Homologs in group_2706

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05160 FBDBKF_05160 100.0 Morganella morganii S1 pabA Anthranilate/para-aminobenzoate synthase component II (glutamine amidotransferase)
EHELCC_12430 EHELCC_12430 100.0 Morganella morganii S2 pabA Anthranilate/para-aminobenzoate synthase component II (glutamine amidotransferase)
NLDBIP_12770 NLDBIP_12770 100.0 Morganella morganii S4 pabA Anthranilate/para-aminobenzoate synthase component II (glutamine amidotransferase)
LHKJJB_12630 LHKJJB_12630 100.0 Morganella morganii S3 pabA Anthranilate/para-aminobenzoate synthase component II (glutamine amidotransferase)
F4V73_RS05615 F4V73_RS05615 87.0 Morganella psychrotolerans - aminodeoxychorismate/anthranilate synthase component II

Distribution of the homologs in the orthogroup group_2706

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2706

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P00906 2.92e-95 278 65 0 191 4 trpG-TRPD Anthranilate synthase component II (Fragment) Shigella dysenteriae
P00900 1.38e-92 271 66 0 192 1 trpG Anthranilate synthase component 2 Serratia marcescens
P00904 1.89e-92 282 67 0 191 1 trpGD Bifunctional protein TrpGD Escherichia coli (strain K12)
P00905 4.3e-92 281 66 0 191 1 trpGD Bifunctional protein TrpGD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZEG6 5.86e-89 261 63 0 192 3 trpG Anthranilate synthase component 2 Yersinia pestis
P22101 6.45e-87 256 57 0 190 3 trpG Anthranilate synthase component 2 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KST3 4.61e-84 249 58 0 190 3 trpG Anthranilate synthase component 2 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q89A30 2.76e-81 242 54 0 191 3 trpG Anthranilate synthase component 2 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P42388 1.06e-76 231 52 0 191 3 trpG Anthranilate synthase component 2 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q44696 1.74e-74 225 51 0 190 3 trpG Anthranilate synthase component 2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P71381 1.07e-70 215 50 0 189 3 trpG Anthranilate synthase component 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P09786 8.36e-52 167 48 2 190 1 phnB Anthranilate synthase component 2, pyocyanine specific Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P09575 1.48e-50 169 41 4 189 4 None Multifunctional tryptophan biosynthesis protein (Fragment) Pichia angusta
O25868 1.57e-50 164 38 1 190 3 trpG Anthranilate synthase component 2 Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZJU6 9.44e-50 162 38 1 187 3 trpG Anthranilate synthase component 2 Helicobacter pylori (strain J99 / ATCC 700824)
P00903 4.91e-49 160 44 3 187 1 pabA Aminodeoxychorismate synthase component 2 Escherichia coli (strain K12)
P20576 1.75e-48 159 44 3 192 1 trpG Anthranilate synthase component 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P20409 5.11e-48 169 45 6 190 3 trp1 Multifunctional tryptophan biosynthesis protein Phycomyces blakesleeanus
P28819 3.11e-47 156 40 3 187 2 pabA Aminodeoxychorismate/anthranilate synthase component 2 Bacillus subtilis (strain 168)
Q1XDC5 3.63e-47 155 39 4 191 4 trpG Anthranilate synthase component 2 Neopyropia yezoensis
P06193 4.68e-47 155 42 3 187 3 pabA Aminodeoxychorismate synthase component 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P51362 5.15e-46 152 42 4 188 4 trpG Anthranilate synthase component 2 Porphyra purpurea
P00901 1.08e-45 152 40 3 192 1 trpG Anthranilate synthase component 2 Pseudomonas putida
P05379 2.43e-45 151 42 2 188 3 trpG Anthranilate synthase component 2 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P24773 3.02e-45 162 41 4 196 3 trpC Multifunctional tryptophan biosynthesis protein Penicillium chrysogenum
Q57690 5.03e-45 150 39 5 195 3 trpG Anthranilate synthase component 2 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P06195 7.49e-44 147 42 3 191 3 pabA Aminodeoxychorismate synthase component 2 Serratia marcescens
Q08654 7.85e-44 156 40 7 194 3 trpGD Bifunctional protein TrpGD Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P00902 1.45e-43 146 40 4 192 3 trpG Anthranilate synthase component 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P06194 1.7e-43 146 41 3 187 3 pabA Aminodeoxychorismate synthase component 2 Klebsiella aerogenes
P00937 2.58e-42 150 40 5 189 1 TRP3 Multifunctional tryptophan biosynthesis protein Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P48261 2.62e-42 143 38 4 188 3 trpG Anthranilate synthase component 2 Cyanophora paradoxa
P06558 3.99e-42 143 40 7 205 3 trpG Anthranilate synthase component 2 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q02003 1.4e-41 142 42 6 189 3 trpG Anthranilate synthase component 2 Lactococcus lactis subsp. lactis (strain IL1403)
Q92370 1.6e-41 151 39 5 190 2 trp1 Multifunctional tryptophan biosynthesis protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5V632 3.5e-41 140 40 5 187 3 trpG2 Anthranilate synthase component II Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P00908 9.33e-41 149 38 7 205 3 trp-1 Multifunctional tryptophan biosynthesis protein Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7XUS2 1.57e-40 142 39 9 198 1 ASB1 Anthranilate synthase beta subunit 1, chloroplastic Oryza sativa subsp. japonica
P06531 1.62e-40 149 40 4 196 2 trpC Multifunctional tryptophan biosynthesis protein Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P05328 1.83e-40 148 39 4 196 3 trpC Multifunctional tryptophan biosynthesis protein Aspergillus niger
Q9FJM5 1.97e-40 141 40 6 197 2 ASB2 Anthranilate synthase beta subunit 2, chloroplastic Arabidopsis thaliana
O27693 3.4e-40 138 40 8 199 3 trpG Anthranilate synthase component 2 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P26923 4.32e-40 138 40 7 195 3 trpG Anthranilate synthase component 2 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q42565 1.99e-39 138 41 9 198 1 ASB1 Anthranilate synthase beta subunit 1, chloroplastic Arabidopsis thaliana
Q764B9 2.12e-39 138 38 7 193 1 ASB2 Anthranilate synthase beta subunit 2, chloroplastic Oryza sativa subsp. japonica
P18483 2.63e-39 145 38 5 196 3 trpC Multifunctional tryptophan biosynthesis protein Aspergillus awamori
P32483 3.17e-39 145 44 6 189 3 pabAB Aminodeoxychorismate synthase Streptomyces griseus
Q5V214 1.96e-38 134 38 4 193 3 trpG1 Anthranilate synthase component II Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P33974 2.1e-38 134 38 4 198 3 trpG Anthranilate synthase component 2 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P25170 3.39e-38 142 37 4 186 3 TRPC Multifunctional tryptophan biosynthesis protein Phanerodontia chrysosporium
