58 6.11e-53 168 53 0 158 3 greA Transcription elongation factor GreA Polaromonas naphthalenivorans (strain CJ2)
O68546 2.29e-52 166 52 1 157 3 greA Transcription elongation factor GreA Rhizobium leguminosarum bv. viciae
Q1MDR7 2.29e-52 166 52 1 157 3 greA Transcription elongation factor GreA Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q6FZ57 2.65e-52 166 48 1 158 3 greA Transcription elongation factor GreA Bartonella quintana (strain Toulouse)
A6WZH2 2.86e-52 166 50 1 158 3 greA Transcription elongation factor GreA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B5ZXG2 3.08e-52 166 52 1 157 3 greA Transcription elongation factor GreA Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q2K600 5.15e-52 166 52 1 157 3 greA Transcription elongation factor GreA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3PUK3 6.62e-52 165 52 1 155 3 greA Transcription elongation factor GreA Rhizobium etli (strain CIAT 652)
A9IRC3 9.61e-52 165 49 1 158 3 greA Transcription elongation factor GreA Bartonella tribocorum (strain CIP 105476 / IBS 506)
B9JYZ7 1.23e-51 164 51 1 155 3 greA Transcription elongation factor GreA Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A6U8X4 2.48e-51 164 52 1 155 3 greA Transcription elongation factor GreA Sinorhizobium medicae (strain WSM419)
P56894 2.48e-51 164 52 1 155 3 greA Transcription elongation factor GreA Rhizobium meliloti (strain 1021)
B5YJG9 2.68e-51 164 51 1 155 3 greA Transcription elongation factor GreA Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B9J753 3.68e-51 163 50 1 157 3 greA Transcription elongation factor GreA Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q6G2M7 5.34e-51 163 48 1 158 3 greA Transcription elongation factor GreA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q3A452 9.11e-51 162 50 1 157 3 greA Transcription elongation factor GreA Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q92FZ5 1.4e-50 162 54 1 155 3 greA Transcription elongation factor GreA Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B0U8M0 2.07e-50 161 49 1 158 3 greA Transcription elongation factor GreA Methylobacterium sp. (strain 4-46)
B8IBN8 7.18e-50 160 49 1 157 3 greA Transcription elongation factor GreA Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q4UJS8 1.15e-49 159 53 1 155 3 greA Transcription elongation factor GreA Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q2RQB1 1.33e-49 159 50 1 157 3 greA Transcription elongation factor GreA Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q057J4 2.18e-49 159 51 0 158 3 greA Transcription elongation factor GreA Buchnera aphidicola subsp. Cinara cedri (strain Cc)
P27640 2.7e-49 159 53 1 155 3 greA Transcription elongation factor GreA Rickettsia prowazekii (strain Madrid E)
A8F083 5.32e-49 158 52 1 155 3 greA Transcription elongation factor GreA Rickettsia canadensis (strain McKiel)
Q68VQ2 5.68e-49 158 53 1 155 3 greA Transcription elongation factor GreA Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A8HR94 1.76e-48 156 51 2 158 3 greA Transcription elongation factor GreA Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A5FWZ7 3.75e-48 155 50 1 157 3 greA Transcription elongation factor GreA Acidiphilium cryptum (strain JF-5)
Q89DR1 1.75e-47 154 49 1 157 3 greA Transcription elongation factor GreA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B3QJZ1 1.84e-46 151 47 1 157 3 greA Transcription elongation factor GreA Rhodopseudomonas palustris (strain TIE-1)
Q6N2H8 1.84e-46 151 47 1 157 3 greA Transcription elongation factor GreA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1RKI0 2.71e-46 151 49 1 157 3 greA Transcription elongation factor GreA Rickettsia bellii (strain RML369-C)
Q07JJ7 2.97e-46 151 48 1 157 3 greA Transcription elongation factor GreA Rhodopseudomonas palustris (strain BisA53)
A8GUN3 3.02e-46 151 49 1 157 3 greA Transcription elongation factor GreA Rickettsia bellii (strain OSU 85-389)
