Homologs in group_864

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04370 FBDBKF_04370 100.0 Morganella morganii S1 ftsL cell division protein FtsL
EHELCC_05660 EHELCC_05660 100.0 Morganella morganii S2 ftsL cell division protein FtsL
NLDBIP_05980 NLDBIP_05980 100.0 Morganella morganii S4 ftsL cell division protein FtsL
LHKJJB_02860 LHKJJB_02860 100.0 Morganella morganii S3 ftsL cell division protein FtsL
F4V73_RS08815 F4V73_RS08815 95.2 Morganella psychrotolerans ftsL cell division protein FtsL
PMI_RS10235 PMI_RS10235 74.3 Proteus mirabilis HI4320 ftsL cell division protein FtsL

Distribution of the homologs in the orthogroup group_864

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_864

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7CGA7 1.6e-45 145 66 0 103 3 ftsL Cell division protein FtsL Yersinia pestis
Q7CR84 2.17e-45 145 68 0 104 3 ftsL Cell division protein FtsL Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEN7 4.47e-45 144 69 0 102 3 ftsL Cell division protein FtsL Shigella flexneri
Q32K09 4.47e-45 144 69 0 102 3 ftsL Cell division protein FtsL Shigella dysenteriae serotype 1 (strain Sd197)
P0AEN4 4.47e-45 144 69 0 102 1 ftsL Cell division protein FtsL Escherichia coli (strain K12)
P0AEN5 4.47e-45 144 69 0 102 3 ftsL Cell division protein FtsL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEN6 4.47e-45 144 69 0 102 3 ftsL Cell division protein FtsL Escherichia coli O157:H7
F7XXN6 2.27e-24 91 53 0 83 3 ftsL Cell division protein FtsL Moranella endobia (strain PCIT)
Q5E2P3 3.02e-23 89 47 1 104 3 ftsL Cell division protein FtsL Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9KPG0 4.83e-19 78 41 0 99 3 ftsL Cell division protein FtsL Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1SU12 3.03e-17 73 37 1 102 3 ftsL Cell division protein FtsL Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q8E9P1 9.58e-17 72 40 1 102 3 ftsL Cell division protein FtsL Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
O85296 3.97e-11 57 46 0 76 3 ftsL Cell division protein FtsL Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P45058 8.08e-10 54 34 0 95 3 ftsL Cell division protein FtsL Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P57318 1.13e-07 48 38 0 60 3 ftsL Cell division protein FtsL Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9HVZ6 2.29e-06 45 32 0 96 1 ftsL Cell division protein FtsL Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q89AP9 3.77e-05 42 35 0 51 3 ftsL Cell division protein FtsL Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q83F34 4.08e-05 42 31 1 89 3 ftsL Cell division protein FtsL Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q8PCK6 0.000408 39 34 1 81 3 ftsL Cell division protein FtsL Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_06335
Feature type CDS
Gene ftsL
Product cell division protein FtsL
Location 64760 - 65077 (strand: -1)
Length 318 (nucleotides) / 105 (amino acids)

Contig

Accession ZDB_683
Length 224720 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_864
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04999 Cell division protein FtsL

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3116 Cell cycle control, cell division, chromosome partitioning (D) D Cell division protein FtsL, interacts with FtsB and FtsQ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03586 cell division protein FtsL - -

Protein Sequence

MTTERHNLARVICRDLLRHGFIPAILFIAVIVSAIFVVITAHKTRLLTAEREHLVLERNSLDIEWRNLILEENALGDHSRVERLSVERLSMQHVDPANEKIVVTK

Flanking regions ( +/- flanking 50bp)

AGTGTTAACCCGCGTGCCCGCAGTTCGGTACTGCGCTTTGCGGAGAAAGCATGACCACAGAACGGCACAATTTAGCCCGCGTTATTTGTCGTGACCTGCTGCGCCACGGATTTATCCCTGCGATTTTATTTATCGCAGTGATCGTCAGCGCGATTTTTGTGGTCATCACGGCACATAAAACACGTCTGCTGACCGCAGAGCGGGAACATCTTGTGCTGGAGCGTAACTCGCTGGATATCGAATGGCGTAACCTGATTCTGGAAGAGAACGCCCTGGGGGATCACAGCCGTGTTGAGCGCCTGTCCGTTGAGCGTCTCAGTATGCAGCATGTGGATCCGGCAAACGAAAAAATTGTCGTAACAAAATGACGAAGGCATGAAAAGCAGAAAAGCAGCAGGCAAAACGCAGGGCGGTGCCC