Q06129 3.06e-37 130 38 4 191 1 trpG Anthranilate synthase component 2 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9HPG6 5.72e-37 130 38 4 200 3 trpG Anthranilate synthase component 2 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q9YGB2 1.2e-36 129 40 6 178 3 trpG Anthranilate synthase component 2 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
O28670 2.39e-36 127 41 6 183 3 trpG Anthranilate synthase component 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P9WN35 4.41e-36 129 40 7 198 1 trpG Anthranilate synthase component 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN34 4.41e-36 129 40 7 198 3 trpG Anthranilate synthase component 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P26922 7.4e-36 127 37 4 188 1 trpG Anthranilate synthase component 2 Azospirillum brasilense
P27627 1.04e-35 126 38 7 197 3 None Aminodeoxychorismate synthase component 2 Streptomyces lividans
P0CN87 2.35e-35 134 36 4 191 3 TRP1 Multifunctional tryptophan biosynthesis protein Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CN86 2.54e-35 134 36 4 191 3 TRP1 Multifunctional tryptophan biosynthesis protein Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P27710 2.72e-35 134 36 4 191 3 TRP1 Multifunctional tryptophan biosynthesis protein Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P20441 5.49e-35 125 37 6 201 3 trpG Anthranilate synthase component 2 Leptospira biflexa
O19914 8.51e-34 122 33 3 195 4 trpG Anthranilate synthase component 2 Cyanidium caldarium
F2RB79 1.33e-33 129 39 5 186 1 cmlB Aminodeoxychorismate synthase Streptomyces venezuelae (strain ATCC 10712 / CBS 650.69 / DSM 40230 / JCM 4526 / NBRC 13096 / PD 04745)
P50872 7.27e-33 127 40 3 184 4 trpE(G) Anthranilate synthase Azospirillum brasilense
P15395 9.41e-33 126 38 7 193 4 trpE(G) Anthranilate synthase Rhizobium meliloti (strain 1021)
P72539 1.57e-30 120 39 5 186 3 papA Aminodeoxychorismate synthase Streptomyces pristinaespiralis
Q92411 3.74e-28 113 34 6 206 3 TRP1 Multifunctional tryptophan biosynthesis protein Cochliobolus heterostrophus
P44339 6.72e-24 96 31 8 198 4 HI_1171 Putative anthranilate synthase component II Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8TXV8 1.21e-21 90 31 5 188 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8U0R9 3.87e-21 89 29 2 183 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8LPN3 1.03e-20 92 30 8 245 1 ADCS Aminodeoxychorismate synthase, chloroplastic Arabidopsis thaliana
Q6TAS3 5.75e-20 90 32 9 237 1 ADCS Aminodeoxychorismate synthase, chloroplastic Solanum lycopersicum
Q5Z856 1.51e-19 89 28 8 249 2 ADCS Probable aminodeoxychorismate synthase, chloroplastic Oryza sativa subsp. japonica
Q5JFM4 2.79e-19 84 28 2 183 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
O59071 4.5e-19 83 28 2 183 1 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A6UQ90 5.86e-19 83 31 5 189 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
E4QHI6 9.88e-19 86 29 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Borreliella burgdorferi (strain N40)
A4FW79 1.07e-18 82 28 3 183 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
O94277 1.16e-18 86 31 8 195 3 SPBP8B7.29 Putative aminodeoxychorismate synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A5UK20 1.16e-18 82 32 5 158 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q2NER5 1.38e-18 82 25 3 183 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
A6VH31 2.26e-18 81 29 5 189 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q9V0I6 4.44e-18 80 27 2 183 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Pyrococcus abyssi (strain GE5 / Orsay)
P37254 4.74e-18 84 28 6 208 1 ABZ1 Aminodeoxychorismate synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0CL64 5.25e-18 84 28 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
A6LKY1 5.64e-18 84 29 5 191 3 guaA GMP synthase [glutamine-hydrolyzing] Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B9KFL4 7.51e-18 84 32 5 193 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q58970 8.9e-18 80 30 3 183 1 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6ASN4 9.93e-18 83 29 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
P14952 1.35e-17 77 44 3 94 3 trpG Anthranilate synthase component 2 (Fragment) Acetivibrio thermocellus
Q6LXA7 1.73e-17 79 32 4 158 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A9A9L8 5.97e-17 78 28 3 183 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q9PN49 7.08e-17 81 32 5 193 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HTL3 7.36e-17 80 31 5 193 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter jejuni (strain RM1221)
Q64XQ7 1.31e-16 80 31 4 175 3 guaA GMP synthase [glutamine-hydrolyzing] Bacteroides fragilis (strain YCH46)
Q5LGV6 1.31e-16 80 31 4 175 3 guaA GMP synthase [glutamine-hydrolyzing] Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A6LD04 1.39e-16 80 32 2 138 3 guaA GMP synthase [glutamine-hydrolyzing] Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A1W0N3 1.46e-16 80 32 5 193 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FMV3 2.42e-16 79 31 5 193 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A6L686 4.06e-16 79 33 2 136 3 guaA GMP synthase [glutamine-hydrolyzing] Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
O26805 4.08e-16 75 31 5 187 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9RT91 9.17e-16 77 30 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A9BER7 1.65e-15 77 27 6 191 3 guaA GMP synthase [glutamine-hydrolyzing] Petrotoga mobilis (strain DSM 10674 / SJ95)
A7H2D2 1.97e-15 77 31 5 193 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q6KZC5 2.06e-15 73 29 4 189 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
C1D0M2 4.57e-15 75 31 3 185 3 guaA GMP synthase [glutamine-hydrolyzing] Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q1J0T4 5.67e-15 75 31 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
B7IHI2 6.22e-15 75 27 5 191 3 guaA GMP synthase [glutamine-hydrolyzing] Thermosipho africanus (strain TCF52B)
A6UVC9 8.79e-15 72 28 5 185 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A1URR0 1.02e-14 74 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q89ZV6 1.06e-14 74 32 2 136 3 guaA1 GMP synthase [glutamine-hydrolyzing] 1 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
P60502 1.29e-14 74 28 3 184 3 guaA GMP synthase [glutamine-hydrolyzing] Spiroplasma kunkelii
Q72IE5 1.38e-14 74 31 5 193 3 guaA GMP synthase [glutamine-hydrolyzing] Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q7UFS3 1.57e-14 74 31 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
C0QYF1 1.95e-14 73 28 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
A0RQD7 2.09e-14 73 33 7 189 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter fetus subsp. fetus (strain 82-40)