A5ER96 9.68e-46 149 49 1 157 3 greA Transcription elongation factor GreA Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q1QJF3 1.62e-45 149 48 1 157 3 greA Transcription elongation factor GreA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q3SPT8 2.05e-45 149 48 1 157 3 greA Transcription elongation factor GreA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q7VJT9 1.86e-44 146 48 1 157 3 greA Transcription elongation factor GreA Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q6AL57 3.33e-44 145 46 1 154 3 greA Transcription elongation factor GreA Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q20ZR6 3.62e-44 145 47 1 157 3 greA Transcription elongation factor GreA Rhodopseudomonas palustris (strain BisB18)
A5CE64 7.34e-44 145 46 1 158 3 greA Transcription elongation factor GreA Orientia tsutsugamushi (strain Boryong)
B9KDP9 2.32e-43 144 44 1 157 3 greA Transcription elongation factor GreA Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
P64275 2.43e-43 144 45 1 157 3 greA Transcription elongation factor GreA Helicobacter pylori (strain ATCC 700392 / 26695)
P64276 2.43e-43 144 45 1 157 3 greA Transcription elongation factor GreA Helicobacter pylori (strain J99 / ATCC 700824)
B2USW4 2.62e-43 144 45 1 157 3 greA Transcription elongation factor GreA Helicobacter pylori (strain Shi470)
Q17WJ3 3.52e-43 143 45 1 157 3 greA Transcription elongation factor GreA Helicobacter acinonychis (strain Sheeba)
B3CTQ6 3.94e-43 143 46 1 158 3 greA Transcription elongation factor GreA Orientia tsutsugamushi (strain Ikeda)
Q1CT06 4.78e-43 143 45 1 157 3 greA Transcription elongation factor GreA Helicobacter pylori (strain HPAG1)
B5Z7M6 4.78e-43 143 45 1 157 3 greA Transcription elongation factor GreA Helicobacter pylori (strain G27)
B6JM90 4.78e-43 143 45 1 157 3 greA Transcription elongation factor GreA Helicobacter pylori (strain P12)
A7I2X0 4.8e-43 143 47 1 157 3 greA Transcription elongation factor GreA Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q2GD99 7.41e-43 142 45 1 157 3 greA Transcription elongation factor GreA Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
A1V9Q2 1.26e-42 142 44 2 158 3 greA Transcription elongation factor GreA Nitratidesulfovibrio vulgaris (strain DP4)
Q725M4 1.26e-42 142 44 2 158 3 greA Transcription elongation factor GreA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B8DJL8 3.75e-42 140 45 2 157 3 greA Transcription elongation factor GreA Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A5V3E1 8.17e-42 139 50 4 160 3 greA Transcription elongation factor GreA Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B9L822 9.31e-42 139 47 1 157 3 greA Transcription elongation factor GreA Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
C6BRV2 1e-41 139 44 2 157 3 greA Transcription elongation factor GreA Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q2LR03 1.19e-41 139 45 1 155 3 greA Transcription elongation factor GreA Syntrophus aciditrophicus (strain SB)
Q1GUG9 2.99e-41 138 47 3 158 3 greA Transcription elongation factor GreA Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
B8IZM4 3.76e-41 138 47 2 157 3 greA Transcription elongation factor GreA Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A7H585 4.51e-40 135 42 1 157 3 greA Transcription elongation factor GreA Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A6Q4L2 6.22e-40 135 44 2 153 3 greA Transcription elongation factor GreA Nitratiruptor sp. (strain SB155-2)
A1VY10 9.36e-40 134 41 1 157 3 greA Transcription elongation factor GreA Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q2G656 1.7e-39 134 44 4 160 3 greA Transcription elongation factor GreA Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q5HWI0 4.64e-39 132 40 1 157 3 greA Transcription elongation factor GreA Campylobacter jejuni (strain RM1221)
Q9PIK9 4.64e-39 132 40 1 157 3 greA Transcription elongation factor GreA Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FK75 4.64e-39 132 40 1 157 3 greA Transcription elongation factor GreA Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
