Homologs in group_1270

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07505 FBDBKF_07505 100.0 Morganella morganii S1 nirB NAD(P)H-nitrite reductase, large subunit
EHELCC_17175 EHELCC_17175 100.0 Morganella morganii S2 nirB NAD(P)H-nitrite reductase, large subunit
NLDBIP_13780 NLDBIP_13780 100.0 Morganella morganii S4 nirB NAD(P)H-nitrite reductase, large subunit
LHKJJB_09070 LHKJJB_09070 100.0 Morganella morganii S3 nirB NAD(P)H-nitrite reductase, large subunit
F4V73_RS13605 F4V73_RS13605 92.2 Morganella psychrotolerans nirB nitrite reductase large subunit NirB
PMI_RS07160 PMI_RS07160 80.0 Proteus mirabilis HI4320 nirB nitrite reductase large subunit NirB

Distribution of the homologs in the orthogroup group_1270

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1270

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P08201 0.0 1384 78 2 844 3 nirB Nitrite reductase (NADH) large subunit Escherichia coli (strain K12)
Q06458 0.0 993 56 3 851 3 nasB Nitrite reductase [NAD(P)H] large subunit Klebsiella oxytoca
P22944 0.0 733 44 12 869 3 niiA Nitrite reductase [NAD(P)H] Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P38681 0.0 699 44 15 882 2 nit-6 Nitrite reductase [NAD(P)H] Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P42435 3.55e-167 508 36 19 824 2 nasD Nitrite reductase [NAD(P)H] Bacillus subtilis (strain 168)
P42433 1.43e-114 370 32 21 794 2 nasB Assimilatory nitrate reductase electron transfer subunit Bacillus subtilis (strain 168)
Q05805 4.59e-40 150 38 4 215 4 DVU_1597 Sulfite reductase, assimilatory-type Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8D4F7 1.7e-33 136 30 9 321 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Vibrio vulnificus (strain CMCP6)
Q7MFY7 2.24e-33 136 30 9 321 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Vibrio vulnificus (strain YJ016)
Q58065 1.68e-31 132 29 9 345 3 MJ0649 NADH oxidase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B5FG80 1.66e-30 127 27 5 337 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aliivibrio fischeri (strain MJ11)
P37337 1.08e-28 123 29 5 288 3 bphG Biphenyl dioxygenase system ferredoxin--NAD(+) reductase component Paraburkholderia xenovorans (strain LB400)
B5XVA0 1.2e-28 122 25 8 338 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Klebsiella pneumoniae (strain 342)
Q0TEG9 4.67e-28 120 26 12 376 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NSJ1 5.27e-28 120 27 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A8A3I8 7.31e-28 119 27 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O9:H4 (strain HS)
B5Z372 8.49e-28 119 26 9 343 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X850 8.49e-28 119 26 9 343 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O157:H7
Q5E3X0 9.17e-28 119 26 5 337 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B7M9E8 9.41e-28 119 27 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O8 (strain IAI1)
B7LEC2 9.41e-28 119 27 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain 55989 / EAEC)
A6TCX6 1.22e-27 119 27 10 342 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8FEN4 1.43e-27 119 27 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UHC3 1.99e-27 118 27 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LW23 2.42e-27 118 27 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A5W4E9 2.97e-27 119 31 7 289 1 todA Toluene 1,2-dioxygenase system ferredoxin--NAD(+) reductase component Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B6I697 4.28e-27 117 26 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain SE11)
Q9HTK9 4.5e-27 117 27 7 322 1 alkT Rubredoxin-NAD(+) reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7MYL1 4.83e-27 117 27 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O81 (strain ED1a)
Q1R7Y9 7.08e-27 117 26 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain UTI89 / UPEC)
A1AEQ1 7.08e-27 117 26 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O1:K1 / APEC
B7MKI0 7.08e-27 117 26 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
A0KEJ2 8.87e-27 117 27 9 323 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B7N6U1 9.2e-27 116 26 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A7ZQE0 1.11e-26 116 26 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q07946 1.15e-26 117 29 8 318 1 bedA Benzene 1,2-dioxygenase system ferredoxin--NAD(+) reductase subunit Pseudomonas putida
P37596 1.4e-26 116 26 9 343 1 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12)
B1IUW8 1.4e-26 116 26 9 343 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XCN8 1.4e-26 116 26 9 343 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12 / DH10B)
C4ZYV6 1.4e-26 116 26 9 343 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12 / MC4100 / BW2952)
B1LQ29 1.44e-26 115 26 9 343 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain SMS-3-5 / SECEC)
Q31X75 2.03e-26 115 26 9 343 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella boydii serotype 4 (strain Sb227)
Q3YYF3 2.21e-26 115 26 9 343 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella sonnei (strain Ss046)
Q32CL7 2.62e-26 115 26 10 344 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella dysenteriae serotype 1 (strain Sd197)
B2U036 2.67e-26 115 26 9 343 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A9MFX5 7.3e-26 114 26 9 340 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4STH3 7.83e-26 114 27 10 323 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aeromonas salmonicida (strain A449)
Q9UYU5 1.2e-25 114 28 7 330 3 PYRAB14120 NAD(P)H sulfur oxidoreductase (CoA-dependent) Pyrococcus abyssi (strain GE5 / Orsay)
P59403 1.36e-25 113 26 9 343 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella flexneri
Q0T1D6 1.36e-25 113 26 9 343 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella flexneri serotype 5b (strain 8401)
