Homologs in group_2707

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05165 FBDBKF_05165 100.0 Morganella morganii S1 trpD Anthranilate phosphoribosyltransferase, glycosyltransferase domain
EHELCC_12425 EHELCC_12425 100.0 Morganella morganii S2 trpD Anthranilate phosphoribosyltransferase, glycosyltransferase domain
NLDBIP_12765 NLDBIP_12765 100.0 Morganella morganii S4 trpD Anthranilate phosphoribosyltransferase, glycosyltransferase domain
LHKJJB_12625 LHKJJB_12625 100.0 Morganella morganii S3 trpD Anthranilate phosphoribosyltransferase, glycosyltransferase domain
F4V73_RS05620 F4V73_RS05620 93.4 Morganella psychrotolerans trpD anthranilate phosphoribosyltransferase

Distribution of the homologs in the orthogroup group_2707

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2707

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P00904 1.52e-162 467 73 0 332 1 trpGD Bifunctional protein TrpGD Escherichia coli (strain K12)
B4EWH5 2.4e-162 459 71 0 332 3 trpD Anthranilate phosphoribosyltransferase Proteus mirabilis (strain HI4320)
P00905 1.39e-159 459 72 0 332 1 trpGD Bifunctional protein TrpGD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C6DGZ7 5.99e-158 449 71 0 332 3 trpD Anthranilate phosphoribosyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B2VKT4 1.23e-157 447 70 0 332 3 trpD Anthranilate phosphoribosyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q7N488 9.67e-156 442 69 0 331 3 trpD Anthranilate phosphoribosyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D4U2 2.44e-154 439 70 0 332 3 trpD Anthranilate phosphoribosyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GF80 3.22e-153 436 72 0 332 3 trpD Anthranilate phosphoribosyltransferase Serratia proteamaculans (strain 568)
Q66AK2 5.11e-153 435 72 0 332 3 trpD Anthranilate phosphoribosyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TJ65 5.11e-153 435 72 0 332 3 trpD Anthranilate phosphoribosyltransferase Yersinia pestis (strain Pestoides F)
Q1CJ26 5.11e-153 435 72 0 332 3 trpD Anthranilate phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
B2K3W4 5.11e-153 435 72 0 332 3 trpD Anthranilate phosphoribosyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C7P0 5.11e-153 435 72 0 332 3 trpD Anthranilate phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
Q8ZEG7 5.18e-153 435 72 0 332 3 trpD Anthranilate phosphoribosyltransferase Yersinia pestis
A7FI31 5.18e-153 435 72 0 332 3 trpD Anthranilate phosphoribosyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JKS0 6.94e-153 435 72 0 332 3 trpD Anthranilate phosphoribosyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q2NT50 1.15e-143 411 66 0 332 3 trpD Anthranilate phosphoribosyltransferase Sodalis glossinidius (strain morsitans)
Q9KST4 5.26e-140 402 60 0 332 3 trpD Anthranilate phosphoribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F210 5.26e-140 402 60 0 332 3 trpD Anthranilate phosphoribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MM54 7.28e-134 387 58 0 329 3 trpD Anthranilate phosphoribosyltransferase Vibrio vulnificus (strain YJ016)
Q6LPA6 7.53e-134 387 59 0 327 3 trpD Anthranilate phosphoribosyltransferase Photobacterium profundum (strain SS9)
Q8D8B4 1.43e-133 386 58 0 329 3 trpD Anthranilate phosphoribosyltransferase Vibrio vulnificus (strain CMCP6)
A5UBZ6 1.39e-132 384 56 0 325 3 trpD Anthranilate phosphoribosyltransferase Haemophilus influenzae (strain PittEE)
B8F815 2.2e-132 383 56 1 330 3 trpD Anthranilate phosphoribosyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
Q4QKA1 8.27e-132 381 56 0 325 3 trpD Anthranilate phosphoribosyltransferase Haemophilus influenzae (strain 86-028NP)
A5UEN6 1.09e-130 379 56 0 325 3 trpD Anthranilate phosphoribosyltransferase Haemophilus influenzae (strain PittGG)
P43858 5.48e-130 377 55 0 325 3 trpD Anthranilate phosphoribosyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P22096 1.1e-128 374 58 0 331 3 trpD Anthranilate phosphoribosyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C4LC91 7.58e-128 372 55 1 330 3 trpD Anthranilate phosphoribosyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A7MRZ7 2.17e-125 365 58 0 328 3 trpD Anthranilate phosphoribosyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q65TF2 3.46e-124 362 53 0 327 3 trpD Anthranilate phosphoribosyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P57856 4.39e-124 362 53 1 330 3 trpD Anthranilate phosphoribosyltransferase Pasteurella multocida (strain Pm70)
Q44602 1.06e-121 356 48 0 329 3 trpD Anthranilate phosphoribosyltransferase Buchnera aphidicola subsp. Schlechtendalia chinensis
A6VNT3 2.41e-121 355 52 0 330 3 trpD Anthranilate phosphoribosyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0UU36 3.31e-121 355 53 1 330 3 trpD Anthranilate phosphoribosyltransferase Histophilus somni (strain 2336)
Q9RQ35 7.56e-118 346 47 0 329 3 trpD Anthranilate phosphoribosyltransferase Buchnera aphidicola subsp. Melaphis rhois
B3GY52 1.78e-117 345 51 0 329 3 trpD Anthranilate phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A1STT2 1.55e-116 343 53 1 332 3 trpD Anthranilate phosphoribosyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B0BQA6 6.86e-116 341 50 0 329 3 trpD Anthranilate phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N1G7 1e-114 338 50 0 329 3 trpD Anthranilate phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A0KMC8 1.91e-112 333 55 1 330 3 trpD Anthranilate phosphoribosyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P59415 2.63e-112 332 44 0 329 3 trpD Anthranilate phosphoribosyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A4SKT3 2.76e-112 332 55 1 330 3 trpD Anthranilate phosphoribosyltransferase Aeromonas salmonicida (strain A449)
Q494D8 2.53e-111 330 48 1 329 3 trpD Anthranilate phosphoribosyltransferase Blochmanniella pennsylvanica (strain BPEN)
B8D7H6 2.31e-110 327 45 0 329 3 trpD Anthranilate phosphoribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
O68426 1.33e-109 325 47 0 329 3 trpD Anthranilate phosphoribosyltransferase Buchnera aphidicola subsp. Diuraphis noxia
P57367 1.47e-109 325 45 0 329 3 trpD Anthranilate phosphoribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D972 1.47e-109 325 45 0 329 3 trpD Anthranilate phosphoribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q5QX82 2.35e-109 325 53 2 297 3 trpD Anthranilate phosphoribosyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
P42392 2.67e-106 317 45 0 329 3 trpD Anthranilate phosphoribosyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q15RZ7 5.91e-106 316 48 1 328 3 trpD Anthranilate phosphoribosyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A0Q8R1 4.13e-102 306 47 0 322 3 trpD Anthranilate phosphoribosyltransferase Francisella tularensis subsp. novicida (strain U112)
B0TWF2 6.74e-102 305 46 0 332 3 trpD Anthranilate phosphoribosyltransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A7NF00 2.46e-101 304 47 0 322 3 trpD Anthranilate phosphoribosyltransferase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q0BJW6 2.96e-101 304 47 0 322 3 trpD Anthranilate phosphoribosyltransferase Francisella tularensis subsp. holarctica (strain OSU18)
B2SEF6 9.08e-101 303 47 0 322 3 trpD Anthranilate phosphoribosyltransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
A4J0E5 1.6e-100 302 47 0 322 3 trpD Anthranilate phosphoribosyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q12LE4 2.58e-99 300 50 2 333 3 trpD Anthranilate phosphoribosyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A9F0C1 2.42e-98 297 47 1 327 3 trpD Anthranilate phosphoribosyltransferase Sorangium cellulosum (strain So ce56)