O50237 5.83e-39 132 46 3 156 3 greA Transcription elongation factor GreA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A0LK20 1.6e-38 131 43 1 155 3 greA Transcription elongation factor GreA Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q7M9N2 1.62e-38 131 45 1 157 3 greA Transcription elongation factor GreA Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A8ESG0 3.15e-38 130 42 1 157 3 greA Transcription elongation factor GreA Aliarcobacter butzleri (strain RM4018)
Q7UVA0 3.9e-38 130 38 1 157 3 greA Transcription elongation factor GreA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q9KDD7 1.14e-36 126 42 1 154 3 greA Transcription elongation factor GreA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A0M5U7 6.58e-36 124 42 1 149 3 greA Transcription elongation factor GreA Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A2RIW3 1.52e-35 124 42 1 155 3 greA Transcription elongation factor GreA Lactococcus lactis subsp. cremoris (strain MG1363)
A6Q9U9 1.55e-35 124 45 1 157 3 greA Transcription elongation factor GreA Sulfurovum sp. (strain NBC37-1)
A4IR71 2.11e-35 123 44 1 154 3 greA Transcription elongation factor GreA Geobacillus thermodenitrificans (strain NG80-2)
Q65GT4 2.3e-35 123 42 1 154 3 greA Transcription elongation factor GreA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A7GT58 3.79e-35 122 44 1 154 3 greA Transcription elongation factor GreA Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q5KWV4 3.83e-35 122 43 1 154 3 greA Transcription elongation factor GreA Geobacillus kaustophilus (strain HTA426)
Q030Z7 8.72e-35 122 41 1 155 3 greA Transcription elongation factor GreA Lactococcus lactis subsp. cremoris (strain SK11)
P80240 8.78e-35 122 40 1 154 1 greA Transcription elongation factor GreA Bacillus subtilis (strain 168)
A6H247 9.97e-35 121 42 1 149 3 greA Transcription elongation factor GreA Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q03MH4 1.08e-34 121 43 1 155 3 greA Transcription elongation factor GreA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q8KCH5 1.27e-34 121 44 2 154 3 greA Transcription elongation factor GreA Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q5M638 1.28e-34 121 43 1 155 3 greA Transcription elongation factor GreA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1J6 1.28e-34 121 43 1 155 3 greA Transcription elongation factor GreA Streptococcus thermophilus (strain CNRZ 1066)
Q6HDE6 1.31e-34 121 42 2 159 3 greA Transcription elongation factor GreA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634G5 1.31e-34 121 42 2 159 3 greA Transcription elongation factor GreA Bacillus cereus (strain ZK / E33L)
Q81LK9 1.31e-34 121 42 2 159 3 greA Transcription elongation factor GreA Bacillus anthracis
C3L5Y5 1.31e-34 121 42 2 159 3 greA Transcription elongation factor GreA Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P968 1.31e-34 121 42 2 159 3 greA Transcription elongation factor GreA Bacillus anthracis (strain A0248)
A0AIU5 1.63e-34 121 43 1 151 3 greA Transcription elongation factor GreA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B9IYE4 1.93e-34 121 42 2 159 3 greA Transcription elongation factor GreA Bacillus cereus (strain Q1)
B7HQD7 1.93e-34 121 42 2 159 3 greA Transcription elongation factor GreA Bacillus cereus (strain AH187)
Q730F5 1.93e-34 121 42 2 159 3 greA Transcription elongation factor GreA Bacillus cereus (strain ATCC 10987 / NRS 248)
P64277 1.98e-34 121 43 1 151 3 greA Transcription elongation factor GreA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DE15 1.98e-34 121 43 1 151 3 greA Transcription elongation factor GreA Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZH4 1.98e-34 121 43 1 151 3 greA Transcription elongation factor GreA Listeria monocytogenes serotype 4b (strain F2365)
C1KVE3 1.98e-34 121 43 1 151 3 greA Transcription elongation factor GreA Listeria monocytogenes serotype 4b (strain CLIP80459)
P64278 1.98e-34 121 43 1 151 3 greA Transcription elongation factor GreA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q817Z6 3.05e-34 120 42 1 155 3 greA Transcription elongation factor GreA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A5FJJ8 5.49e-34 120 40 1 149 3 greA Transcription elongation factor GreA Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q03YY4 1.58e-33 119 42 2 155 3 greA Transcription elongation factor GreA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B3EPH3 1.72e-33 118 41 2 155 3 greA Transcription elongation factor GreA Chlorobium phaeobacteroides (strain BS1)