Q0VTB0 1.47e-25 113 27 10 327 1 rubB Rubredoxin-NAD(+) reductase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A8GG95 1.71e-25 112 25 7 341 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Serratia proteamaculans (strain 568)
B5RDG6 1.12e-24 110 27 9 338 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q10499 1.27e-24 113 30 13 330 3 aif1 Apoptosis-inducing factor 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q3TY86 1.37e-24 113 29 9 323 1 Aifm3 Apoptosis-inducing factor 3 Mus musculus
A9N0E0 1.7e-24 109 27 9 342 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5F365 2.55e-24 109 27 9 336 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella agona (strain SL483)
O24679 2.69e-24 110 29 5 288 1 tecA4 Chlorobenzene dioxygenase, ferredoxin reductase component Cupriavidus sp. (strain PS12)
B5QV90 2.78e-24 109 27 9 338 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella enteritidis PT4 (strain P125109)
Q9AL95 2.94e-24 109 25 5 339 1 nroR NADH-rubredoxin oxidoreductase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q6D8S1 4.15e-24 108 25 9 373 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B4TF25 6.59e-24 108 27 9 322 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella heidelberg (strain SL476)
Q8U1K9 8.41e-24 107 27 9 375 1 PF1197 NAD(P)H:rubredoxin oxidoreductase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8ZMJ6 8.87e-24 107 27 9 342 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A8ANR8 1.01e-23 107 25 9 342 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5FSZ2 1.05e-23 107 26 9 342 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella dublin (strain CT_02021853)
P16640 1.19e-23 108 28 7 296 1 camA Putidaredoxin reductase CamA Pseudomonas putida
Q8Z4C4 1.33e-23 107 26 9 338 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella typhi
P0C621 1.69e-23 107 30 6 278 3 todA Toluene 1,2-dioxygenase system ferredoxin--NAD(+) reductase component Pseudomonas putida
P08087 1.69e-23 107 30 6 278 3 bnzD Benzene 1,2-dioxygenase system ferredoxin--NAD(+) reductase component Pseudomonas putida
B5BEP9 1.73e-23 107 27 9 336 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi A (strain AKU_12601)
Q5PF36 1.73e-23 107 27 9 336 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TT18 1.83e-23 106 26 8 336 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella schwarzengrund (strain CVM19633)
Q5S3I2 2.18e-23 107 30 7 291 1 ddmA1 Dicamba O-demethylase 1, ferredoxin reductase component Stenotrophomonas maltophilia
B4T3B2 2.44e-23 106 26 9 338 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella newport (strain SL254)
C0PWN3 5.07e-23 105 26 9 338 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi C (strain RKS4594)
Q57KT2 5.07e-23 105 26 9 338 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella choleraesuis (strain SC-B67)
Q5S3I1 5.86e-23 105 30 7 291 1 ddmA2 Dicamba O-demethylase 2, ferredoxin reductase component Stenotrophomonas maltophilia
Q96NN9 6.91e-23 107 28 9 325 1 AIFM3 Apoptosis-inducing factor 3 Homo sapiens
Q8L3B0 8.37e-23 105 24 8 373 1 padH NADH-dependent phenylglyoxylate dehydrogenase subunit epsilon Aromatoleum evansii
A4WDR7 1.29e-22 104 25 9 338 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Enterobacter sp. (strain 638)
Q8U1M0 2.63e-22 104 27 7 331 1 nsr NAD(P)H sulfur oxidoreductase (CoA-dependent) Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P42454 5e-22 102 26 8 329 1 rubB Rubredoxin-NAD(+) reductase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B7NRJ1 5.98e-22 102 26 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1LNJ8 7.74e-22 102 26 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli (strain SMS-3-5 / SECEC)
Q9LK94 1.25e-21 102 30 8 283 1 MDAR4 Monodehydroascorbate reductase 4, peroxisomal Arabidopsis thaliana
P43494 3.16e-21 100 26 5 285 1 thcD Rhodocoxin reductase Rhodococcus erythropolis
B7N6C9 3.62e-21 100 25 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P77650 5.62e-21 99 25 5 285 1 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli (strain K12)
B1IVT5 5.62e-21 99 25 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A348 5.62e-21 99 25 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli O9:H4 (strain HS)
B1XB17 5.62e-21 99 25 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli (strain K12 / DH10B)
C4ZXB7 5.62e-21 99 25 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli (strain K12 / MC4100 / BW2952)
Q5JGP4 5.94e-21 100 25 10 399 1 TK1299 NAD(P)H sulfur oxidoreductase (CoA-dependent) Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9L4M8 6.52e-21 99 29 4 262 3 alkT Rubredoxin-NAD(+) reductase Pseudomonas putida
P17052 7.62e-21 99 29 4 263 1 alkT Rubredoxin-NAD(+) reductase Pseudomonas oleovorans
B6I5B5 9.65e-21 99 25 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli (strain SE11)
B7LDD4 9.65e-21 99 25 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli (strain 55989 / EAEC)
B5Z115 1.55e-20 98 25 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA71 1.55e-20 98 25 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli O157:H7
A7ZPY5 1.61e-20 98 25 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli O139:H28 (strain E24377A / ETEC)
X5CY81 1.65e-20 98 28 10 321 1 cndC1 Chloroacetanilide N-alkylformylase, ferredoxin reductase component Rhizorhabdus wittichii (strain DC-6 / KACC 16600)
Q3YZ11 4.45e-20 97 25 5 285 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Shigella sonnei (strain Ss046)
O58308 6.43e-20 97 27 9 330 1 PH0572 NAD(P)H coenzyme A polysulfide/persulfide reductase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q0S032 9.53e-20 96 26 4 255 1 bphA4 Biphenyl 2,3-dioxygenase, ferredoxin reductase component Rhodococcus jostii (strain RHA1)
P33009 9.92e-20 96 24 6 293 4 terPA Terpredoxin reductase Pseudomonas sp.