Q0HWI1 8.37e-98 295 52 2 334 3 trpD Anthranilate phosphoribosyltransferase Shewanella sp. (strain MR-7)
Q0HK79 1.73e-97 295 52 2 334 3 trpD Anthranilate phosphoribosyltransferase Shewanella sp. (strain MR-4)
A0KVD3 1.89e-97 295 53 2 334 3 trpD Anthranilate phosphoribosyltransferase Shewanella sp. (strain ANA-3)
Q3IKY4 7.64e-97 293 46 3 330 3 trpD Anthranilate phosphoribosyltransferase Pseudoalteromonas translucida (strain TAC 125)
A9KTR5 1.01e-96 293 52 2 337 3 trpD Anthranilate phosphoribosyltransferase Shewanella baltica (strain OS195)
A3QF71 1.66e-96 292 51 2 336 3 trpD Anthranilate phosphoribosyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1S7I0 2.23e-96 292 51 2 333 3 trpD Anthranilate phosphoribosyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A4Y843 2.89e-96 291 52 2 335 3 trpD Anthranilate phosphoribosyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A3D628 3.81e-96 291 52 2 337 3 trpD Anthranilate phosphoribosyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A6WPW9 6.48e-96 291 52 2 337 3 trpD Anthranilate phosphoribosyltransferase Shewanella baltica (strain OS185)
Q8ECV2 8.3e-96 290 52 2 334 3 trpD Anthranilate phosphoribosyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q084N6 8.5e-95 288 51 2 335 3 trpD Anthranilate phosphoribosyltransferase Shewanella frigidimarina (strain NCIMB 400)
Q47YC2 3.42e-94 287 43 2 331 3 trpD Anthranilate phosphoribosyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A1RIE5 1.19e-93 285 51 2 335 3 trpD Anthranilate phosphoribosyltransferase Shewanella sp. (strain W3-18-1)
A9B9W1 7.9e-78 244 40 4 331 3 trpD Anthranilate phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9211)
A9BHQ6 3.55e-77 243 38 1 326 3 trpD Anthranilate phosphoribosyltransferase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q8FLJ8 2.29e-75 238 42 2 307 3 trpD Anthranilate phosphoribosyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A5GKM1 4.86e-75 237 42 4 330 3 trpD Anthranilate phosphoribosyltransferase Synechococcus sp. (strain WH7803)
B8FA41 6.2e-75 237 40 1 326 3 trpD Anthranilate phosphoribosyltransferase Desulfatibacillum aliphaticivorans
B1GZB9 6.58e-75 236 38 3 325 3 trpD Anthranilate phosphoribosyltransferase Endomicrobium trichonymphae
Q0I9N0 7.09e-75 237 41 4 329 3 trpD Anthranilate phosphoribosyltransferase Synechococcus sp. (strain CC9311)
Q57686 7.57e-75 236 37 5 329 3 trpD Anthranilate phosphoribosyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
C0QR68 7.58e-74 234 40 2 294 3 trpD Anthranilate phosphoribosyltransferase Persephonella marina (strain DSM 14350 / EX-H1)
B8GWP8 8.77e-74 234 40 3 331 3 trpD Anthranilate phosphoribosyltransferase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A728 8.77e-74 234 40 3 331 3 trpD Anthranilate phosphoribosyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q7TV05 2.56e-73 233 40 4 331 3 trpD Anthranilate phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9313)
C3PKY4 2.61e-73 233 39 1 306 3 trpD Anthranilate phosphoribosyltransferase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
B4RBX4 6.2e-73 231 40 4 334 3 trpD Anthranilate phosphoribosyltransferase Phenylobacterium zucineum (strain HLK1)
Q136D3 8.01e-73 231 39 5 336 3 trpD Anthranilate phosphoribosyltransferase Rhodopseudomonas palustris (strain BisB5)
B8I0U9 1.33e-72 231 40 6 327 3 trpD Anthranilate phosphoribosyltransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q98ME4 1.59e-72 231 41 1 323 3 trpD Anthranilate phosphoribosyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q11HU2 3.41e-72 229 39 1 322 3 trpD Anthranilate phosphoribosyltransferase Chelativorans sp. (strain BNC1)
Q2IWB1 9.5e-72 229 39 4 331 3 trpD Anthranilate phosphoribosyltransferase Rhodopseudomonas palustris (strain HaA2)
B3QUY6 1.21e-71 228 38 3 327 3 trpD Anthranilate phosphoribosyltransferase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B0SYZ3 1.24e-71 229 39 1 330 3 trpD Anthranilate phosphoribosyltransferase Caulobacter sp. (strain K31)
B3Q6M8 1.3e-71 228 39 6 334 3 trpD Anthranilate phosphoribosyltransferase Rhodopseudomonas palustris (strain TIE-1)
Q07NF5 1.31e-71 228 39 4 331 3 trpD Anthranilate phosphoribosyltransferase Rhodopseudomonas palustris (strain BisA53)
A8ZZX1 1.38e-71 228 39 3 329 3 trpD Anthranilate phosphoribosyltransferase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q6N5T0 5.17e-71 227 39 5 332 3 trpD Anthranilate phosphoribosyltransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q17ZP2 8.04e-71 226 41 3 322 3 trpD Anthranilate phosphoribosyltransferase Helicobacter acinonychis (strain Sheeba)
P17170 1.81e-70 225 43 2 277 3 trpD Anthranilate phosphoribosyltransferase Lacticaseibacillus casei
B3W6W9 4.78e-70 224 40 2 327 3 trpD Anthranilate phosphoribosyltransferase Lacticaseibacillus casei (strain BL23)
Q9RTJ5 8.01e-70 224 39 2 324 3 trpD Anthranilate phosphoribosyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q7VCJ6 1.5e-69 223 37 4 331 3 trpD Anthranilate phosphoribosyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q03CY0 1.94e-69 223 43 2 277 3 trpD Anthranilate phosphoribosyltransferase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
A0AJ83 3.73e-69 222 42 3 282 3 trpD Anthranilate phosphoribosyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
C4ZI69 3.83e-69 222 38 5 327 3 trpD Anthranilate phosphoribosyltransferase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
B0CGT8 4.11e-69 222 37 1 322 3 trpD Anthranilate phosphoribosyltransferase Brucella suis (strain ATCC 23445 / NCTC 10510)
P94326 5.91e-69 221 37 4 332 3 trpD Anthranilate phosphoribosyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2JWL5 1.37e-68 221 38 2 327 3 trpD Anthranilate phosphoribosyltransferase Synechococcus sp. (strain JA-3-3Ab)
Q0A6E7 1.43e-68 220 42 3 330 3 trpD Anthranilate phosphoribosyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q215B8 2.66e-68 220 41 4 284 3 trpD Anthranilate phosphoribosyltransferase Rhodopseudomonas palustris (strain BisB18)
Q8Y6Q3 3.51e-68 219 39 5 331 3 trpD Anthranilate phosphoribosyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q3AXD5 3.95e-68 219 39 5 329 3 trpD Anthranilate phosphoribosyltransferase Synechococcus sp. (strain CC9902)
B6JNC0 4.1e-68 219 40 3 322 3 trpD Anthranilate phosphoribosyltransferase Helicobacter pylori (strain P12)
A5GTM6 4.82e-68 219 40 4 317 3 trpD Anthranilate phosphoribosyltransferase Synechococcus sp. (strain RCC307)
C1CG45 4.83e-68 219 38 5 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus pneumoniae (strain JJA)
P67000 4.83e-68 219 38 5 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2ISS4 4.83e-68 219 38 5 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus pneumoniae (strain CGSP14)
P66999 4.83e-68 219 38 5 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1I7T0 4.83e-68 219 38 5 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus pneumoniae (strain Hungary19A-6)
C1C969 4.83e-68 219 38 5 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus pneumoniae (strain 70585)
Q04IY6 4.83e-68 219 38 5 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9ZJU7 5.2e-68 219 40 3 322 3 trpD Anthranilate phosphoribosyltransferase Helicobacter pylori (strain J99 / ATCC 700824)
Q2RT49 6.58e-68 219 40 2 322 3 trpD Anthranilate phosphoribosyltransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B8DHB1 8.06e-68 218 39 3 330 3 trpD Anthranilate phosphoribosyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