B0K5B9 1.72e-33 118 40 1 154 3 greA Transcription elongation factor GreA Thermoanaerobacter sp. (strain X514)
B0KCE3 1.72e-33 118 40 1 154 3 greA Transcription elongation factor GreA Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B9K7Y7 2.2e-33 118 41 1 155 3 greA Transcription elongation factor GreA Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A7Z726 3.9e-33 117 40 1 154 3 greA Transcription elongation factor GreA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q5WHM1 4.47e-33 117 41 1 154 3 greA Transcription elongation factor GreA Shouchella clausii (strain KSM-K16)
B3EE12 8.08e-33 117 41 2 154 3 greA Transcription elongation factor GreA Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B1LAX5 9.23e-33 116 43 1 155 3 greA Transcription elongation factor GreA Thermotoga sp. (strain RQ2)
B3QPT8 1.19e-32 116 40 2 154 3 greA Transcription elongation factor GreA Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q8EPT6 1.44e-32 116 40 1 155 3 greA Transcription elongation factor GreA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B4SBF9 2.27e-32 115 42 2 154 3 greA Transcription elongation factor GreA Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q9X232 3.08e-32 115 41 1 155 3 greA Transcription elongation factor GreA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8R7N0 5.22e-32 114 39 1 154 3 greA Transcription elongation factor GreA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q0SQ85 5.85e-32 114 42 1 150 3 greA Transcription elongation factor GreA Clostridium perfringens (strain SM101 / Type A)
Q8XHL7 5.85e-32 114 42 1 150 3 greA Transcription elongation factor GreA Clostridium perfringens (strain 13 / Type A)
Q0TMI6 5.85e-32 114 42 1 150 3 greA Transcription elongation factor GreA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B2GD90 5.92e-32 114 39 1 154 3 greA Transcription elongation factor GreA Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A5ILE7 8.18e-32 114 41 1 155 3 greA Transcription elongation factor GreA Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q8DY80 1.35e-31 114 45 1 155 3 greA Transcription elongation factor GreA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E3U5 1.35e-31 114 45 1 155 3 greA Transcription elongation factor GreA Streptococcus agalactiae serotype III (strain NEM316)
Q3JZS3 1.35e-31 114 45 1 155 3 greA Transcription elongation factor GreA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B4S9B2 2.51e-31 113 40 2 155 3 greA Transcription elongation factor GreA Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B9E6Y8 4.45e-31 112 44 1 145 3 greA Transcription elongation factor GreA Macrococcus caseolyticus (strain JCSC5402)
A4SFN0 4.68e-31 112 42 3 152 3 greA Transcription elongation factor GreA Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q8DSP7 4.76e-31 112 43 1 155 3 greA Transcription elongation factor GreA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
C1FNC6 4.81e-31 112 41 1 154 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Kyoto / Type A2)
B3QV56 1.29e-30 111 39 1 151 3 greA Transcription elongation factor GreA Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q3ATA7 1.32e-30 111 41 2 154 3 greA Transcription elongation factor GreA Chlorobium chlorochromatii (strain CaD3)
B1KTC2 1.57e-30 111 40 1 154 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Loch Maree / Type A3)
A7GJB4 1.57e-30 111 40 1 154 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IGJ3 1.57e-30 111 40 1 154 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Okra / Type B1)
C3KVU0 1.57e-30 111 40 1 154 3 greA Transcription elongation factor GreA Clostridium botulinum (strain 657 / Type Ba4)
Q9CHT2 1.84e-30 110 43 1 155 3 greA Transcription elongation factor GreA Lactococcus lactis subsp. lactis (strain IL1403)