Q43497 2.07e-19 95 27 9 310 1 AFRR Monodehydroascorbate reductase Solanum lycopersicum
Q8S3R2 9.08e-19 94 28 7 285 2 MDAR2 Monodehydroascorbate reductase 2, peroxisomal Oryza sativa subsp. japonica
W8X9R5 1.27e-18 92 28 4 284 1 ctmF Probable ferredoxin reductase CtmF Castellaniella defragrans (strain DSM 12143 / CCUG 39792 / 65Phen)
Q7N4V5 2.16e-18 92 24 7 366 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q51973 2.78e-18 91 26 4 282 1 cmtAa p-cumate 2,3-dioxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas putida
G2ITT5 3.29e-18 91 30 7 258 1 ligXd 5,5'-dehydrodivanillate O-demethylase ferredoxin reductase subunit Sphingobium sp. (strain NBRC 103272 / SYK-6)
A0A0H2UQZ4 4.96e-18 91 23 9 343 3 nox NADH oxidase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A2RIB7 5.21e-18 91 25 6 289 1 noxE NADH oxidase Lactococcus lactis subsp. cremoris (strain MG1363)
Q9SR59 9.4e-18 90 28 5 234 2 MDAR3 Monodehydroascorbate reductase 3 Arabidopsis thaliana
Q93WJ8 1.06e-17 90 28 4 231 1 MDAR2 Monodehydroascorbate reductase 2 Arabidopsis thaliana
Q0T1X7 1.5e-17 89 25 7 295 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Shigella flexneri serotype 5b (strain 8401)
O84925 2.84e-17 89 23 9 343 1 nox NADH oxidase Streptococcus pneumoniae
Q8DP70 3.98e-17 88 23 9 343 1 nox NADH oxidase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q5XC60 4.12e-17 88 29 6 199 1 M6_Spy0868 NADH oxidase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q84BZ0 1.09e-16 86 27 10 327 1 andAa Anthranilate 1,2-dioxygenase system ferredoxin--NAD(+) reductase component Burkholderia cepacia
Q9GRX6 1.1e-16 87 25 10 317 2 aif Apoptosis-inducing factor 1, mitochondrial Dictyostelium discoideum
Q40977 1.78e-16 86 25 9 307 1 None Monodehydroascorbate reductase Pisum sativum
Q652L6 2.36e-16 86 27 5 235 1 MDAR3 Monodehydroascorbate reductase 3, cytosolic Oryza sativa subsp. japonica
Q6ZJ08 4.65e-16 85 26 4 231 1 MDAR4 Monodehydroascorbate reductase 4, cytosolic Oryza sativa subsp. japonica
Q42711 1.65e-15 83 29 5 231 2 None Monodehydroascorbate reductase, seedling isozyme Cucumis sativus
O95831 4.75e-15 82 25 11 289 1 AIFM1 Apoptosis-inducing factor 1, mitochondrial Homo sapiens
Q49WB0 6.81e-15 81 25 10 291 3 cdr Coenzyme A disulfide reductase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4L4Y7 1.16e-14 80 24 12 376 3 cdr Coenzyme A disulfide reductase Staphylococcus haemolyticus (strain JCSC1435)
P92947 1.48e-14 80 27 7 235 1 MDAR5 Monodehydroascorbate reductase, chloroplastic/mitochondrial Arabidopsis thaliana
Q9Z0X1 1.64e-14 81 25 11 289 1 Aifm1 Apoptosis-inducing factor 1, mitochondrial Mus musculus
Q54465 3.56e-14 80 29 8 251 3 merA Mercuric reductase Shewanella putrefaciens
Q9JM53 4.62e-14 79 25 11 289 1 Aifm1 Apoptosis-inducing factor 1, mitochondrial Rattus norvegicus
P37061 1.07e-13 77 26 6 290 1 nox NADH oxidase Enterococcus faecalis (strain ATCC 700802 / V583)
Q84PW3 1.42e-13 77 26 4 226 2 MDAR5 Monodehydroascorbate reductase 5, chlorplastic Oryza sativa subsp. japonica
D5IGG6 1.81e-13 77 26 6 288 1 fdr Ferredoxin--NAD(P)(+) reductase fdr Sphingomonas sp.
P0A0E7 2.35e-13 77 25 21 433 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain MW2)
P0A0E8 2.35e-13 77 25 21 433 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus
Q6GAB8 2.35e-13 77 25 21 433 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain MSSA476)
Q6GHY9 2.35e-13 77 25 21 433 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain MRSA252)
P99084 2.35e-13 77 25 21 433 1 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain N315)
P0A0E6 2.35e-13 77 25 21 433 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY8 2.35e-13 77 25 21 433 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain COL)
Q9LFA3 2.98e-13 76 26 9 313 1 MDAR1 Monodehydroascorbate reductase 1, peroxisomal Arabidopsis thaliana
Q8S3R1 1.29e-12 74 28 4 230 2 MDAR1 Monodehydroascorbate reductase 1, peroxisomal Oryza sativa subsp. japonica
Q2YWW1 1.53e-12 74 22 9 331 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q87KN5 1.84e-12 74 26 7 226 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B7MR55 1.85e-12 74 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O81 (strain ED1a)
Q5HHB4 1.91e-12 73 22 10 355 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain COL)
Q8NTE1 2.16e-12 73 28 7 232 1 lpd Dihydrolipoyl dehydrogenase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A5IRE8 2.24e-12 73 22 9 324 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain JH9)
A6U077 2.24e-12 73 22 9 324 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain JH1)
O52582 3.34e-12 73 21 9 331 1 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain NCTC 8325 / PS 47)
P37062 3.5e-12 73 27 7 224 1 npr NADH peroxidase Enterococcus faecalis (strain ATCC 700802 / V583)
C0Q478 3.91e-12 73 26 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi C (strain RKS4594)
Q57H91 3.91e-12 73 26 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella choleraesuis (strain SC-B67)
Q7A6H1 3.95e-12 72 22 9 331 1 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain N315)