Q5SI28 2.57e-14 73 31 5 191 1 guaA GMP synthase [glutamine-hydrolyzing] Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q3Z886 2.6e-14 73 34 2 136 3 guaA GMP synthase [glutamine-hydrolyzing] Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q8CMQ8 3.05e-14 73 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRX1 3.14e-14 73 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0M3J8 3.97e-14 73 29 5 187 3 guaA GMP synthase [glutamine-hydrolyzing] Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q9L0H2 4.18e-14 73 29 5 177 3 guaA GMP synthase [glutamine-hydrolyzing] Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q92SQ3 5.71e-14 72 31 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium meliloti (strain 1021)
A4XKX8 6.24e-14 72 28 5 187 3 guaA GMP synthase [glutamine-hydrolyzing] Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B2RIF9 8.05e-14 72 28 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
B9MS76 9.59e-14 72 29 5 189 3 guaA GMP synthase [glutamine-hydrolyzing] Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
C6BSD8 1.01e-13 72 28 3 185 3 guaA GMP synthase [glutamine-hydrolyzing] Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
C3MCS5 1.01e-13 72 30 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B9J7L1 1.03e-13 72 29 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q2YVL5 1.04e-13 72 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NY69 1.17e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain MW2)
Q6GC81 1.17e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain MSSA476)
Q6GJQ6 1.23e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain MRSA252)
P99105 1.23e-13 71 30 5 186 1 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain N315)
P64296 1.23e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IPX0 1.23e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain JH9)
A6TYP2 1.23e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain JH1)
A7WY93 1.23e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8Z0R1 1.24e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain USA300 / TCH1516)
A6QE71 1.24e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain Newman)
Q5HIQ6 1.24e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain COL)
Q2G0Y6 1.24e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJM5 1.24e-13 71 30 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain USA300)
Q2KDG7 1.3e-13 71 29 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3PYH7 1.53e-13 71 29 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium etli (strain CIAT 652)
Q65MU0 1.67e-13 71 30 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8FRZ3 1.85e-13 71 33 8 189 3 guaA GMP synthase [glutamine-hydrolyzing] Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B1XLR5 1.91e-13 71 27 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q8RC63 2.1e-13 70 28 4 188 3 guaA GMP synthase [glutamine-hydrolyzing] Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P49057 2.27e-13 70 27 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7MWL9 2.51e-13 70 27 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q73U79 2.62e-13 70 30 5 183 3 guaA GMP synthase [glutamine-hydrolyzing] Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
B9DLM7 2.72e-13 70 29 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus carnosus (strain TM300)
A6UFA3 2.84e-13 70 30 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Sinorhizobium medicae (strain WSM419)
Q0AW22 2.93e-13 70 27 5 191 3 guaA GMP synthase [glutamine-hydrolyzing] Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B7JXM2 2.96e-13 70 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Rippkaea orientalis (strain PCC 8801 / RF-1)
Q6G5J3 3.09e-13 70 28 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A0Q6C0 3.27e-13 70 29 5 185 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. novicida (strain U112)
B6JHM4 3.6e-13 70 28 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q1MMJ7 4.41e-13 70 29 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1QKC3 4.42e-13 70 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q2S0V0 4.55e-13 70 31 6 193 3 guaA GMP synthase [glutamine-hydrolyzing] Salinibacter ruber (strain DSM 13855 / M31)
B5ZYE9 4.85e-13 70 29 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q46E00 5.29e-13 67 31 4 186 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanosarcina barkeri (strain Fusaro / DSM 804)
Q8DGA5 5.65e-13 69 26 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8PXF0 5.69e-13 67 32 7 187 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B0U0B2 5.97e-13 69 29 5 185 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B7IUT1 6.37e-13 69 26 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain G9842)
A4IXW6 6.63e-13 69 29 5 185 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. tularensis (strain WY96-3418)
Q74LF7 6.76e-13 69 26 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q5NG38 6.82e-13 69 29 5 185 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HJ0 6.82e-13 69 29 5 185 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. tularensis (strain FSC 198)
B2SGK4 7.8e-13 69 29 5 185 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. mediasiatica (strain FSC147)
A5N5D9 7.84e-13 69 35 1 110 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DYY7 7.84e-13 69 35 1 110 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium kluyveri (strain NBRC 12016)
Q8FWT4 8.85e-13 69 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella suis biovar 1 (strain 1330)
A9MEB0 8.85e-13 69 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A3DCD4 8.97e-13 69 28 6 189 3 guaA GMP synthase [glutamine-hydrolyzing] Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A9WY54 9.11e-13 69 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella suis (strain ATCC 23445 / NCTC 10510)
Q577H0 9.11e-13 69 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella abortus biovar 1 (strain 9-941)
Q2YK38 9.11e-13 69 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella abortus (strain 2308)
B2SBN5 9.11e-13 69 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella abortus (strain S19)
A5VU71 9.2e-13 69 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YBL2 9.21e-13 69 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q5Z1E9 9.58e-13 69 28 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Nocardia farcinica (strain IFM 10152)
C0RKS9 9.83e-13 68 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella melitensis biotype 2 (strain ATCC 23457)
A9VQG9 1.09e-12 68 26 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus mycoides (strain KBAB4)
Q046I2 1.1e-12 68 26 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P60501 1.14e-12 68 27 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q12UJ5 1.15e-12 66 29 5 186 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q47LQ0 1.15e-12 68 28 2 185 3 guaA GMP synthase [glutamine-hydrolyzing] Thermobifida fusca (strain YX)
Q6G197 1.2e-12 68 28 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bartonella quintana (strain Toulouse)