A5I7P5 1.86e-30 110 40 1 154 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZA6 1.86e-30 110 40 1 154 3 greA Transcription elongation factor GreA Clostridium botulinum (strain ATCC 19397 / Type A)
C4XLU8 2.06e-30 110 41 2 157 3 greA Transcription elongation factor GreA Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A5N4L0 3.4e-30 110 40 1 155 3 greA Transcription elongation factor GreA Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DY72 3.4e-30 110 40 1 155 3 greA Transcription elongation factor GreA Clostridium kluyveri (strain NBRC 12016)
B9L0L0 3.76e-30 110 40 1 155 3 greA Transcription elongation factor GreA Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A1BHJ3 5.42e-30 109 39 2 154 3 greA Transcription elongation factor GreA Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B3ESB4 7.1e-30 109 37 1 151 3 greA Transcription elongation factor GreA Amoebophilus asiaticus (strain 5a2)
Q88WQ9 8.14e-30 109 40 1 155 3 greA2 Transcription elongation factor GreA 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P64284 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain MW2)
A8Z4E8 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8V9 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain MSSA476)
Q6GG93 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain MRSA252)
P99156 9.26e-30 109 44 2 156 1 greA Transcription elongation factor GreA Staphylococcus aureus (strain N315)
P64283 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHF1 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain Newman)
Q5HFF2 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain COL)
Q2YT68 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5ITD5 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain JH9)
Q2FXW7 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGB6 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain USA300)
A6U279 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain JH1)
A7X319 9.26e-30 109 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6MTU9 1.3e-29 108 42 0 141 3 greA Transcription elongation factor GreA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q97EB6 2.99e-29 107 40 1 155 3 greA Transcription elongation factor GreA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A4VX43 3.75e-29 107 42 1 155 3 greA Transcription elongation factor GreA Streptococcus suis (strain 05ZYH33)
A4W3E8 3.75e-29 107 42 1 155 3 greA Transcription elongation factor GreA Streptococcus suis (strain 98HAH33)
P0DB47 4.97e-29 107 44 1 155 3 greA Transcription elongation factor GreA Streptococcus pyogenes serotype M3 (strain SSI-1)
A2RGA4 4.97e-29 107 44 1 155 3 greA Transcription elongation factor GreA Streptococcus pyogenes serotype M5 (strain Manfredo)
P64287 4.97e-29 107 44 1 155 3 greA Transcription elongation factor GreA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDQ7 4.97e-29 107 44 1 155 1 greA Transcription elongation factor GreA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DB46 4.97e-29 107 44 1 155 3 greA Transcription elongation factor GreA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P64285 4.97e-29 107 44 1 155 3 greA Transcription elongation factor GreA Streptococcus pyogenes serotype M1
A0PXN3 8.22e-29 106 39 1 154 3 greA Transcription elongation factor GreA Clostridium novyi (strain NT)
B2UXU9 8.35e-29 106 38 1 155 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Alaska E43 / Type E3)
B1MX52 1.08e-28 106 39 2 156 3 greA Transcription elongation factor GreA Leuconostoc citreum (strain KM20)
Q9HZY5 1.17e-28 106 38 2 152 3 greB Transcription elongation factor GreB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2SSM5 1.32e-28 106 41 0 141 3 greA Transcription elongation factor GreA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
A8FFL6 1.43e-28 106 42 1 154 3 greA Transcription elongation factor GreA Bacillus pumilus (strain SAFR-032)
Q4L6V7 1.6e-28 105 44 2 156 3 greA Transcription elongation factor GreA Staphylococcus haemolyticus (strain JCSC1435)
Q49Y48 3.64e-28 105 43 2 156 3 greA Transcription elongation factor GreA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B9DNJ3 8.29e-28 104 42 2 156 3 greA Transcription elongation factor GreA Staphylococcus carnosus (strain TM300)