Q99VC0 3.95e-12 72 22 9 331 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X0I7 3.95e-12 72 22 9 331 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain Mu3 / ATCC 700698)
B2TWF7 4.62e-12 72 27 9 254 3 sthA Soluble pyridine nucleotide transhydrogenase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q83MI1 4.87e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Shigella flexneri
A8Z076 5.05e-12 72 21 9 331 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain USA300 / TCH1516)
A6QFI1 5.05e-12 72 21 9 331 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain Newman)
Q2FIA5 5.05e-12 72 21 9 331 1 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain USA300)
A8AKW0 5.32e-12 72 25 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q5E212 5.6e-12 72 24 9 268 3 sthA Soluble pyridine nucleotide transhydrogenase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8NXE8 6.52e-12 72 21 9 331 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain MW2)
Q6GAV6 6.52e-12 72 21 9 331 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain MSSA476)
P21880 6.66e-12 72 25 11 290 3 pdhD Dihydrolipoyl dehydrogenase Bacillus subtilis (strain 168)
B1LNS2 7.1e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain SMS-3-5 / SECEC)
Q8FB93 7.1e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7LUN3 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R3U7 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain UTI89 / UPEC)
B6I5I0 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain SE11)
B7NFR2 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P27306 7.35e-12 72 25 8 257 1 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain K12)
A1AIE2 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O1:K1 / APEC
B1XBX3 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain K12 / DH10B)
C5A0R1 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M718 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O8 (strain IAI1)
B7NU38 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z064 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O157:H7 (strain EC4115 / EHEC)
B7LA64 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain 55989 / EAEC)
B7MIA0 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZUI2 7.35e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8X727 8.03e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O157:H7
Q0TA96 8.1e-12 72 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B5REZ6 9.08e-12 72 26 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella gallinarum (strain 287/91 / NCTC 13346)
P66008 9.32e-12 72 26 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66009 9.32e-12 72 26 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella typhi
B5BJN6 9.32e-12 72 26 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi A (strain AKU_12601)
A9N0H2 9.32e-12 72 26 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PK71 9.32e-12 72 26 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5QXQ7 9.32e-12 72 26 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella enteritidis PT4 (strain P125109)
B1IVB6 1.1e-11 71 24 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A770 1.1e-11 71 24 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O9:H4 (strain HS)
B7UNU0 1.31e-11 71 25 8 257 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q7MBG9 1.37e-11 71 23 8 249 3 sthA Soluble pyridine nucleotide transhydrogenase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B2VGA0 1.39e-11 71 24 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4WG49 1.72e-11 71 24 9 257 3 sthA Soluble pyridine nucleotide transhydrogenase Enterobacter sp. (strain 638)
Q6GIB7 2.03e-11 70 21 9 331 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain MRSA252)
A6TGE6 2.1e-11 70 25 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XZ14 2.26e-11 70 25 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Klebsiella pneumoniae (strain 342)
Q8KCW2 3.89e-11 70 27 6 219 3 lpd Dihydrolipoyl dehydrogenase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B7VM91 6.45e-11 69 24 9 264 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio atlanticus (strain LGP32)
P14218 6.47e-11 69 32 11 206 1 lpd Dihydrolipoyl dehydrogenase Pseudomonas fluorescens
P11959 7.52e-11 68 24 10 252 1 pdhD Dihydrolipoyl dehydrogenase Geobacillus stearothermophilus
P85207 1.36e-10 68 31 9 225 1 lpd Dihydrolipoyl dehydrogenase Thermus scotoductus (strain ATCC 700910 / SA-01)
Q9I3D1 1.51e-10 68 32 11 206 1 lpdG Dihydrolipoyl dehydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q58280 1.88e-10 68 34 2 135 1 fsr Coenzyme F420-dependent sulfite reductase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q873E8 4.93e-10 66 26 11 254 3 gtr-1 Glutathione reductase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q6LLT9 5.39e-10 66 24 7 226 3 sthA Soluble pyridine nucleotide transhydrogenase Photobacterium profundum (strain SS9)
Q8CPT6 6.04e-10 66 21 10 321 3 cdr Coenzyme A disulfide reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQI9 6.04e-10 66 21 10 321 3 cdr Coenzyme A disulfide reductase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P23189 7.71e-10 65 23 6 217 3 gor Glutathione reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I1L9 8.08e-10 65 27 9 263 1 lpdV Dihydrolipoyl dehydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P31052 1.02e-09 65 31 9 193 1 lpdG Dihydrolipoyl dehydrogenase Pseudomonas putida