Q4L386 1.23e-12 68 29 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus haemolyticus (strain JCSC1435)
B9L0W3 1.27e-12 68 30 5 185 3 guaA GMP synthase [glutamine-hydrolyzing] Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A0Q2S8 1.32e-12 68 30 7 181 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium novyi (strain NT)
B1WY30 1.33e-12 68 26 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Crocosphaera subtropica (strain ATCC 51142 / BH68)
O28949 1.34e-12 66 25 3 185 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q81IS3 1.42e-12 68 26 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B9JZA3 1.78e-12 68 30 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q2A3D4 1.89e-12 68 29 5 185 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. holarctica (strain LVS)
Q6MLD2 1.97e-12 68 30 4 184 3 guaA GMP synthase [glutamine-hydrolyzing] Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B7H4Q8 2e-12 68 26 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain B4264)
Q0BLV0 2.01e-12 68 29 5 185 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. holarctica (strain OSU18)
A7NCA3 2.01e-12 68 29 5 185 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q212S9 2.32e-12 68 28 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Rhodopseudomonas palustris (strain BisB18)
Q5FMD6 2.43e-12 67 27 5 177 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A7GKG1 2.99e-12 67 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q7M8K2 3.43e-12 67 30 5 189 3 guaA GMP synthase [glutamine-hydrolyzing] Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q89N53 3.84e-12 67 32 7 192 3 guaA GMP synthase [glutamine-hydrolyzing] Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O66601 3.97e-12 67 35 1 110 3 guaA GMP synthase [glutamine-hydrolyzing] Aquifex aeolicus (strain VF5)
Q38ZE1 3.99e-12 67 28 5 187 3 guaA GMP synthase [glutamine-hydrolyzing] Latilactobacillus sakei subsp. sakei (strain 23K)
B1YIZ1 4.06e-12 67 32 2 123 3 guaA GMP synthase [glutamine-hydrolyzing] Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A1BD85 4.38e-12 67 30 7 197 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q8THC7 4.43e-12 65 31 4 184 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q02Y87 4.46e-12 67 29 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Lactococcus lactis subsp. cremoris (strain SK11)
Q9Z6H4 4.46e-12 67 29 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Lactococcus lactis subsp. cremoris (strain MG1363)
Q1WRY8 4.6e-12 67 31 9 191 3 guaA GMP synthase [glutamine-hydrolyzing] Ligilactobacillus salivarius (strain UCC118)
O52831 4.67e-12 67 30 6 188 3 guaA GMP synthase [glutamine-hydrolyzing] Corynebacterium ammoniagenes
Q73ER7 5.05e-12 67 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain ATCC 10987 / NRS 248)
A6QBI5 5.5e-12 67 29 5 185 3 guaA GMP synthase [glutamine-hydrolyzing] Sulfurovum sp. (strain NBC37-1)
Q3ZXH7 6.8e-12 66 32 4 138 3 guaA GMP synthase [glutamine-hydrolyzing] Dehalococcoides mccartyi (strain CBDB1)
Q9ZKG4 6.89e-12 66 30 4 184 3 guaA GMP synthase [glutamine-hydrolyzing] Helicobacter pylori (strain J99 / ATCC 700824)
Q8KFZ5 7.06e-12 66 30 8 198 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q82HM9 7.31e-12 66 29 6 178 3 guaA GMP synthase [glutamine-hydrolyzing] Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
B7JM61 7.68e-12 66 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain AH820)
Q81VE0 7.68e-12 66 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus anthracis
Q6HPC6 7.84e-12 66 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus thuringiensis subsp. konkukian (strain 97-27)
A5FHB4 7.88e-12 66 27 5 187 3 guaA GMP synthase [glutamine-hydrolyzing] Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q63GV4 7.99e-12 66 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain ZK / E33L)
C1EUB4 7.99e-12 66 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain 03BB102)
A0R8W7 7.99e-12 66 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus thuringiensis (strain Al Hakam)
C3L508 7.99e-12 66 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBL1 7.99e-12 66 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus anthracis (strain A0248)
Q49UU9 8.45e-12 66 28 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4V7C6 9.04e-12 66 35 2 110 1 Gmps GMP synthase [glutamine-hydrolyzing] Rattus norvegicus
Q9CFJ0 1.02e-11 66 29 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Lactococcus lactis subsp. lactis (strain IL1403)
Q17YH9 1.11e-11 65 29 4 184 3 guaA GMP synthase [glutamine-hydrolyzing] Helicobacter acinonychis (strain Sheeba)
Q3THK7 1.14e-11 66 34 2 110 1 Gmps GMP synthase [glutamine-hydrolyzing] Mus musculus
B9E8Y0 1.23e-11 65 28 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Macrococcus caseolyticus (strain JCSC5402)
P29727 1.35e-11 65 29 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus subtilis (strain 168)
A7I131 1.36e-11 65 28 6 188 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B2G994 1.36e-11 65 31 8 177 3 guaA GMP synthase [glutamine-hydrolyzing] Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VLY3 1.36e-11 65 31 8 177 3 guaA GMP synthase [glutamine-hydrolyzing] Limosilactobacillus reuteri (strain DSM 20016)
Q5N2F8 1.43e-11 65 31 3 138 3 guaA GMP synthase [glutamine-hydrolyzing] Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q8G5P4 1.47e-11 65 27 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bifidobacterium longum (strain NCC 2705)
A7Z235 1.58e-11 65 29 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q8XHB2 1.76e-11 65 26 7 188 3 carA Carbamoyl phosphate synthase small chain Clostridium perfringens (strain 13 / Type A)
Q7NHC2 1.87e-11 65 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A4QBV0 1.91e-11 65 29 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Corynebacterium glutamicum (strain R)
Q8YT80 2.02e-11 65 28 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8NSR1 2.06e-11 65 29 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8UIL2 2.1e-11 65 27 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8DU81 2.48e-11 65 32 8 190 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5RA96 2.89e-11 65 35 2 110 2 GMPS GMP synthase [glutamine-hydrolyzing] Pongo abelii
P49915 3.03e-11 64 35 2 110 1 GMPS GMP synthase [glutamine-hydrolyzing] Homo sapiens
Q4WFT3 3.51e-11 64 31 7 193 1 gua1 GMP synthase [glutamine-hydrolyzing] Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q3SQP4 4.04e-11 64 27 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A8LAX2 4.19e-11 64 27 3 162 3 guaA GMP synthase [glutamine-hydrolyzing] Parafrankia sp. (strain EAN1pec)
Q1JGP6 4.99e-11 64 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M2 (strain MGAS10270)
B7K8T7 5e-11 64 26 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Gloeothece citriformis (strain PCC 7424)