Q71Z37 8.32e-68 218 39 3 330 3 trpD Anthranilate phosphoribosyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KVS8 8.32e-68 218 39 3 330 3 trpD Anthranilate phosphoribosyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
B9KXB8 1.1e-67 218 40 8 336 3 trpD Anthranilate phosphoribosyltransferase Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q92B78 1.1e-67 218 41 1 281 3 trpD Anthranilate phosphoribosyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A5UMC1 1.24e-67 218 36 2 316 3 trpD Anthranilate phosphoribosyltransferase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
P56737 1.83e-67 218 40 3 322 3 trpD Anthranilate phosphoribosyltransferase Helicobacter pylori (strain ATCC 700392 / 26695)
A8I839 2.11e-67 218 39 4 328 3 trpD Anthranilate phosphoribosyltransferase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B5Z8S5 2.11e-67 217 40 3 322 3 trpD Anthranilate phosphoribosyltransferase Helicobacter pylori (strain G27)
B2UV44 2.59e-67 217 40 3 322 3 trpD Anthranilate phosphoribosyltransferase Helicobacter pylori (strain Shi470)
C1CMD6 2.83e-67 217 37 5 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus pneumoniae (strain P1031)
B5E7M6 2.83e-67 217 37 5 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus pneumoniae serotype 19F (strain G54)
Q1QMJ8 2.89e-67 217 38 4 332 3 trpD Anthranilate phosphoribosyltransferase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A4VHK0 3.96e-67 217 48 3 242 3 trpD Anthranilate phosphoribosyltransferase Stutzerimonas stutzeri (strain A1501)
A3DDS8 4.01e-67 217 35 3 327 3 trpD Anthranilate phosphoribosyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8DVF6 7.05e-67 216 37 3 330 3 trpD Anthranilate phosphoribosyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A1TJQ1 7.48e-67 216 42 4 317 3 trpD Anthranilate phosphoribosyltransferase Paracidovorax citrulli (strain AAC00-1)
Q112P2 7.97e-67 216 36 3 339 3 trpD Anthranilate phosphoribosyltransferase Trichodesmium erythraeum (strain IMS101)
A2BWT1 8.52e-67 216 36 3 330 3 trpD Anthranilate phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9515)
B0VUS1 8.56e-67 216 43 2 255 3 trpD Anthranilate phosphoribosyltransferase Acinetobacter baumannii (strain SDF)
C1CT54 8.59e-67 216 37 5 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus pneumoniae (strain Taiwan19F-14)
B8ZN62 8.59e-67 216 37 5 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B0VBS2 8.85e-67 216 43 2 255 3 trpD Anthranilate phosphoribosyltransferase Acinetobacter baumannii (strain AYE)
A3M784 8.85e-67 216 43 2 255 3 trpD Anthranilate phosphoribosyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
A7INK3 9.02e-67 216 36 4 331 3 trpD Anthranilate phosphoribosyltransferase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B9JFD7 9.84e-67 216 38 3 333 3 trpD Anthranilate phosphoribosyltransferase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
C4Z111 1.01e-66 216 38 6 318 3 trpD Anthranilate phosphoribosyltransferase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q3SRJ4 1.36e-66 215 40 4 282 3 trpD Anthranilate phosphoribosyltransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q5WGS4 1.76e-66 215 36 2 334 3 trpD Anthranilate phosphoribosyltransferase Shouchella clausii (strain KSM-K16)
Q1CRX3 1.84e-66 215 40 3 322 3 trpD Anthranilate phosphoribosyltransferase Helicobacter pylori (strain HPAG1)
A9BS05 1.98e-66 215 40 4 316 3 trpD Anthranilate phosphoribosyltransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q0BTY4 2.28e-66 215 38 1 279 3 trpD Anthranilate phosphoribosyltransferase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A6LU93 3.53e-66 214 35 2 328 3 trpD Anthranilate phosphoribosyltransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q03WZ9 3.66e-66 214 36 3 330 3 trpD Anthranilate phosphoribosyltransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A5VXL4 6.83e-66 214 41 5 324 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P00500 6.98e-66 214 42 2 256 1 trpD Anthranilate phosphoribosyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A3PHK8 7.7e-66 213 42 2 267 3 trpD Anthranilate phosphoribosyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q123F3 8.01e-66 214 39 3 323 3 trpD Anthranilate phosphoribosyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
A4WX68 8.12e-66 213 42 2 267 3 trpD Anthranilate phosphoribosyltransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B9KMV1 1.18e-65 213 39 2 307 3 trpD Anthranilate phosphoribosyltransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q1GHJ3 1.27e-65 213 39 3 318 3 trpD Anthranilate phosphoribosyltransferase Ruegeria sp. (strain TM1040)
Q7TTV4 1.41e-65 213 40 4 316 3 trpD Anthranilate phosphoribosyltransferase Parasynechococcus marenigrum (strain WH8102)
Q2RIT6 1.45e-65 213 39 1 331 3 trpD Anthranilate phosphoribosyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B6JG28 1.52e-65 213 37 4 331 3 trpD Anthranilate phosphoribosyltransferase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q9ZFA8 1.8e-65 213 42 2 267 3 trpD Anthranilate phosphoribosyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3J897 2.41e-65 212 37 3 330 3 trpD Anthranilate phosphoribosyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A9KL44 2.68e-65 212 36 4 324 3 trpD Anthranilate phosphoribosyltransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B2V751 2.73e-65 212 37 2 301 3 trpD Anthranilate phosphoribosyltransferase Sulfurihydrogenibium sp. (strain YO3AOP1)
A5CXR3 3.77e-65 212 33 2 327 3 trpD Anthranilate phosphoribosyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q3ABS0 4.56e-65 211 41 1 281 3 trpD Anthranilate phosphoribosyltransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A0LJ59 5.54e-65 211 38 1 329 3 trpD Anthranilate phosphoribosyltransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q2JQ65 6.15e-65 211 37 2 327 3 trpD Anthranilate phosphoribosyltransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8G0F5 6.25e-65 211 37 1 322 3 trpD Anthranilate phosphoribosyltransferase Brucella suis biovar 1 (strain 1330)
Q88WI3 6.89e-65 211 42 5 284 3 trpD Anthranilate phosphoribosyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q5ZX98 7.6e-65 211 36 2 321 3 trpD Anthranilate phosphoribosyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X6R9 7.6e-65 211 36 2 321 3 trpD Anthranilate phosphoribosyltransferase Legionella pneumophila (strain Paris)
A9M5F3 8.1e-65 211 37 1 322 3 trpD Anthranilate phosphoribosyltransferase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A6X0L1 8.36e-65 211 38 1 323 3 trpD Anthranilate phosphoribosyltransferase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8XS00 9.73e-65 211 39 5 331 3 trpD2 Anthranilate phosphoribosyltransferase 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q88QR7 1.06e-64 211 41 5 324 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P06559 1.36e-64 211 41 2 309 3 trpD Anthranilate phosphoribosyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QI74 1.36e-64 211 41 2 309 3 trpD Anthranilate phosphoribosyltransferase Corynebacterium glutamicum (strain R)
Q8UER8 1.41e-64 210 37 3 333 3 trpD Anthranilate phosphoribosyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q97EF2 1.49e-64 210 35 1 329 3 trpD Anthranilate phosphoribosyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q3K5V3 1.67e-64 210 42 5 277 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas fluorescens (strain Pf0-1)