A6LPL4 9.23e-28 103 39 1 154 3 greA Transcription elongation factor GreA Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q04EK0 1.01e-27 103 36 2 155 3 greA Transcription elongation factor GreA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
B7ID86 2.82e-27 102 40 1 153 3 greA Transcription elongation factor GreA Thermosipho africanus (strain TCF52B)
A6LMS3 3.28e-27 102 40 1 153 3 greA Transcription elongation factor GreA Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B0S216 4.09e-27 102 40 1 155 3 greA Transcription elongation factor GreA Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q8CSB3 4.29e-27 102 42 2 156 3 greA Transcription elongation factor GreA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNU0 4.29e-27 102 42 2 156 3 greA Transcription elongation factor GreA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8ZJH2 6.59e-27 102 36 2 152 3 greB Transcription elongation factor GreB Yersinia pestis
Q98Q16 1e-26 101 42 1 142 3 greA Transcription elongation factor GreA Mycoplasmopsis pulmonis (strain UAB CTIP)
B9DTR1 1.22e-26 101 42 1 155 3 greA Transcription elongation factor GreA Streptococcus uberis (strain ATCC BAA-854 / 0140J)
C1CSD7 1.38e-26 101 39 1 155 3 greA Transcription elongation factor GreA Streptococcus pneumoniae (strain Taiwan19F-14)
C1CLL5 1.38e-26 101 39 1 155 3 greA Transcription elongation factor GreA Streptococcus pneumoniae (strain P1031)
C1CFA2 1.38e-26 101 39 1 155 3 greA Transcription elongation factor GreA Streptococcus pneumoniae (strain JJA)
Q8DP42 1.38e-26 101 39 1 155 3 greA Transcription elongation factor GreA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B8ZLB8 1.38e-26 101 39 1 155 3 greA Transcription elongation factor GreA Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1C8A8 1.38e-26 101 39 1 155 3 greA Transcription elongation factor GreA Streptococcus pneumoniae (strain 70585)
B5E681 1.38e-26 101 39 1 155 3 greA Transcription elongation factor GreA Streptococcus pneumoniae serotype 19F (strain G54)
Q04HS9 1.38e-26 101 39 1 155 3 greA Transcription elongation factor GreA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B1ICT9 2.78e-26 100 39 1 155 3 greA Transcription elongation factor GreA Streptococcus pneumoniae (strain Hungary19A-6)
P78019 3.57e-26 100 39 1 142 3 greA Transcription elongation factor GreA Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P57802 3.57e-26 100 38 2 143 3 greB Transcription elongation factor GreB Pasteurella multocida (strain Pm70)
A3DJG6 3.91e-26 99 35 1 154 3 greA Transcription elongation factor GreA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q97PT2 4.15e-26 99 39 1 155 3 greA Transcription elongation factor GreA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A3CPS3 8.55e-26 99 38 1 155 3 greA Transcription elongation factor GreA Streptococcus sanguinis (strain SK36)
A8AVM5 1.22e-25 98 38 1 155 3 greA Transcription elongation factor GreA Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q7VM42 1.55e-25 98 37 2 152 3 greB Transcription elongation factor GreB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6F215 6.12e-25 96 38 2 156 3 greA Transcription elongation factor GreA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
A8MLU4 2.42e-24 95 37 1 154 3 greA Transcription elongation factor GreA Alkaliphilus oremlandii (strain OhILAs)
B9LBX1 4.72e-24 94 36 1 154 3 greA Transcription elongation factor GreA Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WK05 4.72e-24 94 36 1 154 3 greA Transcription elongation factor GreA Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
P30128 5.82e-24 94 33 3 160 1 greB Transcription elongation factor GreB Escherichia coli (strain K12)
A9NGN4 8.68e-24 94 39 1 138 3 greA Transcription elongation factor GreA Acholeplasma laidlawii (strain PG-8A)
P43882 9.06e-24 94 36 2 152 3 greB Transcription elongation factor GreB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B2TI25 9.53e-24 94 41 1 134 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Eklund 17B / Type B)