Q891G7 5.05e-11 63 28 5 176 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium tetani (strain Massachusetts / E88)
Q9L4N5 6.04e-11 63 27 3 160 3 carA Carbamoyl phosphate synthase small chain Lactococcus lactis subsp. cremoris (strain MG1363)
A2RED2 6.09e-11 63 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M5 (strain Manfredo)
Q2RXI5 6.22e-11 63 29 4 187 3 guaA GMP synthase [glutamine-hydrolyzing] Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P60499 6.34e-11 63 29 4 162 3 guaA GMP synthase [glutamine-hydrolyzing] Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B8I4P0 6.66e-11 63 26 4 188 3 guaA GMP synthase [glutamine-hydrolyzing] Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
C0MAM2 7.02e-11 63 33 6 145 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus equi subsp. equi (strain 4047)
A4YSU1 8.9e-11 63 29 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Bradyrhizobium sp. (strain ORS 278)
P9WMS6 9.83e-11 63 33 8 179 3 guaA GMP synthase [glutamine-hydrolyzing] Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WMS7 1.01e-10 63 33 8 179 1 guaA GMP synthase [glutamine-hydrolyzing] Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U871 1.01e-10 63 33 8 179 3 guaA GMP synthase [glutamine-hydrolyzing] Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AHL0 1.01e-10 63 33 8 179 3 guaA GMP synthase [glutamine-hydrolyzing] Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KP87 1.01e-10 63 33 8 179 3 guaA GMP synthase [glutamine-hydrolyzing] Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A5A2 1.01e-10 63 33 8 179 3 guaA GMP synthase [glutamine-hydrolyzing] Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9CF80 1.05e-10 62 26 2 155 3 carA Carbamoyl phosphate synthase small chain Lactococcus lactis subsp. lactis (strain IL1403)
C0MFC7 1.14e-10 63 33 6 145 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus equi subsp. zooepidemicus (strain H70)
Q6A6X1 1.17e-10 63 27 1 159 3 guaA GMP synthase [glutamine-hydrolyzing] Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q987R3 1.17e-10 63 27 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P0DB55 1.2e-10 63 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB54 1.2e-10 63 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P46810 1.2e-10 63 31 6 176 3 guaA GMP synthase [glutamine-hydrolyzing] Mycobacterium leprae (strain TN)
B8ZUE2 1.2e-10 63 31 6 176 3 guaA GMP synthase [glutamine-hydrolyzing] Mycobacterium leprae (strain Br4923)
B5XLN9 1.27e-10 62 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M49 (strain NZ131)
Q48TF6 1.27e-10 62 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1J6G5 1.27e-10 62 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M4 (strain MGAS10750)
P64300 1.27e-10 62 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M18 (strain MGAS8232)
P64299 1.27e-10 62 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M1
Q5XC20 1.34e-10 62 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q3AT13 1.47e-10 62 27 6 197 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium chlorochromatii (strain CaD3)
Q5NN19 1.48e-10 62 28 4 189 3 guaA GMP synthase [glutamine-hydrolyzing] Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q6BLS3 1.5e-10 62 29 7 185 3 GUA1 GMP synthase [glutamine-hydrolyzing] Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q1JLL1 1.5e-10 62 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBM8 1.5e-10 62 31 11 203 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1CSM2 1.8e-10 62 29 4 184 3 guaA GMP synthase [glutamine-hydrolyzing] Helicobacter pylori (strain HPAG1)
A8FAH5 1.92e-10 62 29 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus pumilus (strain SAFR-032)
Q4JTG0 2.05e-10 62 32 9 180 3 guaA GMP synthase [glutamine-hydrolyzing] Corynebacterium jeikeium (strain K411)
Q6YV23 2.15e-10 62 27 3 170 2 CARA Carbamoyl phosphate synthase small chain, chloroplastic Oryza sativa subsp. japonica
A6H0T6 2.23e-10 62 26 5 187 3 guaA GMP synthase [glutamine-hydrolyzing] Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
B2KCS8 2.31e-10 62 27 5 190 3 guaA GMP synthase [glutamine-hydrolyzing] Elusimicrobium minutum (strain Pei191)
Q9KF78 3.05e-10 62 27 4 186 3 guaA Putative GMP synthase [glutamine-hydrolyzing] Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8X239 3.25e-10 60 31 1 110 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
B3ELI1 3.69e-10 61 32 10 198 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium phaeobacteroides (strain BS1)
O25165 3.9e-10 61 29 2 182 3 guaA GMP synthase [glutamine-hydrolyzing] Helicobacter pylori (strain ATCC 700392 / 26695)
Q974T4 3.9e-10 59 29 1 115 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
B7VJU8 3.92e-10 61 27 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio atlanticus (strain LGP32)
A5ILP6 4.11e-10 61 30 4 162 3 guaA GMP synthase [glutamine-hydrolyzing] Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B0S0S7 4.17e-10 61 25 6 178 3 guaA GMP synthase [glutamine-hydrolyzing] Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q8RDR4 4.5e-10 61 24 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5WJI0 4.82e-10 61 32 4 142 3 guaA GMP synthase [glutamine-hydrolyzing] Shouchella clausii (strain KSM-K16)
Q3MEA8 4.89e-10 61 27 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8DZX7 5.12e-10 61 29 9 202 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E5M8 5.12e-10 61 29 9 202 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus agalactiae serotype III (strain NEM316)
Q3K1C0 5.12e-10 61 29 9 202 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5B1L4 5.21e-10 61 26 5 193 3 gua1 GMP synthase [glutamine-hydrolyzing] Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B1LAK3 5.31e-10 61 30 4 162 3 guaA GMP synthase [glutamine-hydrolyzing] Thermotoga sp. (strain RQ2)
Q9X2E0 5.31e-10 61 30 4 162 3 guaA GMP synthase [glutamine-hydrolyzing] Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B3QYF4 5.61e-10 61 28 4 197 3 guaA GMP synthase [glutamine-hydrolyzing] Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B2URJ0 5.61e-10 60 27 5 182 3 carA Carbamoyl phosphate synthase small chain Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
B2J9G3 5.75e-10 61 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q6APU2 6.06e-10 60 29 4 189 3 guaA GMP synthase [glutamine-hydrolyzing] Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B6JMN5 6.38e-10 60 28 2 182 3 guaA GMP synthase [glutamine-hydrolyzing] Helicobacter pylori (strain P12)
B2A5V5 6.45e-10 60 26 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B5Z842 6.82e-10 60 29 2 182 3 guaA GMP synthase [glutamine-hydrolyzing] Helicobacter pylori (strain G27)