Q1QV38 1.78e-64 210 42 3 297 3 trpD Anthranilate phosphoribosyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B4SE13 1.82e-64 210 35 3 338 3 trpD Anthranilate phosphoribosyltransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q8YHF7 2.43e-64 209 37 1 322 3 trpD Anthranilate phosphoribosyltransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RJB0 2.43e-64 209 37 1 322 3 trpD Anthranilate phosphoribosyltransferase Brucella melitensis biotype 2 (strain ATCC 23457)
Q57CZ9 2.43e-64 209 37 1 322 3 trpD Anthranilate phosphoribosyltransferase Brucella abortus biovar 1 (strain 9-941)
Q2YRR5 2.43e-64 209 37 1 322 3 trpD Anthranilate phosphoribosyltransferase Brucella abortus (strain 2308)
B2S5Z0 2.43e-64 209 37 1 322 3 trpD Anthranilate phosphoribosyltransferase Brucella abortus (strain S19)
Q92PS0 2.53e-64 209 38 5 324 3 trpD Anthranilate phosphoribosyltransferase Rhizobium meliloti (strain 1021)
Q02YA8 2.8e-64 209 38 3 333 3 trpD Anthranilate phosphoribosyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
B0KJB2 3.28e-64 209 41 5 324 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas putida (strain GB-1)
Q48NP8 3.69e-64 209 45 4 263 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q28R66 3.8e-64 209 39 2 317 3 trpD Anthranilate phosphoribosyltransferase Jannaschia sp. (strain CCS1)
A5VQR4 3.85e-64 209 37 1 322 3 trpD Anthranilate phosphoribosyltransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
C3MCF3 3.93e-64 209 37 3 323 3 trpD Anthranilate phosphoribosyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B8EJS2 4.02e-64 209 37 2 329 3 trpD Anthranilate phosphoribosyltransferase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q5WY74 4.48e-64 209 39 2 278 3 trpD Anthranilate phosphoribosyltransferase Legionella pneumophila (strain Lens)
P20575 4.58e-64 209 40 5 324 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas putida
A2RK17 4.85e-64 209 38 3 333 3 trpD Anthranilate phosphoribosyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
B5YD05 6.4e-64 208 34 5 335 3 trpD Anthranilate phosphoribosyltransferase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q1IJR5 6.51e-64 209 39 2 278 3 trpD Anthranilate phosphoribosyltransferase Koribacter versatilis (strain Ellin345)
A9W900 7.65e-64 208 38 4 324 3 trpD Anthranilate phosphoribosyltransferase Methylorubrum extorquens (strain PA1)
B1XSZ2 8.38e-64 208 42 4 273 3 trpD Anthranilate phosphoribosyltransferase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
B9JX63 1.29e-63 207 37 1 328 3 trpD Anthranilate phosphoribosyltransferase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q6NEC1 1.33e-63 207 39 2 315 3 trpD Anthranilate phosphoribosyltransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A5IG81 1.37e-63 208 36 2 321 3 trpD Anthranilate phosphoribosyltransferase Legionella pneumophila (strain Corby)
B1JE35 1.49e-63 208 40 7 330 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas putida (strain W619)
B1JUU6 2.43e-63 207 41 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia orbicola (strain MC0-3)
B2FKL2 2.49e-63 207 41 5 327 3 trpD Anthranilate phosphoribosyltransferase Stenotrophomonas maltophilia (strain K279a)
Q13TW5 2.83e-63 207 40 4 315 3 trpD Anthranilate phosphoribosyltransferase Paraburkholderia xenovorans (strain LB400)
Q2W3A9 3.31e-63 207 37 3 335 3 trpD Anthranilate phosphoribosyltransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A2BQY1 3.49e-63 207 35 3 328 3 trpD Anthranilate phosphoribosyltransferase Prochlorococcus marinus (strain AS9601)
A8AW02 3.84e-63 206 37 4 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A2C1X5 4.4e-63 206 36 4 324 3 trpD Anthranilate phosphoribosyltransferase Prochlorococcus marinus (strain NATL1A)
Q31LB6 4.94e-63 206 40 3 333 3 trpD Anthranilate phosphoribosyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q21MR4 4.99e-63 206 41 3 276 3 trpD Anthranilate phosphoribosyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B8DZP4 5.44e-63 206 34 5 335 3 trpD Anthranilate phosphoribosyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q1IG00 5.48e-63 206 40 5 324 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas entomophila (strain L48)
Q7NGU2 5.59e-63 206 43 1 293 3 trpD Anthranilate phosphoribosyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A6U9C4 6.29e-63 206 37 3 322 3 trpD Anthranilate phosphoribosyltransferase Sinorhizobium medicae (strain WSM419)
Q39JZ6 6.9e-63 206 39 2 313 3 trpD Anthranilate phosphoribosyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B5ZPY6 1.02e-62 205 36 1 319 3 trpD Anthranilate phosphoribosyltransferase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q1BSD3 1.11e-62 205 40 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia orbicola (strain AU 1054)
A0K459 1.11e-62 205 40 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia cenocepacia (strain HI2424)
B8IP99 1.16e-62 205 41 2 279 3 trpD Anthranilate phosphoribosyltransferase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q8ESU1 1.17e-62 205 36 3 330 3 trpD Anthranilate phosphoribosyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A1W2Z7 1.37e-62 205 39 4 316 3 trpD Anthranilate phosphoribosyltransferase Acidovorax sp. (strain JS42)
B9MBS3 1.37e-62 205 39 4 316 3 trpD Anthranilate phosphoribosyltransferase Acidovorax ebreus (strain TPSY)
Q9X6J5 1.44e-62 205 38 2 298 3 trpD Anthranilate phosphoribosyltransferase Geobacillus stearothermophilus
A8LMJ6 1.66e-62 205 39 2 317 3 trpD Anthranilate phosphoribosyltransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q88A04 1.67e-62 205 44 4 263 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P73617 2e-62 205 39 4 336 3 trpD Anthranilate phosphoribosyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A1WH74 2.14e-62 204 42 3 281 3 trpD Anthranilate phosphoribosyltransferase Verminephrobacter eiseniae (strain EF01-2)
A1WYT2 2.19e-62 204 37 3 329 3 trpD Anthranilate phosphoribosyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
Q1MGE2 2.35e-62 204 36 1 319 3 trpD Anthranilate phosphoribosyltransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B0U7Z5 2.41e-62 204 40 2 286 3 trpD Anthranilate phosphoribosyltransferase Methylobacterium sp. (strain 4-46)
B1I3Z8 2.63e-62 204 41 3 277 3 trpD Anthranilate phosphoribosyltransferase Desulforudis audaxviator (strain MP104C)
B9M5M2 3.14e-62 204 38 3 284 3 trpD Anthranilate phosphoribosyltransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B1Z9R9 3.22e-62 204 37 4 324 3 trpD Anthranilate phosphoribosyltransferase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B1M5Q2 3.77e-62 204 40 2 286 3 trpD Anthranilate phosphoribosyltransferase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q02166 3.79e-62 207 39 3 283 2 PAT1 Anthranilate phosphoribosyltransferase, chloroplastic Arabidopsis thaliana
Q3M4T0 3.87e-62 204 37 7 343 3 trpD Anthranilate phosphoribosyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B4E7A8 4.57e-62 204 40 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q8R9M6 4.86e-62 204 37 1 325 3 trpD Anthranilate phosphoribosyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B7KUV9 5.06e-62 203 37 4 324 3 trpD Anthranilate phosphoribosyltransferase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q4ZML2 5.35e-62 204 44 4 263 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q46L78 5.61e-62 204 35 4 324 3 trpD Anthranilate phosphoribosyltransferase Prochlorococcus marinus (strain NATL2A)