A9KIP3 1.05e-23 93 37 1 151 3 greA Transcription elongation factor GreA Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
P64273 1.31e-23 93 33 3 160 3 greB Transcription elongation factor GreB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P64274 1.31e-23 93 33 3 160 3 greB Transcription elongation factor GreB Escherichia coli O157:H7
P47524 1.85e-23 93 39 2 143 3 greA Transcription elongation factor GreA Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8ZLJ2 2.09e-23 92 32 2 158 3 greB Transcription elongation factor GreB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B8G358 2.16e-23 92 36 1 150 3 greA Transcription elongation factor GreA Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q181F4 2.35e-23 92 37 1 154 3 greA Transcription elongation factor GreA Clostridioides difficile (strain 630)
Q8Z217 2.8e-23 92 32 2 158 3 greB Transcription elongation factor GreB Salmonella typhi
Q8P7P8 2.98e-23 92 36 1 152 3 greB Transcription elongation factor GreB Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PJ11 3.01e-23 92 35 1 152 3 greB Transcription elongation factor GreB Xanthomonas axonopodis pv. citri (strain 306)
A9BFC0 6.39e-23 91 36 0 141 3 greA Transcription elongation factor GreA Petrotoga mobilis (strain DSM 10674 / SJ95)
A7NFC5 7.7e-23 91 37 1 151 3 greA Transcription elongation factor GreA Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q0B0N4 2.23e-22 90 30 1 155 3 greA Transcription elongation factor GreA Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q883T5 6.35e-22 89 34 2 152 3 greB Transcription elongation factor GreB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3Z8E7 7.67e-22 89 34 2 155 3 greA Transcription elongation factor GreA Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
A5UPG5 9.65e-22 88 36 1 151 3 greA Transcription elongation factor GreA Roseiflexus sp. (strain RS-1)
B3PM73 3.53e-21 87 34 0 143 3 greA Transcription elongation factor GreA Metamycoplasma arthritidis (strain 158L3-1)
Q7MPX6 5.61e-21 86 34 4 159 3 greB Transcription elongation factor GreB Vibrio vulnificus (strain YJ016)
Q8DDU7 5.74e-21 86 34 4 159 3 greB Transcription elongation factor GreB Vibrio vulnificus (strain CMCP6)
Q7NBS1 1.03e-20 85 38 2 142 3 greA Transcription elongation factor GreA Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q88KH5 1.52e-20 85 33 3 154 3 greB Transcription elongation factor GreB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q87TB8 3.22e-20 84 32 4 159 3 greB Transcription elongation factor GreB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9JVD0 4.63e-20 84 35 1 153 3 greB Transcription elongation factor GreB Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q4A921 4.8e-20 84 40 2 132 3 greA Transcription elongation factor GreA Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q4A759 5.23e-20 84 40 2 132 3 greA Transcription elongation factor GreA Mesomycoplasma hyopneumoniae (strain 7448)
Q5ZZL8 5.95e-20 84 40 2 132 3 greA Transcription elongation factor GreA Mesomycoplasma hyopneumoniae (strain 232)
Q9KNL7 6.49e-20 84 32 4 159 3 greB Transcription elongation factor GreB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9K0C5 1.08e-19 83 35 1 153 3 greB Transcription elongation factor GreB Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A5IYH4 1.92e-18 80 40 2 120 3 greA Transcription elongation factor GreA Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
Q88ZS9 2.93e-18 79 33 2 151 3 greA1 Transcription elongation factor GreA 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9ADK2 5.25e-18 79 34 2 143 3 greA Transcription elongation factor GreA Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q82I57 1.19e-17 78 34 2 144 3 greA Transcription elongation factor GreA Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
