Homologs in group_912

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04920 FBDBKF_04920 100.0 Morganella morganii S1 arsR DNA-binding transcriptional regulator, ArsR family
EHELCC_06210 EHELCC_06210 100.0 Morganella morganii S2 arsR DNA-binding transcriptional regulator, ArsR family
NLDBIP_06530 NLDBIP_06530 100.0 Morganella morganii S4 arsR DNA-binding transcriptional regulator, ArsR family
LHKJJB_03410 LHKJJB_03410 100.0 Morganella morganii S3 arsR DNA-binding transcriptional regulator, ArsR family
F4V73_RS04900 F4V73_RS04900 75.7 Morganella psychrotolerans - metalloregulator ArsR/SmtB family transcription factor
PMI_RS10605 PMI_RS10605 90.1 Proteus mirabilis HI4320 - metalloregulator ArsR/SmtB family transcription factor

Distribution of the homologs in the orthogroup group_912

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_912

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37309 5.21e-39 129 63 0 98 3 arsR Arsenical resistance operon repressor Escherichia coli (strain K12)
P52144 9.91e-38 126 61 0 99 4 arsR Arsenical resistance operon repressor Escherichia coli
P15905 1.6e-36 123 57 0 102 4 arsR Arsenical resistance operon repressor Escherichia coli
Q88JD1 1.96e-27 100 50 0 93 1 arsR2 Arsenic resistance transcriptional regulator ArsR2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88LK1 4.28e-25 94 46 1 103 1 arsR1 Arsenic resistance transcriptional regulator ArsR1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q58721 1.17e-11 59 40 0 66 4 MJ1325 Uncharacterized HTH-type transcriptional regulator MJ1325 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q56405 1.18e-11 60 43 0 67 3 cadC Cadmium resistance transcriptional regulatory protein CadC Listeria monocytogenes
P37374 1.3e-10 57 34 1 86 4 cadC Cadmium resistance transcriptional regulatory protein CadC homolog Staphylococcus aureus
Q01256 1.43e-10 56 31 1 96 4 arsR Arsenical resistance operon repressor Staphylococcus xylosus
P0A4U2 3.52e-10 56 46 0 63 3 cadC Cadmium resistance transcriptional regulatory protein CadC Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P0A4U3 3.52e-10 56 46 0 63 3 cadC Cadmium resistance transcriptional regulatory protein CadC Lactococcus lactis subsp. lactis
P45949 1.4e-09 54 38 0 68 1 arsR Arsenical resistance operon repressor Bacillus subtilis (strain 168)
P96677 8.39e-09 52 36 1 66 1 aseR HTH-type transcriptional repressor AseR Bacillus subtilis (strain 168)
O32242 1.08e-08 51 33 1 71 2 sdpR Transcriptional repressor SdpR Bacillus subtilis (strain 168)
P30338 1.09e-08 52 32 1 94 4 arsR Arsenical resistance operon repressor Staphylococcus aureus
P30339 5.11e-07 48 30 0 78 3 cadC Cadmium resistance transcriptional regulatory protein CadC Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
O52029 4.14e-06 45 36 1 65 2 arsR Putative arsenical resistance operon repressor ArsR Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P9WMI5 4.5e-06 45 35 1 67 1 smtB HTH-type transcriptional repressor SmtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMI4 4.5e-06 45 35 1 67 3 smtB HTH-type transcriptional repressor SmtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O52026 6.45e-06 45 31 1 66 2 arsR2 Putative arsenical resistance operon repressor ArsR2 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P20047 1.14e-05 44 32 0 77 1 cadC Cadmium resistance transcriptional regulatory protein CadC Staphylococcus aureus
C0H3S9 1.56e-05 43 28 1 83 4 ybzH Uncharacterized HTH-type transcriptional regulator YbzH Bacillus subtilis (strain 168)
Q8UAA8 2.93e-05 43 34 1 66 1 bigR Biofilm growth-associated repressor Agrobacterium fabrum (strain C58 / ATCC 33970)
Q55940 3.48e-05 43 35 1 67 1 ziaR Transcriptional repressor SmtB homolog Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q87AD5 3.55e-05 43 34 1 72 3 bigR Biofilm growth-associated repressor Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P52695 3.75e-05 42 35 2 81 1 hlyU Transcriptional activator HlyU Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9PFB1 4.16e-05 42 34 1 72 1 bigR Biofilm growth-associated repressor Xylella fastidiosa (strain 9a5c)
O53478 0.000432 40 30 1 97 1 Rv2034 HTH-type transcriptional regulator Rv2034 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_06885
Feature type CDS
Gene arsR
Product DNA-binding transcriptional regulator, ArsR family
Location 191898 - 192233 (strand: -1)
Length 336 (nucleotides) / 111 (amino acids)

Contig

Accession ZDB_683
Length 224720 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_912
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01022 Bacterial regulatory protein, arsR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0640 Transcription (K) K DNA-binding transcriptional regulator, ArsR family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03892 ArsR family transcriptional regulator, arsenate/arsenite/antimonite-responsive transcriptional repressor - -

Protein Sequence

MEPLQLFKILGDQTRLDIVLLLKASGELCVCDIYTALNLSQPKTSRHLAMLRESGLLLDSKHGKWVHYRLSPALLPWVKSIIDVTYATEKNRVADLLKSLETKEPVSRCSV

Flanking regions ( +/- flanking 50bp)

ACGCATGTGTTTTTTAGAGGTAATTTTAAAAAAAGATTAAAGAGGTACACATGGAACCATTACAACTGTTTAAAATTTTAGGTGACCAAACCAGACTGGATATCGTGCTATTGCTAAAAGCATCCGGGGAGTTATGTGTCTGTGATATCTATACGGCCTTGAATTTATCGCAACCAAAGACATCCCGGCATCTGGCAATGCTAAGAGAATCAGGTCTTTTGCTCGATTCAAAACATGGCAAATGGGTTCATTATCGTTTATCTCCTGCATTACTACCGTGGGTGAAAAGTATCATTGATGTCACTTACGCCACAGAGAAAAATAGAGTTGCAGATTTGCTTAAGAGTCTGGAGACAAAAGAACCTGTGAGTCGCTGTTCTGTATAAAAATTTTTAAGCTAACATATTTGAAAAAACATATGTAAGGTTGAGCGATG