Q67PJ9 6.72e-62 203 42 3 282 3 trpD Anthranilate phosphoribosyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q02000 7.51e-62 203 39 1 284 3 trpD Anthranilate phosphoribosyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q845X9 7.65e-62 203 40 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
B2JHI7 7.77e-62 203 40 4 314 3 trpD Anthranilate phosphoribosyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q5V211 8.15e-62 203 37 6 331 3 trpD Anthranilate phosphoribosyltransferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q1AU89 1.06e-61 203 38 7 342 3 trpD Anthranilate phosphoribosyltransferase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A4YVD5 1.13e-61 202 37 2 280 3 trpD Anthranilate phosphoribosyltransferase Bradyrhizobium sp. (strain ORS 278)
B0K2U2 1.23e-61 202 35 1 329 3 trpD Anthranilate phosphoribosyltransferase Thermoanaerobacter sp. (strain X514)
B0K8T3 1.23e-61 202 35 1 329 3 trpD Anthranilate phosphoribosyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q5KXU8 1.25e-61 202 36 3 333 3 trpD Anthranilate phosphoribosyltransferase Geobacillus kaustophilus (strain HTA426)
Q0C1A1 1.25e-61 202 37 2 329 3 trpD Anthranilate phosphoribosyltransferase Hyphomonas neptunium (strain ATCC 15444)
O66576 1.33e-61 202 36 6 327 3 trpD Anthranilate phosphoribosyltransferase Aquifex aeolicus (strain VF5)
A5EK24 1.82e-61 202 38 2 280 3 trpD Anthranilate phosphoribosyltransferase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B7JX56 2.02e-61 202 38 4 333 3 trpD Anthranilate phosphoribosyltransferase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q8YXQ9 2.08e-61 202 38 7 343 1 trpD2 Anthranilate phosphoribosyltransferase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B7IM73 2.44e-61 202 35 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus cereus (strain G9842)
Q2K880 2.58e-61 202 35 1 319 3 trpD Anthranilate phosphoribosyltransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5N0L1 2.68e-61 202 39 3 333 3 trpD Anthranilate phosphoribosyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q5LRH8 2.98e-61 201 40 2 317 3 trpD Anthranilate phosphoribosyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P26924 3.04e-61 202 37 3 322 3 trpD Anthranilate phosphoribosyltransferase Azospirillum brasilense
B1YLS1 3.08e-61 201 37 5 334 3 trpD Anthranilate phosphoribosyltransferase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
P70936 3.91e-61 201 35 2 333 3 trpD Anthranilate phosphoribosyltransferase Priestia megaterium (strain ATCC 12872 / QMB1551)
B3PLP1 4e-61 201 38 6 336 3 trpD Anthranilate phosphoribosyltransferase Cellvibrio japonicus (strain Ueda107)
C5D3D7 4.58e-61 201 36 4 331 3 trpD Anthranilate phosphoribosyltransferase Geobacillus sp. (strain WCH70)
B8GNI1 5.02e-61 201 42 3 264 3 trpD Anthranilate phosphoribosyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B3EMT4 5.12e-61 201 35 4 339 3 trpD Anthranilate phosphoribosyltransferase Chlorobium phaeobacteroides (strain BS1)
A4JB68 6.62e-61 201 40 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B2IKP4 6.72e-61 201 39 2 281 3 trpD Anthranilate phosphoribosyltransferase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q9V1G4 7.76e-61 200 38 4 289 3 trpD Anthranilate phosphoribosyltransferase Pyrococcus abyssi (strain GE5 / Orsay)
A3CRK8 7.79e-61 201 40 3 323 3 trpD Anthranilate phosphoribosyltransferase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
B3Q0L2 8.96e-61 200 35 1 319 3 trpD Anthranilate phosphoribosyltransferase Rhizobium etli (strain CIAT 652)
A3CLL8 9.22e-61 200 36 4 331 3 trpD Anthranilate phosphoribosyltransferase Streptococcus sanguinis (strain SK36)
Q7TU90 9.43e-61 200 35 2 303 3 trpD Anthranilate phosphoribosyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A9VJV9 9.52e-61 200 36 5 333 3 trpD Anthranilate phosphoribosyltransferase Bacillus mycoides (strain KBAB4)
A7H793 1.1e-60 200 39 3 282 3 trpD Anthranilate phosphoribosyltransferase Anaeromyxobacter sp. (strain Fw109-5)
B7HGZ8 1.51e-60 200 35 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus cereus (strain B4264)
Q12TL1 2.43e-60 199 40 3 295 3 trpD Anthranilate phosphoribosyltransferase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q3A6L6 2.87e-60 199 34 3 339 3 trpD Anthranilate phosphoribosyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q1IZP8 3.21e-60 199 39 2 331 3 trpD Anthranilate phosphoribosyltransferase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A3PCQ4 3.67e-60 199 35 3 328 3 trpD Anthranilate phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9301)
Q30VM1 3.85e-60 198 38 4 320 3 trpD Anthranilate phosphoribosyltransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q8F708 3.89e-60 199 38 5 318 3 trpD Anthranilate phosphoribosyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8KC17 3.98e-60 199 36 2 289 3 trpD Anthranilate phosphoribosyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q1GYF5 4.37e-60 199 35 4 329 3 trpD Anthranilate phosphoribosyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A6VU64 4.5e-60 199 40 1 271 3 trpD Anthranilate phosphoribosyltransferase Marinomonas sp. (strain MWYL1)
A4IQ85 5.02e-60 198 35 3 333 3 trpD Anthranilate phosphoribosyltransferase Geobacillus thermodenitrificans (strain NG80-2)
Q72PD0 5.31e-60 198 38 5 318 3 trpD Anthranilate phosphoribosyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q465F3 5.76e-60 199 38 2 281 3 trpD Anthranilate phosphoribosyltransferase Methanosarcina barkeri (strain Fusaro / DSM 804)
A1B3Y5 8.15e-60 198 39 2 307 3 trpD Anthranilate phosphoribosyltransferase Paracoccus denitrificans (strain Pd 1222)
A1KAT3 8.88e-60 198 42 5 283 3 trpD Anthranilate phosphoribosyltransferase Azoarcus sp. (strain BH72)
B4SLE9 1.09e-59 197 40 6 328 3 trpD Anthranilate phosphoribosyltransferase Stenotrophomonas maltophilia (strain R551-3)
A8G4M3 1.27e-59 197 35 3 328 3 trpD Anthranilate phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9215)
Q0VMX5 1.63e-59 197 45 4 243 3 trpD Anthranilate phosphoribosyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B5EBU6 1.91e-59 197 35 4 336 3 trpD Anthranilate phosphoribosyltransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A5GES2 3.41e-59 197 37 3 289 3 trpD Anthranilate phosphoribosyltransferase Geotalea uraniireducens (strain Rf4)
Q8U089 4.96e-59 195 37 6 316 3 trpD Anthranilate phosphoribosyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
C5BPA3 5.04e-59 196 39 1 283 3 trpD Anthranilate phosphoribosyltransferase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q5LYI4 5.16e-59 196 34 5 333 3 trpD Anthranilate phosphoribosyltransferase Streptococcus thermophilus (strain CNRZ 1066)
B4UHD1 6.72e-59 196 37 0 330 3 trpD Anthranilate phosphoribosyltransferase Anaeromyxobacter sp. (strain K)
C6DYM5 7.31e-59 196 34 4 336 3 trpD Anthranilate phosphoribosyltransferase Geobacter sp. (strain M21)
B8JAL5 1.35e-58 194 38 0 330 3 trpD Anthranilate phosphoribosyltransferase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q74AH4 1.51e-58 195 35 5 333 3 trpD Anthranilate phosphoribosyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A6TM73 2.03e-58 194 35 5 331 3 trpD Anthranilate phosphoribosyltransferase Alkaliphilus metalliredigens (strain QYMF)