Q92CU0 7.69e-10 60 26 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q3B1J3 8.04e-10 60 28 6 199 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B4SFX7 8.27e-10 60 28 4 196 3 guaA GMP synthase [glutamine-hydrolyzing] Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B0TI09 8.76e-10 60 25 4 188 3 guaA GMP synthase [glutamine-hydrolyzing] Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A4SGJ0 8.76e-10 60 29 7 197 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q2GHY2 8.82e-10 60 24 5 195 3 guaA GMP synthase [glutamine-hydrolyzing] Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
C4XSN8 1.13e-09 60 27 4 188 3 guaA GMP synthase [glutamine-hydrolyzing] Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q7MNE1 1.15e-09 60 27 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio vulnificus (strain YJ016)
Q8DF07 1.24e-09 60 27 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio vulnificus (strain CMCP6)
C0R5H8 1.27e-09 60 26 5 201 3 guaA GMP synthase [glutamine-hydrolyzing] Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q73IH1 1.27e-09 60 26 5 201 3 guaA GMP synthase [glutamine-hydrolyzing] Wolbachia pipientis wMel
B2UUF1 1.53e-09 59 28 2 182 3 guaA GMP synthase [glutamine-hydrolyzing] Helicobacter pylori (strain Shi470)
C4K7H1 1.63e-09 59 27 5 191 3 guaA GMP synthase [glutamine-hydrolyzing] Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
P63732 1.78e-09 59 27 4 146 3 carA Carbamoyl phosphate synthase small chain Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P63731 1.78e-09 59 27 4 146 3 carA Carbamoyl phosphate synthase small chain Streptococcus agalactiae serotype III (strain NEM316)
A7I661 1.85e-09 57 29 4 186 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q2IV75 1.88e-09 59 27 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Rhodopseudomonas palustris (strain HaA2)
B6EGZ6 2.1e-09 59 27 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Aliivibrio salmonicida (strain LFI1238)
B3EEV3 2.35e-09 59 28 6 197 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q5GSJ3 2.57e-09 59 26 6 198 3 guaA GMP synthase [glutamine-hydrolyzing] Wolbachia sp. subsp. Brugia malayi (strain TRS)
A6TLR3 3.06e-09 58 25 6 189 3 guaA GMP synthase [glutamine-hydrolyzing] Alkaliphilus metalliredigens (strain QYMF)
Q46I26 3.09e-09 58 29 4 147 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain NATL2A)
Q036Y5 3.13e-09 58 25 3 182 3 guaA GMP synthase [glutamine-hydrolyzing] Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3W952 3.13e-09 58 25 3 182 3 guaA GMP synthase [glutamine-hydrolyzing] Lacticaseibacillus casei (strain BL23)
A2BZD9 3.18e-09 58 26 5 187 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain NATL1A)
C1CF29 3.19e-09 58 32 6 153 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain JJA)
B8ZKZ5 3.19e-09 58 32 6 153 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q8XI46 3.3e-09 58 31 1 110 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium perfringens (strain 13 / Type A)
O08317 3.3e-09 58 30 5 159 2 carA Carbamoyl phosphate synthase arginine-specific small chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B2FNS1 3.51e-09 58 28 4 187 3 guaA GMP synthase [glutamine-hydrolyzing] Stenotrophomonas maltophilia (strain K279a)
Q97VZ9 3.56e-09 57 28 3 149 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O66727 3.56e-09 58 26 4 181 3 carA Carbamoyl phosphate synthase small chain Aquifex aeolicus (strain VF5)
B4SSX7 3.72e-09 58 28 4 187 3 guaA GMP synthase [glutamine-hydrolyzing] Stenotrophomonas maltophilia (strain R551-3)
P63734 3.73e-09 58 26 2 138 3 carA Carbamoyl phosphate synthase small chain Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P63733 3.73e-09 58 26 2 138 3 carA Carbamoyl phosphate synthase small chain Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q3AD70 4.02e-09 58 26 6 191 3 guaA GMP synthase [glutamine-hydrolyzing] Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B5FAY1 4.12e-09 58 27 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Aliivibrio fischeri (strain MJ11)
Q3YT30 4.55e-09 58 25 4 200 3 guaA GMP synthase [glutamine-hydrolyzing] Ehrlichia canis (strain Jake)
B3CPU7 4.76e-09 58 25 6 198 3 guaA GMP synthase [glutamine-hydrolyzing] Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q97FM9 5.1e-09 58 31 1 110 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8Y822 5.42e-09 58 25 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q3ANK7 5.51e-09 58 34 2 109 3 guaA GMP synthase [glutamine-hydrolyzing] Synechococcus sp. (strain CC9605)
Q9PAR6 6.45e-09 58 29 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Xylella fastidiosa (strain 9a5c)
B9DUB2 6.63e-09 57 27 7 190 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q04CA4 6.68e-09 57 25 5 174 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GBU7 6.68e-09 57 25 5 174 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q2RGP2 7e-09 57 25 2 185 3 guaA GMP synthase [glutamine-hydrolyzing] Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2SCJ3 7.04e-09 57 26 6 196 3 guaA GMP synthase [glutamine-hydrolyzing] Hahella chejuensis (strain KCTC 2396)
Q9HSH4 7.15e-09 56 27 6 191 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B4R9R7 7.28e-09 57 26 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Phenylobacterium zucineum (strain HLK1)
Q88Y74 7.35e-09 57 27 6 186 3 guaA GMP synthase [glutamine-hydrolyzing] Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q7N3K4 7.37e-09 57 26 5 191 3 guaA GMP synthase [glutamine-hydrolyzing] Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6CEF3 7.38e-09 57 30 8 186 3 GUA1 GMP synthase [glutamine-hydrolyzing] Yarrowia lipolytica (strain CLIB 122 / E 150)
Q720X7 7.4e-09 57 25 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Listeria monocytogenes serotype 4b (strain F2365)
Q819S2 7.41e-09 57 27 3 165 3 carA Carbamoyl phosphate synthase small chain Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8CXH8 7.57e-09 57 26 4 163 3 carA Carbamoyl phosphate synthase small chain Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5E763 7.63e-09 57 26 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q732I2 7.63e-09 57 27 3 165 3 carA Carbamoyl phosphate synthase small chain Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5M4P4 7.67e-09 57 27 7 190 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M029 7.74e-09 57 27 7 190 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus thermophilus (strain CNRZ 1066)
Q8F4F4 8.65e-09 57 28 6 186 3 guaA Probable GMP synthase [glutamine-hydrolyzing] Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RB7 8.65e-09 57 28 6 186 3 guaA Probable GMP synthase [glutamine-hydrolyzing] Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q0UHC4 8.74e-09 57 28 7 192 3 GUA1 GMP synthase [glutamine-hydrolyzing] Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A2C5P2 9.45e-09 57 32 2 109 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9303)