P17239 1.12e-09 65 28 8 197 1 merA Mercuric reductase Acidithiobacillus ferrooxidans
P43783 1.18e-09 65 26 10 257 3 gor Glutathione reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C3LPZ2 1.2e-09 65 23 10 278 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio cholerae serotype O1 (strain M66-2)
P50529 1.2e-09 65 23 10 278 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4K5 1.2e-09 65 23 10 278 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q51772 1.51e-09 65 30 9 200 3 merA Mercuric reductase Pseudomonas fluorescens
Q48A14 1.74e-09 64 23 12 290 3 sthA Soluble pyridine nucleotide transhydrogenase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P43784 2.13e-09 64 29 9 223 3 lpdA Dihydrolipoyl dehydrogenase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P00393 2.46e-09 63 30 7 184 1 ndh Type II NADH:quinone oxidoreductase Escherichia coli (strain K12)
P43504 2.86e-09 60 37 1 85 3 NIIA Nitrite reductase [NAD(P)H] (Fragment) Leptosphaeria maculans
D0VWY5 3.34e-09 63 27 8 213 1 garB Glutathione amide reductase Marichromatium gracile
A1U1Y5 4.82e-09 63 23 8 252 3 sthA Soluble pyridine nucleotide transhydrogenase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
P9WHH5 6.06e-09 63 27 6 215 1 sthA Probable soluble pyridine nucleotide transhydrogenase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH4 6.06e-09 63 27 6 215 3 sthA Probable soluble pyridine nucleotide transhydrogenase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U665 6.06e-09 63 27 6 215 3 sthA Soluble pyridine nucleotide transhydrogenase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AFH2 6.06e-09 63 27 6 215 3 sthA Soluble pyridine nucleotide transhydrogenase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KM51 6.06e-09 63 27 6 215 3 sthA Soluble pyridine nucleotide transhydrogenase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P66007 6.06e-09 63 27 6 215 3 sthA Probable soluble pyridine nucleotide transhydrogenase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P42770 1.12e-08 62 26 8 217 2 EMB2360 Glutathione reductase, chloroplastic Arabidopsis thaliana
P94702 1.21e-08 62 29 9 200 3 merA Mercuric reductase Enterobacter agglomerans
A1JI37 1.3e-08 62 22 8 290 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A6VW16 1.5e-08 61 27 6 209 3 sthA Soluble pyridine nucleotide transhydrogenase Marinomonas sp. (strain MWYL1)
Q7MQ83 1.57e-08 61 25 7 226 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio vulnificus (strain YJ016)
Q8DD46 1.57e-08 61 25 7 226 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio vulnificus (strain CMCP6)
A8GL77 1.61e-08 61 23 7 252 3 sthA Soluble pyridine nucleotide transhydrogenase Serratia proteamaculans (strain 568)
D9J041 1.75e-08 61 27 6 191 1 merA Mercuric reductase Lysinibacillus sphaericus
P00392 2.66e-08 61 29 8 188 1 merA Mercuric reductase Pseudomonas aeruginosa
P52992 2.89e-08 60 29 8 192 3 odhL Dihydrolipoyl dehydrogenase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9VQ79 3.2e-08 61 25 5 229 2 AIF Putative apoptosis-inducing factor 1, mitochondrial Drosophila melanogaster
Q56839 4.07e-08 60 25 7 207 1 xecC 2-oxopropyl-CoM reductase, carboxylating Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
P31046 4.12e-08 60 30 7 185 1 lpd3 Dihydrolipoyl dehydrogenase 3 Pseudomonas putida
B1JQ50 4.66e-08 60 22 7 253 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G61 4.66e-08 60 22 7 253 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRG4 4.66e-08 60 22 7 253 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis (strain Pestoides F)
Q1CNP4 4.66e-08 60 22 7 253 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6N5 4.66e-08 60 22 7 253 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZA97 4.66e-08 60 22 7 253 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis
B2JZF3 4.66e-08 60 22 7 253 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBU5 4.66e-08 60 22 7 253 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD10 4.66e-08 60 22 7 253 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P39051 4.71e-08 60 25 6 185 1 TPR Trypanothione reductase Trypanosoma brucei brucei
P08332 5.14e-08 60 28 8 198 3 merA Mercuric reductase Shigella flexneri
G0SB20 5.25e-08 60 26 4 183 1 CTHT_0048590 Dihydrolipoamide dehydrogenase Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
P16171 5.78e-08 60 23 6 256 1 merA Mercuric reductase Bacillus cereus
P80461 6.65e-08 60 25 10 247 1 GOR Glutathione reductase, chloroplastic (Fragment) Nicotiana tabacum
B5FXE5 7.8e-08 58 26 8 258 2 AIFM2 Ferroptosis suppressor protein 1 Taeniopygia guttata
P27456 8.34e-08 59 25 16 363 2 GR Glutathione reductase, chloroplastic/mitochondrial Pisum sativum
P57303 1.14e-07 58 24 9 274 3 lpdA Dihydrolipoyl dehydrogenase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q1QX78 1.38e-07 58 25 7 215 3 sthA Soluble pyridine nucleotide transhydrogenase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B4F1H1 1.67e-07 58 23 8 245 3 sthA Soluble pyridine nucleotide transhydrogenase Proteus mirabilis (strain HI4320)