O51157 1.46e-17 82 33 1 145 3 greA Transcription elongation factor GreA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P9WMT9 6.21e-17 76 37 4 144 1 greA Transcription elongation factor GreA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMT8 6.21e-17 76 37 4 144 3 greA Transcription elongation factor GreA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U1C6 6.21e-17 76 37 4 144 3 greA Transcription elongation factor GreA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AM72 6.21e-17 76 37 4 144 3 greA Transcription elongation factor GreA Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KHL8 6.21e-17 76 37 4 144 3 greA Transcription elongation factor GreA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P64280 6.21e-17 76 37 4 144 3 greA Transcription elongation factor GreA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B2S1W7 6.33e-17 76 30 1 150 3 greA Transcription elongation factor GreA Treponema pallidum subsp. pallidum (strain SS14)
O83063 6.33e-17 76 30 1 150 3 greA Transcription elongation factor GreA Treponema pallidum (strain Nichols)
C1A2Y4 3.48e-16 74 36 4 144 3 greA Transcription elongation factor GreA Rhodococcus erythropolis (strain PR4 / NBRC 100887)
A1TE43 5.05e-16 73 36 3 144 3 greA Transcription elongation factor GreA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q9PQI7 1.27e-15 72 31 2 132 3 greA Transcription elongation factor GreA Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIU2 1.27e-15 72 31 2 132 3 greA Transcription elongation factor GreA Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
A0R2X1 1.27e-15 72 35 4 146 1 greA Transcription elongation factor GreA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B1MKJ7 2.33e-15 72 35 5 155 3 greA Transcription elongation factor GreA Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A4F866 7.09e-15 70 35 4 153 3 greA Transcription elongation factor GreA Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
B5ZBB2 2.05e-14 69 32 3 134 3 greA Transcription elongation factor GreA Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
P46808 1.02e-13 67 34 5 155 3 greA Transcription elongation factor GreA Mycobacterium leprae (strain TN)
B8ZT53 1.02e-13 67 34 5 155 3 greA Transcription elongation factor GreA Mycobacterium leprae (strain Br4923)
Q8VQD7 4.7e-10 58 26 4 157 1 gfh1 Transcription inhibitor protein Gfh1 Thermus aquaticus
Q9Z7G4 1e-08 56 28 2 130 3 greA Transcription elongation factor GreA Chlamydia pneumoniae
Q72JT8 2.31e-08 53 24 4 157 1 gfh1 Transcription inhibitor protein Gfh1 Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SJG6 3.18e-08 53 24 4 157 1 gfh1 Transcription inhibitor protein Gfh1 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q9PLU1 8.57e-07 50 29 2 111 3 greA Transcription elongation factor GreA Chlamydia muridarum (strain MoPn / Nigg)
O84641 3.24e-05 46 24 2 130 3 greA Transcription elongation factor GreA Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_11725
Feature type CDS
Gene greA
Product transcription elongation factor GreA
Location 57988 - 58464 (strand: -1)
Length 477 (nucleotides) / 158 (amino acids)
In genomic island -

Contig

Accession ZDB_689
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1451
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01272 Transcription elongation factor, GreA/GreB, C-term
PF03449 Transcription elongation factor, N-terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0782 Transcription (K) K Transcription elongation factor, GreA/GreB family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03624 transcription elongation factor GreA - -

Protein Sequence

MKQIPMTVRGADQLREELEFLKNERRPKIIADIAEAREHGDLKENAEYHAAREQQGFCEGRIQEIEAKLSNAQVIDVTKMTNNGRIIFGATVTVFNVATDEEQTYRIVGDDEADIKSNLLSVNSPIARGLIGKEVDDVVVIQTPGGEVEYEVINVEYL

Flanking regions ( +/- flanking 50bp)

TTTAATCAGGATGATATGACTATTACTTAGGAATGATTCAGAGGTAGAGAATGAAACAAATCCCTATGACGGTACGCGGCGCAGACCAACTGCGTGAAGAATTAGAATTTCTCAAAAATGAGCGCCGTCCGAAAATTATCGCTGATATCGCGGAAGCCCGCGAGCACGGCGATCTGAAAGAAAACGCAGAATATCACGCCGCCCGTGAGCAGCAGGGTTTCTGTGAAGGCCGTATTCAGGAGATCGAAGCCAAGCTCTCCAATGCGCAGGTGATTGATGTCACCAAAATGACCAACAATGGCCGGATTATTTTCGGTGCGACTGTTACCGTTTTTAACGTCGCAACGGATGAAGAGCAGACTTACCGCATCGTGGGTGATGATGAGGCTGATATCAAATCAAACCTGCTGTCAGTGAACTCTCCGATTGCCCGCGGCCTTATCGGTAAAGAGGTTGACGACGTGGTTGTCATCCAGACACCGGGCGGTGAAGTTGAGTATGAAGTCATCAATGTGGAATACCTGTAAGCTGCGTCGTAAAAAAACAGCACAATACGGATATTTCATCAGAAAAATGC