B0U3R8 9.78e-09 57 29 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Xylella fastidiosa (strain M12)
Q6HES7 9.95e-09 57 27 3 165 3 carA Carbamoyl phosphate synthase small chain Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q636D9 9.95e-09 57 27 3 165 3 carA Carbamoyl phosphate synthase small chain Bacillus cereus (strain ZK / E33L)
Q81WF1 9.95e-09 57 27 3 165 3 carA Carbamoyl phosphate synthase small chain Bacillus anthracis
Q3A590 9.96e-09 57 28 5 191 3 guaA GMP synthase [glutamine-hydrolyzing] Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q5L3E1 1.06e-08 57 27 4 173 3 guaA GMP synthase [glutamine-hydrolyzing] Geobacillus kaustophilus (strain HTA426)
C1CLE8 1.1e-08 57 32 6 153 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain P1031)
B2IQR1 1.16e-08 57 32 6 153 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain CGSP14)
Q87BK6 1.16e-08 57 29 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6W2 1.16e-08 57 29 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Xylella fastidiosa (strain M23)
C1CQS0 1.17e-08 57 32 6 153 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain Taiwan19F-14)
P64298 1.17e-08 57 32 6 153 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P64297 1.17e-08 57 32 6 153 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1ICM9 1.17e-08 57 32 6 153 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain Hungary19A-6)
C1C842 1.17e-08 57 32 6 153 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain 70585)
B5E5U0 1.17e-08 57 32 6 153 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae serotype 19F (strain G54)
Q04JQ8 1.17e-08 57 32 6 153 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A8ETA7 1.19e-08 57 28 4 184 3 guaA GMP synthase [glutamine-hydrolyzing] Aliarcobacter butzleri (strain RM4018)
B2HDP0 1.23e-08 57 31 8 179 3 guaA GMP synthase [glutamine-hydrolyzing] Mycobacterium marinum (strain ATCC BAA-535 / M)
Q0W700 1.25e-08 55 26 7 187 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
B9M9G4 1.32e-08 57 29 5 184 3 guaA GMP synthase [glutamine-hydrolyzing] Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q839J8 1.37e-08 57 27 4 184 3 guaA GMP synthase [glutamine-hydrolyzing] Enterococcus faecalis (strain ATCC 700802 / V583)
Q5FPL0 1.48e-08 57 29 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Gluconobacter oxydans (strain 621H)
A8AC69 1.55e-08 55 30 1 113 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
Q18KM8 1.64e-08 55 27 6 195 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q83GZ6 1.77e-08 56 31 1 94 3 guaA GMP synthase [glutamine-hydrolyzing] Tropheryma whipplei (strain Twist)
Q7UGJ6 1.82e-08 56 27 6 175 3 carA Carbamoyl phosphate synthase small chain Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
C1A3W7 2.26e-08 56 27 3 186 3 guaA GMP synthase [glutamine-hydrolyzing] Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q83ID3 2.49e-08 56 30 1 94 3 guaA GMP synthase [glutamine-hydrolyzing] Tropheryma whipplei (strain TW08/27)
A1AXH0 2.52e-08 56 24 5 195 3 guaA GMP synthase [glutamine-hydrolyzing] Ruthia magnifica subsp. Calyptogena magnifica
Q8DUP4 2.71e-08 55 24 3 160 3 carA Carbamoyl phosphate synthase small chain Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
C4XRH8 2.9e-08 55 26 3 164 3 carA Carbamoyl phosphate synthase small chain Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q9HJM3 2.95e-08 54 27 5 191 1 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
A0AHK7 3.01e-08 55 25 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
P58894 3.03e-08 55 26 4 158 3 carA Carbamoyl phosphate synthase small chain Streptococcus pyogenes serotype M18 (strain MGAS8232)
C3LT21 3.31e-08 55 26 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio cholerae serotype O1 (strain M66-2)
Q9KTW2 3.31e-08 55 26 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3F1 3.31e-08 55 26 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A6Q4N8 3.56e-08 55 28 5 191 3 guaA GMP synthase [glutamine-hydrolyzing] Nitratiruptor sp. (strain SB155-2)
P0DA13 3.73e-08 55 26 4 158 3 carA Carbamoyl phosphate synthase small chain Streptococcus pyogenes serotype M3 (strain SSI-1)
Q5XCR8 3.73e-08 55 26 4 158 3 carA Carbamoyl phosphate synthase small chain Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DA12 3.73e-08 55 26 4 158 3 carA Carbamoyl phosphate synthase small chain Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P63735 3.73e-08 55 26 4 158 3 carA Carbamoyl phosphate synthase small chain Streptococcus pyogenes serotype M1
Q6FFN2 3.84e-08 55 29 6 189 3 guaA GMP synthase [glutamine-hydrolyzing] Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
C4Z3X1 3.86e-08 55 27 5 177 3 guaA GMP synthase [glutamine-hydrolyzing] Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q3BSP7 4.08e-08 55 28 4 187 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q4FVS5 4.35e-08 55 27 7 188 3 guaA GMP synthase [glutamine-hydrolyzing] Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A6SZM5 4.88e-08 55 26 5 194 3 guaA GMP synthase [glutamine-hydrolyzing] Janthinobacterium sp. (strain Marseille)
P38625 4.89e-08 55 28 7 185 1 GUA1 GMP synthase [glutamine-hydrolyzing] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7UA53 4.9e-08 55 28 5 187 3 guaA GMP synthase [glutamine-hydrolyzing] Parasynechococcus marenigrum (strain WH8102)
Q9Y933 5.29e-08 55 27 2 186 3 guaA GMP synthase [glutamine-hydrolyzing] Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
A1AQJ8 5.73e-08 55 26 5 186 3 guaA GMP synthase [glutamine-hydrolyzing] Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q30TH8 6.16e-08 55 26 5 188 3 guaA GMP synthase [glutamine-hydrolyzing] Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q87S07 6.34e-08 55 26 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A6LQ90 7.21e-08 55 25 4 186 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P54324 7.89e-08 54 29 3 141 1 carA Carbamoyl phosphate synthase arginine-specific small chain Geobacillus stearothermophilus
Q03H14 8.67e-08 54 27 8 188 3 guaA GMP synthase [glutamine-hydrolyzing] Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
C5CBZ4 9.02e-08 54 27 3 174 3 guaA GMP synthase [glutamine-hydrolyzing] Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
Q5FF75 9.05e-08 54 26 5 199 3 guaA GMP synthase [glutamine-hydrolyzing] Ehrlichia ruminantium (strain Gardel)
Q3B0W1 1.06e-07 54 33 2 109 3 guaA GMP synthase [glutamine-hydrolyzing] Synechococcus sp. (strain CC9902)
Q8KGA2 1.15e-07 54 26 7 170 3 carA Carbamoyl phosphate synthase small chain Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q6AD51 1.16e-07 54 26 2 164 3 guaA GMP synthase [glutamine-hydrolyzing] Leifsonia xyli subsp. xyli (strain CTCB07)
Q8ZT92 1.16e-07 54 28 6 188 3 guaA GMP synthase [glutamine-hydrolyzing] Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
A6W2W4 1.18e-07 54 29 4 141 3 guaA GMP synthase [glutamine-hydrolyzing] Marinomonas sp. (strain MWYL1)