Q2NQZ3 1.91e-07 58 23 8 255 3 sthA Soluble pyridine nucleotide transhydrogenase Sodalis glossinidius (strain morsitans)
P94188 1.94e-07 58 27 8 200 3 merA Mercuric reductase Alcaligenes sp.
Q52109 2e-07 58 26 8 202 3 merA Mercuric reductase Acinetobacter calcoaceticus
O50286 2.69e-07 57 24 11 305 3 lpd Dihydrolipoyl dehydrogenase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P09063 2.77e-07 57 25 11 264 1 lpdV Dihydrolipoyl dehydrogenase Pseudomonas putida
Q1I7F0 3.33e-07 57 25 6 184 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas entomophila (strain L48)
P57112 3.36e-07 57 22 9 253 1 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02PF5 3.36e-07 57 22 9 253 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UZU5 3.36e-07 57 22 9 253 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain LESB58)
Q50068 3.56e-07 57 24 10 285 3 lpd Dihydrolipoyl dehydrogenase Mycobacterium leprae (strain TN)
A6V3A6 4.14e-07 57 22 9 253 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain PA7)
P0A0E4 4.19e-07 57 22 4 209 3 merA Mercuric reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P0A0E5 4.19e-07 57 22 4 209 3 merA Mercuric reductase Staphylococcus aureus
O50311 4.32e-07 57 24 7 221 3 lpd Dihydrolipoyl dehydrogenase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q9KPF6 4.41e-07 57 28 11 228 3 lpd Dihydrolipoyl dehydrogenase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B1J606 4.51e-07 57 24 6 184 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain W619)
Q88KY8 4.88e-07 57 21 7 225 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W6F5 4.88e-07 57 21 7 225 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
C4K3I8 6.77e-07 56 23 10 263 3 sthA Soluble pyridine nucleotide transhydrogenase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q9XBQ9 7.14e-07 56 23 7 225 1 sthA Soluble pyridine nucleotide transhydrogenase Azotobacter vinelandii
C1DR10 7.14e-07 56 23 7 225 3 sthA Soluble pyridine nucleotide transhydrogenase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B0KH90 8e-07 56 21 7 225 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain GB-1)
Q54EW8 9.03e-07 56 26 6 204 3 lpd Dihydrolipoyl dehydrogenase, mitochondrial Dictyostelium discoideum
Q9HN74 1.47e-06 55 27 8 204 3 lpdA Dihydrolipoyl dehydrogenase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q60151 1.71e-06 55 26 8 188 3 gor Glutathione reductase Streptococcus thermophilus
Q4KFA6 1.74e-06 55 24 6 184 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P18925 1.75e-06 55 27 7 195 1 None Dihydrolipoyl dehydrogenase Azotobacter vinelandii
P06715 1.9e-06 55 24 12 267 1 gor Glutathione reductase Escherichia coli (strain K12)
P9WHH3 2.06e-06 55 27 8 200 1 mtr Mycothione reductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH2 2.06e-06 55 27 8 200 3 mtr Mycothione reductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P39040 2.08e-06 55 24 7 189 1 TPR Trypanothione reductase Crithidia fasciculata
Q6CZB1 2.24e-06 54 22 7 250 3 sthA Soluble pyridine nucleotide transhydrogenase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O34324 2.38e-06 54 25 7 226 3 acoL Dihydrolipoyl dehydrogenase Bacillus subtilis (strain 168)
Q9HUY1 2.4e-06 54 28 7 187 3 lpd3 Dihydrolipoyl dehydrogenase 3 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O18480 2.45e-06 54 24 6 233 2 None Dihydrolipoyl dehydrogenase Manduca sexta
Q2SIP2 2.81e-06 54 26 7 195 3 sthA Soluble pyridine nucleotide transhydrogenase Hahella chejuensis (strain KCTC 2396)
A4XSQ1 2.86e-06 54 25 6 185 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas mendocina (strain ymp)
Q48KI8 3.17e-06 54 23 7 209 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZV77 3.23e-06 54 23 7 209 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas syringae pv. syringae (strain B728a)
Q74ZK4 3.35e-06 54 22 10 338 3 GLR1 Glutathione reductase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q884I6 3.52e-06 54 23 7 209 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P13110 4.42e-06 53 24 8 212 1 TPR Trypanothione reductase Trypanosoma congolense
P48640 4.57e-06 53 25 9 245 2 GR Glutathione reductase, chloroplastic Glycine max
P39050 4.65e-06 53 25 6 202 3 TPR Trypanothione reductase Leishmania donovani
Q04829 5.77e-06 53 25 15 312 1 lpdA Dihydrolipoyl dehydrogenase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q94655 6.1e-06 53 23 6 181 1 GR Glutathione reductase Plasmodium falciparum (isolate K1 / Thailand)
Q7NBE9 8e-06 52 26 11 248 3 MYCGA3300 Ferredoxin--NADP reductase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q43154 9.99e-06 52 26 6 183 2 None Glutathione reductase, chloroplastic (Fragment) Spinacia oleracea
P48639 1.06e-05 52 25 8 200 3 gor Glutathione reductase Burkholderia cepacia
O15770 1.09e-05 52 23 6 181 1 GR Glutathione reductase Plasmodium falciparum (isolate 3D7)