A4SFZ6 2.17e-58 194 37 5 336 3 trpD Anthranilate phosphoribosyltransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q3BYB6 2.8e-58 194 41 4 316 3 trpD Anthranilate phosphoribosyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q82Y74 3.25e-58 194 38 4 330 3 trpD Anthranilate phosphoribosyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0K6I1 3.7e-58 194 40 6 312 3 trpD Anthranilate phosphoribosyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q03JB8 3.71e-58 193 34 5 333 3 trpD Anthranilate phosphoribosyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q3IQ38 3.85e-58 193 36 1 292 3 trpD Anthranilate phosphoribosyltransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
B3E5V8 5.99e-58 193 38 6 292 3 trpD Anthranilate phosphoribosyltransferase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A5N7N7 6.11e-58 193 38 3 322 3 trpD Anthranilate phosphoribosyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E148 6.11e-58 193 38 3 322 3 trpD Anthranilate phosphoribosyltransferase Clostridium kluyveri (strain NBRC 12016)
Q21SE7 6.56e-58 193 41 3 270 3 trpD Anthranilate phosphoribosyltransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q5M347 7.21e-58 192 33 5 333 3 trpD Anthranilate phosphoribosyltransferase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
A6VFU3 8e-58 192 35 8 324 3 trpD Anthranilate phosphoribosyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
C1DHY8 9.05e-58 193 44 3 262 3 trpD Anthranilate phosphoribosyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q24SK4 9.13e-58 192 41 3 270 3 trpD Anthranilate phosphoribosyltransferase Desulfitobacterium hafniense (strain Y51)
Q63QH1 9.19e-58 192 41 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia pseudomallei (strain K96243)
A3NDZ2 9.19e-58 192 41 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia pseudomallei (strain 668)
Q3JNB1 9.19e-58 192 41 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia pseudomallei (strain 1710b)
A3NZP5 9.19e-58 192 41 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia pseudomallei (strain 1106a)
A1UW99 9.19e-58 192 41 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia mallei (strain SAVP1)
Q62DC9 9.19e-58 192 41 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia mallei (strain ATCC 23344)
A2RYI2 9.19e-58 192 41 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia mallei (strain NCTC 10229)
A3MFQ3 9.19e-58 192 41 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia mallei (strain NCTC 10247)
Q3ZZ15 1.09e-57 192 35 5 330 3 trpD Anthranilate phosphoribosyltransferase Dehalococcoides mccartyi (strain CBDB1)
Q3Z6G6 1.09e-57 192 35 5 330 3 trpD Anthranilate phosphoribosyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q08654 1.13e-57 199 37 4 324 3 trpGD Bifunctional protein TrpGD Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P20574 1.24e-57 192 42 2 262 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02TB6 1.24e-57 192 42 2 262 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V608 1.24e-57 192 42 2 262 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas aeruginosa (strain LESB58)
Q8YZP8 1.32e-57 193 37 5 338 3 trpD1 Anthranilate phosphoribosyltransferase 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2IGV6 1.35e-57 192 37 0 330 3 trpD Anthranilate phosphoribosyltransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q73BR0 1.6e-57 192 35 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8TLP5 1.95e-57 192 39 4 282 3 trpD Anthranilate phosphoribosyltransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
B1YSF6 1.99e-57 192 41 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia ambifaria (strain MC40-6)
Q8XVE7 2.24e-57 192 43 4 266 3 trpD1 Anthranilate phosphoribosyltransferase 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P03947 2.37e-57 191 35 4 324 3 trpD Anthranilate phosphoribosyltransferase Bacillus subtilis (strain 168)
Q0BIM7 2.86e-57 191 41 4 314 3 trpD Anthranilate phosphoribosyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A6UZF1 2.98e-57 191 42 2 262 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas aeruginosa (strain PA7)
Q8PQ48 3.86e-57 191 41 4 313 3 trpD Anthranilate phosphoribosyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q39SQ6 3.92e-57 191 35 5 335 3 trpD Anthranilate phosphoribosyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A5FA70 3.95e-57 191 35 5 301 3 trpD Anthranilate phosphoribosyltransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A4XZC6 4.05e-57 191 43 3 262 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas mendocina (strain ymp)
Q2SUI1 4.48e-57 191 41 4 315 3 trpD Anthranilate phosphoribosyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q81GG8 5.15e-57 191 35 5 331 3 trpD Anthranilate phosphoribosyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B9LEV9 5.8e-57 191 37 4 320 3 trpD Anthranilate phosphoribosyltransferase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WCH7 5.8e-57 191 37 4 320 3 trpD Anthranilate phosphoribosyltransferase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q0B006 6.56e-57 190 32 2 325 3 trpD Anthranilate phosphoribosyltransferase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q0AJP9 6.88e-57 190 42 2 278 3 trpD Anthranilate phosphoribosyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q9YGB4 7.31e-57 190 39 6 279 1 trpD Anthranilate phosphoribosyltransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A5D1S5 8.52e-57 190 37 3 330 3 trpD Anthranilate phosphoribosyltransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A4J146 1.03e-56 190 34 3 326 3 trpD Anthranilate phosphoribosyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A6UP19 1.13e-56 189 38 6 278 3 trpD Anthranilate phosphoribosyltransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q1LIH4 1.43e-56 189 40 6 312 3 trpD Anthranilate phosphoribosyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B8FVH5 1.45e-56 189 41 3 270 3 trpD Anthranilate phosphoribosyltransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A4XLM7 2.11e-56 189 34 5 317 3 trpD Anthranilate phosphoribosyltransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A2SLH5 2.58e-56 189 42 4 266 3 trpD Anthranilate phosphoribosyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B8G5C5 2.58e-56 189 38 4 315 3 trpD Anthranilate phosphoribosyltransferase Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q9KCB3 2.9e-56 189 35 2 304 3 trpD Anthranilate phosphoribosyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q31B38 2.97e-56 189 35 3 324 3 trpD Anthranilate phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9312)
B3QM44 3.1e-56 189 37 2 289 3 trpD Anthranilate phosphoribosyltransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B2SL02 3.61e-56 189 40 5 324 3 trpD Anthranilate phosphoribosyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NYD6 3.61e-56 189 40 5 324 3 trpD Anthranilate phosphoribosyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B7JES7 4.02e-56 188 34 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus cereus (strain AH820)
Q81TM1 4.02e-56 188 34 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus anthracis
C3LAW1 4.02e-56 188 34 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P3T7 4.02e-56 188 34 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus anthracis (strain A0248)
A0RB61 4.15e-56 188 34 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus thuringiensis (strain Al Hakam)
Q3APT3 4.37e-56 189 35 2 292 3 trpD Anthranilate phosphoribosyltransferase Chlorobium chlorochromatii (strain CaD3)
Q2S999 5.22e-56 188 38 4 330 3 trpD Anthranilate phosphoribosyltransferase Hahella chejuensis (strain KCTC 2396)