B1L1J7 1.24e-07 54 25 6 181 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Loch Maree / Type A3)
Q67S57 1.29e-07 54 30 2 111 3 guaA GMP synthase [glutamine-hydrolyzing] Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A7MU26 1.34e-07 54 26 2 183 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio campbellii (strain ATCC BAA-1116)
O85192 1.36e-07 53 24 3 182 3 guaA GMP synthase [glutamine-hydrolyzing] Lacticaseibacillus rhamnosus
A1K5U3 1.39e-07 53 26 5 193 3 guaA GMP synthase [glutamine-hydrolyzing] Azoarcus sp. (strain BH72)
Q5HCA2 1.52e-07 53 26 5 199 3 guaA GMP synthase [glutamine-hydrolyzing] Ehrlichia ruminantium (strain Welgevonden)
A0B5J1 1.59e-07 52 29 5 165 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
C6DBG3 1.62e-07 53 27 6 191 3 guaA GMP synthase [glutamine-hydrolyzing] Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D288 1.62e-07 53 27 6 191 3 guaA GMP synthase [glutamine-hydrolyzing] Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1ZNB4 1.63e-07 53 29 1 110 3 guaA GMP synthase [glutamine-hydrolyzing] Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q47WD1 1.72e-07 53 27 6 194 3 guaA GMP synthase [glutamine-hydrolyzing] Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B2SLG1 1.9e-07 53 27 4 187 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q7U7F9 1.95e-07 53 29 5 169 3 carA Carbamoyl phosphate synthase small chain Parasynechococcus marenigrum (strain WH8102)
Q5H0S2 1.99e-07 53 27 4 187 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3Q9 1.99e-07 53 27 4 187 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2UZ05 2.46e-07 53 30 1 108 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Alaska E43 / Type E3)
Q31F66 2.68e-07 53 23 3 189 3 guaA GMP synthase [glutamine-hydrolyzing] Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q67Q55 2.82e-07 53 28 6 174 3 carA Carbamoyl phosphate synthase small chain Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q2UFN0 2.91e-07 53 28 6 192 3 gua1 GMP synthase [glutamine-hydrolyzing] Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q31DE7 2.92e-07 53 23 6 188 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9312)
B2TIX3 3e-07 53 30 1 108 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Eklund 17B / Type B)
Q8PK88 3.28e-07 53 27 4 187 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas axonopodis pv. citri (strain 306)
Q8EWS9 3.3e-07 53 24 7 192 3 guaA GMP synthase [glutamine-hydrolyzing] Malacoplasma penetrans (strain HF-2)
Q5P9L5 3.33e-07 53 26 7 204 3 guaA GMP synthase [glutamine-hydrolyzing] Anaplasma marginale (strain St. Maries)
B9KH18 3.36e-07 52 26 7 204 3 guaA GMP synthase [glutamine-hydrolyzing] Anaplasma marginale (strain Florida)
Q8P8Q6 3.54e-07 52 27 4 187 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RSB6 3.54e-07 52 27 4 187 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas campestris pv. campestris (strain B100)
Q4UVC5 3.54e-07 52 27 4 187 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas campestris pv. campestris (strain 8004)
Q5APF2 3.59e-07 52 27 7 185 3 GUA1 GMP synthase [glutamine-hydrolyzing] Candida albicans (strain SC5314 / ATCC MYA-2876)
P60500 3.71e-07 52 27 5 191 3 guaA GMP synthase [glutamine-hydrolyzing] Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q49WY3 3.9e-07 52 25 5 185 3 carA Carbamoyl phosphate synthase small chain Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5QWW5 4.54e-07 52 28 7 197 3 guaA GMP synthase [glutamine-hydrolyzing] Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
C4ZCQ4 4.66e-07 52 31 1 108 3 guaA GMP synthase [glutamine-hydrolyzing] Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q2FL30 4.74e-07 51 27 4 165 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
A4G4U7 5.11e-07 52 26 5 193 3 guaA GMP synthase [glutamine-hydrolyzing] Herminiimonas arsenicoxydans
Q4FMW8 5.26e-07 52 25 4 190 3 guaA GMP synthase [glutamine-hydrolyzing] Pelagibacter ubique (strain HTCC1062)
Q09580 5.29e-07 52 29 5 142 3 gmps-1 Probable GMP synthase [glutamine-hydrolyzing] Caenorhabditis elegans
A7GIN0 5.43e-07 52 24 6 177 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IFD1 5.43e-07 52 24 6 177 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Okra / Type B1)
A5I720 5.43e-07 52 24 6 177 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FYP0 5.43e-07 52 24 6 177 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain ATCC 19397 / Type A)
Q8RG87 5.53e-07 52 26 6 182 3 carA Carbamoyl phosphate synthase small chain Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
C3KUC5 5.53e-07 52 24 6 177 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain 657 / Type Ba4)
Q12PS0 5.9e-07 52 27 6 191 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8CXK8 6.03e-07 52 26 4 184 3 guaA GMP synthase [glutamine-hydrolyzing] Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7V9A9 6.32e-07 52 31 2 109 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9313)
Q5HPY9 6.32e-07 52 24 4 180 3 carA Carbamoyl phosphate synthase small chain Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6FUF3 6.8e-07 52 30 3 109 3 GUA1 GMP synthase [glutamine-hydrolyzing] Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_11245
Feature type CDS
Gene pabA
Product Anthranilate/para-aminobenzoate synthase component II (glutamine amidotransferase)
Location 140978 - 141556 (strand: -1)
Length 579 (nucleotides) / 192 (amino acids)
In genomic island -

Contig

Accession ZDB_688
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2706
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00117 Glutamine amidotransferase class-I

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0512 Amino acid transport and metabolism (E)
Coenzyme transport and metabolism (H)
EH Anthranilate/para-aminobenzoate synthase component II (glutamine amidotransferase)

Kegg Ortholog Annotation(s)

Protein Sequence

MADILLLDNVDSFTYNLADQFRAQGHQVVIYRNRVPAEVILSALETMKNPVLVLSPGPGKPADAGCQPEVLSRVRGRYPVIGICLGHQAIVEAYGGKVSHAGAVLHGKASQLHHDEQSMFSGLPNPMKVARYHSLAAEIIPEALTVCATSDNIVMAVRHEQDKVCGLQFHPESVLTPDGAALLANTLAWAQA

Flanking regions ( +/- flanking 50bp)

GCGGTGATCCGCGCCATCACCCGCGCCCATCATGCAGAGGAGACATTCTGATGGCTGATATTTTACTGCTCGATAATGTCGATTCCTTTACCTATAACCTGGCCGACCAGTTCCGTGCTCAGGGCCATCAGGTGGTGATTTACCGTAACCGGGTTCCGGCAGAGGTCATTCTTTCCGCGCTGGAAACCATGAAAAACCCAGTGCTGGTGCTCTCTCCGGGGCCGGGAAAACCGGCGGATGCCGGATGCCAGCCGGAAGTGCTGAGCCGTGTCAGAGGACGTTACCCGGTGATTGGTATTTGCCTCGGCCATCAGGCGATTGTTGAAGCCTACGGCGGCAAAGTCAGCCACGCCGGTGCTGTGCTCCACGGTAAAGCCAGCCAGCTGCACCACGATGAGCAGTCCATGTTTTCCGGTCTGCCGAACCCGATGAAAGTGGCACGCTATCACTCTCTGGCAGCAGAAATTATCCCGGAAGCACTGACCGTGTGCGCCACCAGCGACAACATTGTGATGGCCGTCCGTCATGAACAGGACAAAGTCTGCGGCTTACAGTTTCACCCCGAATCCGTCCTGACACCGGACGGCGCAGCCCTGCTGGCTAATACCCTGGCGTGGGCACAGGCATAACTCAACCTGAATAACAGATAAAAAAACAGATTAAGGAACAGAGAGATGCA