P75389 1.16e-05 52 21 10 286 3 nox NADH oxidase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q6FRV2 1.29e-05 52 21 7 223 3 GLR1 Glutathione reductase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P90597 1.29e-05 52 29 6 191 1 LPD Dihydrolipoyl dehydrogenase Trypanosoma cruzi
Q57971 1.34e-05 51 28 6 173 3 MJ0551 Uncharacterized protein MJ0551 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q2UPB4 1.6e-05 51 27 11 262 3 aclT Thioredoxin reductase aclT Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A4VMU6 1.69e-05 52 23 7 209 3 sthA Soluble pyridine nucleotide transhydrogenase Stutzerimonas stutzeri (strain A1501)
Q3TMV7 1.97e-05 52 25 6 194 2 Pyroxd1 Pyridine nucleotide-disulfide oxidoreductase domain-containing protein 1 Mus musculus
Q93379 2.29e-05 51 24 6 204 1 gsr-1 Glutathione reductase, mitochondrial Caenorhabditis elegans
P28593 2.3e-05 51 21 5 186 1 TPR Trypanothione reductase Trypanosoma cruzi
P0A9P3 2.64e-05 51 27 11 249 3 lpdA Dihydrolipoyl dehydrogenase Shigella flexneri
P0A9P0 2.64e-05 51 27 11 249 1 lpdA Dihydrolipoyl dehydrogenase Escherichia coli (strain K12)
P0A9P1 2.64e-05 51 27 11 249 3 lpdA Dihydrolipoyl dehydrogenase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9P2 2.64e-05 51 27 11 249 3 lpdA Dihydrolipoyl dehydrogenase Escherichia coli O157:H7
O06465 2.79e-05 51 27 5 169 3 ahpF Alkyl hydroperoxide reductase subunit F Xanthomonas campestris pv. phaseoli
O05139 3.23e-05 51 23 6 184 1 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens
Q9PJI3 3.43e-05 50 25 5 218 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia muridarum (strain MoPn / Nigg)
C3K4W1 3.52e-05 50 23 6 184 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens (strain SBW25)
Q60HG3 3.81e-05 50 23 6 222 2 DLD Dihydrolipoyl dehydrogenase, mitochondrial Macaca fascicularis
A0AL74 4.24e-05 50 22 9 244 3 lwe2338 Ferredoxin--NADP reductase 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q3K9F5 5.1e-05 50 23 6 184 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens (strain Pf0-1)
P09622 5.24e-05 50 22 6 222 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial Homo sapiens
P30341 6e-05 50 27 7 217 2 merA Mercuric reductase Streptomyces lividans
O08749 6.39e-05 50 21 6 239 1 Dld Dihydrolipoyl dehydrogenase, mitochondrial Mus musculus
A7YVH9 7.79e-05 50 28 8 185 2 PYROXD1 Pyridine nucleotide-disulfide oxidoreductase domain-containing protein 1 Bos taurus
Q5R4B1 9.74e-05 49 22 6 222 2 DLD Dihydrolipoyl dehydrogenase, mitochondrial Pongo abelii
F1N206 0.000109 49 22 6 222 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial Bos taurus
P72740 0.000111 49 22 8 315 1 lpdA Dihydrolipoyl dehydrogenase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A4VXW3 0.000126 48 26 12 253 3 SSU05_1986 Ferredoxin--NADP reductase Streptococcus suis (strain 05ZYH33)
A4W460 0.000126 48 26 12 253 3 SSU98_1991 Ferredoxin--NADP reductase Streptococcus suis (strain 98HAH33)
P49819 0.000126 49 22 6 222 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial Canis lupus familiaris
Q99MD6 0.000159 49 29 11 207 1 Txnrd3 Thioredoxin reductase 3 Mus musculus
P31023 0.000169 48 27 3 148 1 LPD Dihydrolipoyl dehydrogenase, mitochondrial Pisum sativum
Q41219 0.00017 48 27 3 148 1 FLBR Leghemoglobin reductase Glycine max
O17953 0.000175 48 24 5 191 3 dld-1 Dihydrolipoyl dehydrogenase, mitochondrial Caenorhabditis elegans
P48642 0.000178 48 26 5 142 2 GRC2 Glutathione reductase, cytosolic Oryza sativa subsp. japonica
Q8CIZ7 0.000224 48 22 5 222 2 DLD Dihydrolipoyl dehydrogenase, mitochondrial Cricetulus griseus
Q9HY80 0.000226 43 38 0 54 1 bfd Bacterioferritin-associated ferredoxin Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6HA23 0.00024 48 23 9 224 1 GLR1 Glutathione reductase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q8Y4P5 0.00025 47 22 9 244 3 lmo2390 Ferredoxin--NADP reductase 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6C5H4 0.000254 48 24 9 218 3 GLR1 Glutathione reductase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q9M5K2 0.000268 48 27 5 146 1 LPD2 Dihydrolipoyl dehydrogenase 2, mitochondrial Arabidopsis thaliana
Q43621 0.000313 48 22 5 183 2 None Glutathione reductase, cytosolic Pisum sativum
B4U394 0.000319 47 22 8 246 3 Sez_1109 Ferredoxin--NADP reductase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q811C4 0.000325 47 22 5 222 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial (Fragment) Mesocricetus auratus
Q6BPI1 0.000335 47 20 8 270 3 GLR1 Glutathione reductase Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9M5K3 0.00035 47 27 4 145 1 LPD1 Dihydrolipoyl dehydrogenase 1, mitochondrial Arabidopsis thaliana
P78965 0.000378 47 23 9 211 1 pgr1 Glutathione reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
I3R637 0.000386 47 22 8 265 1 nasD Assimilatory ferredoxin-dependent nitrite reductase Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
P0A156 0.000391 47 29 7 173 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas putida
P0A155 0.000391 47 29 7 173 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9SPB1 0.000395 47 28 4 147 1 FLBR Leghemoglobin reductase Vigna unguiculata
Q06457 0.000413 47 45 1 51 2 nasA Nitrate reductase Klebsiella oxytoca