C0ZCE2 5.43e-56 188 39 2 298 3 trpD Anthranilate phosphoribosyltransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A1ALX3 6.05e-56 188 36 2 288 3 trpD Anthranilate phosphoribosyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A2STA7 6.14e-56 188 34 3 326 3 trpD Anthranilate phosphoribosyltransferase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
Q163Y0 7.25e-56 187 37 3 318 3 trpD Anthranilate phosphoribosyltransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6HLU7 9.07e-56 187 34 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q2Y5W9 1.12e-55 187 38 5 332 3 trpD Anthranilate phosphoribosyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7NW17 1.46e-55 187 40 4 332 3 trpD Anthranilate phosphoribosyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q4K502 1.53e-55 187 44 4 263 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B2UDK8 1.61e-55 187 41 5 284 3 trpD Anthranilate phosphoribosyltransferase Ralstonia pickettii (strain 12J)
P18261 2.29e-55 186 35 3 326 3 trpD Anthranilate phosphoribosyltransferase Bacillus pumilus
Q254S7 2.58e-55 186 33 5 332 3 trpD Anthranilate phosphoribosyltransferase Chlamydia felis (strain Fe/C-56)
A7I4T7 3.31e-55 186 36 4 337 3 trpD Anthranilate phosphoribosyltransferase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
O27698 3.8e-55 186 39 6 319 3 trpD Anthranilate phosphoribosyltransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A6SUH6 4.43e-55 186 43 2 255 3 trpD Anthranilate phosphoribosyltransferase Janthinobacterium sp. (strain Marseille)
B9MKD0 5.5e-55 185 33 5 317 3 trpD Anthranilate phosphoribosyltransferase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B9IU35 5.76e-55 185 34 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus cereus (strain Q1)
B7I0E9 5.76e-55 185 34 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus cereus (strain AH187)
C1ELE7 5.76e-55 185 34 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus cereus (strain 03BB102)
Q8PD71 6.61e-55 185 43 2 262 1 trpD Anthranilate phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UZF9 6.61e-55 185 43 2 262 3 trpD Anthranilate phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain 8004)
A8ACG6 8.66e-55 185 35 4 324 3 trpD Anthranilate phosphoribosyltransferase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
Q8PT97 1.1e-54 186 40 2 248 3 trpD Anthranilate phosphoribosyltransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
C3K308 1.29e-54 185 40 4 276 3 trpD Anthranilate phosphoribosyltransferase Pseudomonas fluorescens (strain SBW25)
Q8TXJ5 1.39e-54 184 35 5 329 3 trpD Anthranilate phosphoribosyltransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q04ZD2 1.49e-54 184 37 4 289 3 trpD Anthranilate phosphoribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04R23 1.49e-54 184 37 4 289 3 trpD Anthranilate phosphoribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q63ED0 1.79e-54 184 34 3 332 3 trpD Anthranilate phosphoribosyltransferase Bacillus cereus (strain ZK / E33L)
Q5FNM7 2.22e-54 184 40 1 270 3 trpD Anthranilate phosphoribosyltransferase Gluconobacter oxydans (strain 621H)
A1AVF1 3.02e-54 183 33 2 327 3 trpD Anthranilate phosphoribosyltransferase Ruthia magnifica subsp. Calyptogena magnifica
Q5P2G2 3.39e-54 183 40 3 282 3 trpD Anthranilate phosphoribosyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q6LYI4 3.41e-54 183 34 6 323 3 trpD Anthranilate phosphoribosyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q46WU8 4.44e-54 184 40 6 312 3 trpD Anthranilate phosphoribosyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A9AAU1 4.75e-54 182 33 7 324 3 trpD Anthranilate phosphoribosyltransferase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q822W6 5.09e-54 183 32 3 331 3 trpD Anthranilate phosphoribosyltransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B0U1N9 5.17e-54 183 40 5 298 3 trpD Anthranilate phosphoribosyltransferase Xylella fastidiosa (strain M12)
B0RMZ8 6.43e-54 183 42 2 262 3 trpD Anthranilate phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q9Z4W9 9.2e-54 182 42 1 267 3 trpD2 Anthranilate phosphoribosyltransferase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6AMS5 9.27e-54 182 36 5 330 3 trpD Anthranilate phosphoribosyltransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q4L676 9.74e-54 182 33 8 334 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus haemolyticus (strain JCSC1435)
B3EH38 1.14e-53 182 34 3 290 3 trpD Anthranilate phosphoribosyltransferase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q9Y8T2 1.21e-53 182 39 2 318 3 trpD Anthranilate phosphoribosyltransferase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q2S1Z6 1.31e-53 182 32 3 336 3 trpD Anthranilate phosphoribosyltransferase Salinibacter ruber (strain DSM 13855 / M31)
A5WFZ6 1.37e-53 182 36 5 349 3 trpD Anthranilate phosphoribosyltransferase Psychrobacter sp. (strain PRwf-1)
Q4J8X7 1.86e-53 181 35 7 320 3 trpD Anthranilate phosphoribosyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
A4FXH2 2.71e-53 181 34 8 324 3 trpD Anthranilate phosphoribosyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q3SGS1 6.39e-53 180 44 5 249 3 trpD Anthranilate phosphoribosyltransferase Thiobacillus denitrificans (strain ATCC 25259)
A6GWZ4 6.97e-53 180 32 5 334 3 trpD Anthranilate phosphoribosyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
B5ERI3 7.48e-53 180 41 6 258 3 trpD Anthranilate phosphoribosyltransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JBC1 7.48e-53 180 41 6 258 3 trpD Anthranilate phosphoribosyltransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A7HXZ5 7.92e-53 180 39 4 331 3 trpD Anthranilate phosphoribosyltransferase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q47AC6 9.55e-53 179 40 4 307 3 trpD Anthranilate phosphoribosyltransferase Dechloromonas aromatica (strain RCB)
Q3B2H3 1.18e-52 180 36 4 296 3 trpD Anthranilate phosphoribosyltransferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q9PGT6 1.24e-52 179 42 5 282 3 trpD Anthranilate phosphoribosyltransferase Xylella fastidiosa (strain 9a5c)
P30525 1.25e-52 176 39 2 242 3 trpD Anthranilate phosphoribosyltransferase (Fragment) Bacillus caldotenax
Q0SHN1 1.96e-52 179 38 1 278 3 trpD Anthranilate phosphoribosyltransferase Rhodococcus jostii (strain RHA1)
P52562 2.02e-52 178 39 1 292 3 trpD Anthranilate phosphoribosyltransferase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
C6C1D5 3.03e-52 178 32 1 313 3 trpD Anthranilate phosphoribosyltransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q11PY2 4.43e-52 177 35 5 326 3 trpD Anthranilate phosphoribosyltransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q1GUW8 4.46e-52 177 38 3 276 3 trpD Anthranilate phosphoribosyltransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
C1D7P3 4.62e-52 178 40 2 281 3 trpD Anthranilate phosphoribosyltransferase Laribacter hongkongensis (strain HLHK9)
Q2G6R1 6.7e-52 177 37 3 296 3 trpD Anthranilate phosphoribosyltransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A8FEK1 7.02e-52 177 35 4 336 3 trpD Anthranilate phosphoribosyltransferase Bacillus pumilus (strain SAFR-032)
Q4FM53 7.07e-52 177 34 5 296 3 trpD Anthranilate phosphoribosyltransferase Pelagibacter ubique (strain HTCC1062)
A6UW21 8.36e-52 177 32 5 330 3 trpD Anthranilate phosphoribosyltransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q021N5 1.12e-51 177 41 4 278 3 trpD Anthranilate phosphoribosyltransferase Solibacter usitatus (strain Ellin6076)
B4S5K5 1.51e-51 177 36 3 277 3 trpD Anthranilate phosphoribosyltransferase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