Q9VIP2 0.000439 47 21 17 395 2 Pyroxd1 Pyridine nucleotide-disulfide oxidoreductase domain-containing protein 1 Drosophila melanogaster
B4F6I3 0.000581 47 26 10 258 2 aifm2 Ferroptosis suppressor protein 1 Xenopus tropicalis
Q04933 0.000694 47 29 5 183 3 None Dihydrolipoyl dehydrogenase Trypanosoma brucei brucei
Q71X35 0.000706 46 22 9 244 3 LMOf2365_2364 Ferredoxin--NADP reductase 2 Listeria monocytogenes serotype 4b (strain F2365)
Q5REJ2 0.000742 46 24 6 186 2 PYROXD1 Pyridine nucleotide-disulfide oxidoreductase domain-containing protein 1 Pongo abelii
O84561 0.000769 46 24 7 222 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
O05940 0.000819 46 22 5 183 3 lpdA Dihydrolipoyl dehydrogenase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P48641 0.000843 46 24 7 207 1 At3g24170 Glutathione reductase, cytosolic Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_08620
Feature type CDS
Gene nirB
Product NAD(P)H-nitrite reductase, large subunit
Location 148541 - 151081 (strand: 1)
Length 2541 (nucleotides) / 846 (amino acids)

Contig

Accession ZDB_685
Length 192328 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1270
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01077 Nitrite and sulphite reductase 4Fe-4S domain
PF03460 Nitrite/Sulfite reductase ferredoxin-like half domain
PF04324 BFD-like [2Fe-2S] binding domain
PF07992 Pyridine nucleotide-disulphide oxidoreductase
PF18267 Rubredoxin NAD+ reductase C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1251 Energy production and conversion (C) C NAD(P)H-nitrite reductase, large subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MSNVKLAIIGNGMVGHRFTEELTDKADAGQFDITVFCEEPRVAYDRVHLSSYFSHHTAEELSLVKPGFYEKHNISVLINERVITVNRQEKVLHTNTGRTVHYDKLVIATGSYPWIPPIKGSDTRDCFVYRTIEDLNAIEACARHSRKGVVIGGGLLGLEAAGALKNLGIETHVIEFSPVLMAEQLDTLGGEQLKQKIERMGVTVHTGKNTTEITASGSGESRKVLHFADGSSLETDFVVFSTGIRPRDRLARQCGLAVAERGGLVINDQCQTSDPDVYAIGECASWHGRTYGLVAPGYKMAQVAADHLLGQENQFTGADMSAKLKLLGVDVGGIGNTHATDDGCHSYIYLDEANEVYKRLIVSDDNKYLLGAVLVGDTEDYGNLLQLALNRIELPENPDVLILPAHAGSKPAIGVESLPDSAQICSCFDVTKGDIIQAIHNGCQTVAEIKAETKAGTGCGGCVPLITQVLNAELTNLGIEVNHHLCEHFAYSRQELYHLIRVEKITTFDELLGRYGEGYGCEVCKPTIGSLLASCRNDYILRDDLVPLQDTNDNFLANMQKDGTYSVIPRSPGGEITPEGLLAIGTVAQEYNLYTKITGSQRIAMFGAQKQDLPAIWEKLIAAGFETGHAYAKALRMAKTCVGTAWCRFGVGDSTALGVELEHRYKGIRTPHKMKFGISGCTRECSEAQGKDIGIIATDKGWNLYVCGNGGMKPRHGDLLMADLDKETLIRYIDRFMMFYIRTADKLSRTSTWLESLEGGIDYLRDVIVSDKLGLNAQLEQELAQLREKVTCEWQETVNNPHARKRFSHFVNSPLPDPNVQMVSERLQHRPARPEERIAVTLIGEE

Flanking regions ( +/- flanking 50bp)

CCGGGATCGCCGTATTTTTAGCCTTAATCCACACAAAATCTGAGGCTGAAATGAGCAACGTCAAGTTAGCAATCATCGGTAACGGTATGGTCGGCCACCGCTTTACCGAAGAGCTTACCGATAAAGCGGACGCCGGACAGTTCGATATCACCGTATTCTGCGAAGAGCCGCGTGTCGCTTATGACCGCGTGCATCTCTCCTCCTATTTTTCTCATCATACGGCGGAAGAATTATCCCTGGTTAAACCCGGTTTCTATGAAAAACACAATATTTCGGTATTAATCAATGAACGGGTGATTACCGTTAACCGTCAGGAAAAGGTGCTGCATACCAATACCGGCCGCACTGTGCATTACGACAAGCTGGTGATTGCGACCGGCTCTTATCCGTGGATCCCGCCGATCAAAGGCAGTGATACCCGCGACTGTTTTGTTTACCGGACGATTGAAGATCTCAATGCCATTGAAGCCTGCGCCCGCCACAGCCGCAAAGGTGTGGTGATCGGCGGTGGTCTGCTGGGGCTGGAAGCCGCCGGGGCCCTGAAAAACCTGGGTATTGAAACCCATGTTATTGAATTTTCGCCAGTCCTGATGGCGGAACAGCTCGATACGCTCGGCGGTGAACAGCTGAAGCAGAAAATTGAACGGATGGGTGTAACGGTACATACCGGCAAAAACACCACGGAAATTACCGCATCCGGCAGCGGAGAGAGCCGCAAAGTGCTGCATTTTGCCGACGGTTCATCGCTGGAGACCGATTTTGTCGTCTTTTCCACCGGGATCCGCCCGCGTGACCGGCTTGCCCGTCAGTGCGGACTGGCCGTGGCGGAGCGCGGCGGTCTGGTGATTAATGACCAGTGTCAGACATCTGACCCGGATGTGTATGCTATCGGGGAATGCGCGTCATGGCACGGCAGAACTTACGGACTGGTGGCACCGGGCTACAAAATGGCACAGGTGGCAGCTGATCATCTGCTGGGGCAGGAGAATCAGTTTACCGGTGCGGATATGAGCGCAAAACTGAAACTGCTGGGTGTGGATGTCGGTGGTATCGGCAATACACATGCGACAGACGACGGCTGCCACAGTTATATTTATCTCGATGAAGCCAATGAGGTTTATAAGCGGCTGATTGTCAGCGACGATAATAAATATCTGCTGGGTGCGGTACTGGTCGGGGATACCGAAGATTACGGTAATCTGCTGCAACTGGCACTGAACCGTATCGAACTGCCGGAAAATCCGGATGTTCTGATCCTCCCGGCACACGCCGGCAGCAAACCGGCGATCGGCGTGGAATCCCTGCCGGACAGTGCACAAATCTGTTCCTGTTTTGATGTCACCAAAGGAGACATTATTCAGGCCATTCATAACGGTTGCCAGACGGTTGCGGAGATCAAAGCGGAAACCAAAGCCGGTACCGGCTGCGGCGGGTGTGTTCCGCTGATCACTCAGGTGCTGAATGCAGAACTGACTAATCTGGGTATTGAGGTGAATCATCACCTCTGCGAGCATTTTGCCTACTCCCGCCAGGAGCTGTATCACCTGATCCGCGTGGAAAAAATCACTACCTTTGATGAGCTGCTGGGCCGCTACGGCGAAGGTTACGGCTGTGAAGTATGTAAACCGACCATCGGCTCCCTGCTCGCGTCCTGCCGGAATGACTATATTCTGCGCGACGACCTGGTACCGTTACAGGATACCAACGATAACTTCCTCGCTAATATGCAGAAGGACGGCACCTATTCGGTGATCCCGCGCTCACCGGGCGGCGAAATCACCCCGGAAGGTCTGCTGGCTATCGGTACAGTTGCGCAGGAATACAATCTGTATACCAAAATTACCGGCTCACAGCGCATTGCCATGTTCGGGGCGCAAAAGCAGGATTTACCGGCTATCTGGGAAAAACTGATCGCCGCCGGATTTGAAACCGGGCACGCCTATGCCAAAGCACTGCGGATGGCGAAAACCTGTGTCGGCACGGCATGGTGCCGGTTCGGGGTCGGTGACAGCACCGCGCTGGGCGTTGAGCTGGAACACCGTTATAAAGGTATCCGCACCCCGCATAAAATGAAATTCGGCATCTCGGGCTGCACTCGCGAGTGCTCGGAGGCGCAGGGGAAAGATATCGGGATTATCGCCACCGACAAGGGCTGGAACCTGTATGTCTGCGGAAACGGCGGCATGAAACCGCGCCACGGCGATCTGCTGATGGCTGACCTTGATAAAGAGACCCTGATACGCTACATCGACCGCTTTATGATGTTTTACATCCGCACCGCCGACAAACTCAGCCGGACATCCACCTGGCTGGAAAGCCTTGAGGGCGGGATTGATTACCTGCGGGATGTGATTGTCAGTGACAAGCTGGGGCTCAATGCACAACTGGAACAGGAACTGGCGCAGTTACGCGAAAAAGTAACCTGCGAGTGGCAGGAAACGGTGAACAACCCGCATGCCCGCAAACGCTTCAGCCATTTTGTTAACAGCCCGCTGCCGGATCCGAATGTGCAAATGGTAAGTGAGCGCTTACAACATCGTCCGGCCCGTCCGGAAGAGCGGATTGCTGTAACTCTGATCGGGGAGGAATAATCATGAGTCAATGGATTACGGTTTGTCAGGTCAGTGATATCACCCCGGGA