A0M4T1 2.04e-51 176 33 4 330 3 trpD Anthranilate phosphoribosyltransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q18FI8 2.25e-51 176 36 2 322 3 trpD Anthranilate phosphoribosyltransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q87EX3 2.62e-51 176 39 5 298 3 trpD Anthranilate phosphoribosyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6S4 2.62e-51 176 39 5 298 3 trpD Anthranilate phosphoribosyltransferase Xylella fastidiosa (strain M23)
Q2KU98 2.78e-51 176 37 5 316 3 trpD Anthranilate phosphoribosyltransferase Bordetella avium (strain 197N)
A1U6H0 3.05e-51 176 41 3 255 3 trpD Anthranilate phosphoribosyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
P83827 3.96e-51 175 44 5 262 1 trpD Anthranilate phosphoribosyltransferase Thermus thermophilus
Q5SH88 3.96e-51 175 44 5 262 1 trpD Anthranilate phosphoribosyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72HJ6 3.96e-51 175 44 5 262 3 trpD Anthranilate phosphoribosyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
P26925 4.24e-51 176 37 5 330 3 trpD Anthranilate phosphoribosyltransferase Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q1CZH6 5e-51 175 39 4 318 3 trpD Anthranilate phosphoribosyltransferase Myxococcus xanthus (strain DK1622)
C1AU95 5.41e-51 176 37 1 278 3 trpD Anthranilate phosphoribosyltransferase Rhodococcus opacus (strain B4)
Q65I32 6.12e-51 175 34 3 333 3 trpD Anthranilate phosphoribosyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q2NFE4 8.99e-51 175 30 5 340 3 trpD Anthranilate phosphoribosyltransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
A3MVG6 1.47e-50 174 39 2 326 3 trpD Anthranilate phosphoribosyltransferase Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
A9HY12 3.05e-50 173 39 3 281 3 trpD Anthranilate phosphoribosyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A4SV53 3.23e-50 173 40 3 277 3 trpD Anthranilate phosphoribosyltransferase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B1Y7I3 7.75e-50 172 43 4 266 3 trpD Anthranilate phosphoribosyltransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B8GJ30 8.25e-50 172 36 3 302 3 trpD Anthranilate phosphoribosyltransferase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
A5UT95 1.16e-49 172 38 4 282 3 trpD Anthranilate phosphoribosyltransferase Roseiflexus sp. (strain RS-1)
A6QGS1 1.42e-49 171 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus aureus (strain Newman)
Q9RL77 1.42e-49 171 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus aureus (strain COL)
Q2FYR7 1.42e-49 171 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH67 1.42e-49 171 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus aureus (strain USA300)
Q7VU66 1.84e-49 171 38 7 317 3 trpD Anthranilate phosphoribosyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9HPG3 1.89e-49 171 36 3 305 3 trpD Anthranilate phosphoribosyltransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R622 1.89e-49 171 36 3 305 3 trpD Anthranilate phosphoribosyltransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q7W388 2.09e-49 171 38 7 317 3 trpD Anthranilate phosphoribosyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEK7 2.09e-49 171 38 7 317 3 trpD Anthranilate phosphoribosyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B9LQ96 2.39e-49 171 36 4 330 3 trpD Anthranilate phosphoribosyltransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
A9B148 2.41e-49 171 39 3 271 3 trpD Anthranilate phosphoribosyltransferase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q604F8 3.11e-49 171 38 3 329 3 trpD Anthranilate phosphoribosyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B9DP50 3.53e-49 170 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus carnosus (strain TM300)
Q0APU5 5.31e-49 170 39 2 259 3 trpD Anthranilate phosphoribosyltransferase Maricaulis maris (strain MCS10)
A7Z619 6.47e-49 169 33 6 337 3 trpD Anthranilate phosphoribosyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q2NA97 6.68e-49 169 36 2 307 3 trpD Anthranilate phosphoribosyltransferase Erythrobacter litoralis (strain HTCC2594)
P66998 6.96e-49 169 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus aureus (strain MW2)
Q6G9J0 6.96e-49 169 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus aureus (strain MSSA476)
P66997 6.96e-49 169 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus aureus (strain N315)
P66996 6.96e-49 169 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ISQ1 6.96e-49 169 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus aureus (strain JH9)
A6U1J1 6.96e-49 169 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus aureus (strain JH1)
A7X232 6.96e-49 169 32 7 327 3 trpD Anthranilate phosphoribosyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A1SLE8 1.07e-48 169 35 2 295 3 trpD Anthranilate phosphoribosyltransferase Nocardioides sp. (strain ATCC BAA-499 / JS614)
A4FAC5 1.1e-48 169 38 3 278 3 trpD Anthranilate phosphoribosyltransferase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
B8DM45 1.15e-48 169 36 3 309 3 trpD Anthranilate phosphoribosyltransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A8LYC4 2.05e-48 169 36 2 280 3 trpD Anthranilate phosphoribosyltransferase Salinispora arenicola (strain CNS-205)
O28668 2.32e-48 173 35 5 302 3 trpCD Tryptophan biosynthesis protein TrpCD Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_11240
Feature type CDS
Gene trpD
Product Anthranilate phosphoribosyltransferase, glycosyltransferase domain
Location 139934 - 140932 (strand: -1)
Length 999 (nucleotides) / 332 (amino acids)
In genomic island -

Contig

Accession ZDB_688
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2707
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00591 Glycosyl transferase family, a/b domain
PF02885 Glycosyl transferase family, helical bundle domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0547 Amino acid transport and metabolism (E) E Anthranilate phosphoribosyltransferase, glycosyltransferase domain

Kegg Ortholog Annotation(s)

Protein Sequence

MQTLFEKLYRGETLTLAESRELFSAIIRGELSETQLAAALISMKMRGEQPDEIAGAAQACLNNARAFPRPDYRFSDIVGTGGDASDSINISTASAFVAAACGIKVAKHGSRSVSSKTGSSDLLNAFGIALDTPADVSRSALDDVGVCFLFAPHYHDGFRFAAPVRQQLKTRTLFNVLGPLINPARPPVALIGVYSPALIRPVAETLKVLGYQRAAVVHSGGMDEVSLHAPTQVAELHNGEIREYRLTTDDFGLPGYDMQELRGGTPEENRQLLTRLLQGEGTAAQSHAVAANVALLMKLNDNEDLQDNAQHALAMIRSGNAFERVTALAARG

Flanking regions ( +/- flanking 50bp)

CATAACTCAACCTGAATAACAGATAAAAAAACAGATTAAGGAACAGAGAGATGCAAACATTATTTGAAAAACTTTACCGGGGTGAAACACTGACCCTGGCGGAAAGCCGGGAATTATTTTCCGCGATTATCCGGGGAGAACTGAGTGAAACCCAGCTGGCAGCAGCACTGATCAGTATGAAAATGCGCGGCGAGCAACCGGATGAAATCGCCGGTGCCGCCCAGGCCTGTCTGAACAATGCGCGCGCCTTCCCGCGTCCGGACTACCGTTTCAGTGATATTGTCGGCACCGGCGGCGATGCTTCCGACAGTATCAATATCTCCACGGCCAGCGCCTTTGTGGCTGCGGCCTGCGGGATAAAAGTCGCCAAACACGGCAGCCGCAGTGTTTCGAGCAAAACCGGCTCTTCTGATTTACTGAATGCCTTCGGGATCGCGCTGGATACCCCGGCGGATGTGTCCCGCAGCGCACTGGATGATGTCGGCGTCTGCTTTCTGTTTGCCCCGCACTATCACGACGGCTTCCGTTTTGCCGCGCCGGTGCGTCAGCAGCTGAAAACCCGTACCTTATTTAATGTCCTCGGGCCGCTGATCAACCCGGCCCGTCCGCCGGTCGCCCTGATCGGCGTATATAGCCCGGCACTGATCCGCCCTGTTGCTGAGACGCTGAAAGTCCTCGGCTACCAGCGTGCCGCCGTAGTACACAGCGGCGGAATGGATGAGGTTTCCCTGCACGCACCGACACAGGTTGCCGAATTGCATAACGGGGAGATCCGCGAATACCGCCTGACCACAGACGATTTCGGCCTGCCGGGTTATGACATGCAGGAATTGCGCGGCGGTACCCCGGAAGAAAACCGTCAGTTGCTGACCCGGTTATTACAGGGAGAAGGCACCGCAGCACAAAGTCACGCCGTGGCAGCCAATGTCGCCCTGCTGATGAAACTCAATGATAACGAAGACTTACAGGATAATGCTCAGCACGCGCTGGCAATGATCCGCAGTGGTAACGCCTTTGAGCGCGTCACCGCCCTGGCCGCGAGAGGATAAACCATGAAAGGCACCGTATTAGAACAGATTGTGAATGATAAACGTATCTC