Homologs in group_2476

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00660 FBDBKF_00660 100.0 Morganella morganii S1 lysR DNA-binding transcriptional regulator, LysR family
EHELCC_00885 EHELCC_00885 100.0 Morganella morganii S2 lysR DNA-binding transcriptional regulator, LysR family
NLDBIP_02575 NLDBIP_02575 100.0 Morganella morganii S4 lysR DNA-binding transcriptional regulator, LysR family
LHKJJB_04090 LHKJJB_04090 100.0 Morganella morganii S3 lysR DNA-binding transcriptional regulator, LysR family
F4V73_RS06670 F4V73_RS06670 77.9 Morganella psychrotolerans - LysR family transcriptional regulator

Distribution of the homologs in the orthogroup group_2476

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2476

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P30864 6.69e-36 134 30 5 307 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
P52689 4.77e-33 127 30 4 297 3 ltrA Probable HTH-type transcriptional regulator LtrA Klebsiella pneumoniae
Q9JPU9 1.59e-30 120 30 5 296 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
Q9JXW7 6.57e-29 115 30 6 298 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P43011 1.23e-27 112 26 4 274 3 HI_1364 Uncharacterized HTH-type transcriptional regulator HI_1364 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2ZDG9 3.11e-26 108 27 3 292 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
P55576 1.59e-23 101 30 11 311 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P77333 3.44e-22 97 27 7 287 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
P72131 1.65e-21 95 26 4 298 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q01610 5.41e-21 94 25 7 309 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P75836 1.18e-20 93 26 6 286 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
P45099 4.23e-20 91 26 8 298 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45463 9.2e-20 90 25 6 288 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain K12)
Q0TD46 1.2e-19 90 25 6 288 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R6S1 1.36e-19 90 25 6 288 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 1.36e-19 90 25 6 288 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XBK9 1.98e-19 90 25 6 288 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O157:H7
P37641 1.17e-18 87 25 5 296 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
P0A9F6 1.81e-18 87 27 6 291 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 1.81e-18 87 27 6 291 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 1.81e-18 87 27 6 291 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
P76250 1.88e-17 84 25 5 293 1 dmlR HTH-type transcriptional regulator DmlR Escherichia coli (strain K12)
P46068 1.53e-16 82 26 8 313 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
P27111 2.5e-16 81 36 0 117 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
Q8X4M5 2.52e-15 78 35 0 117 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
P44821 1.26e-14 76 30 0 119 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O06703 2.89e-14 75 24 7 334 3 bbuR HTH-type transcriptional regulator BbuR Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P67662 5.24e-14 74 26 0 188 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 5.24e-14 74 26 0 188 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 5.24e-14 74 26 0 188 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
P0A2Q2 1.48e-13 73 32 0 122 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q3 1.48e-13 73 32 0 122 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhi
P05827 2.78e-13 72 31 0 122 3 ilvY HTH-type transcriptional regulator IlvY Escherichia coli (strain K12)
P14145 3e-12 69 26 10 305 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
P77559 3.58e-12 69 30 4 182 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
P39592 5.67e-12 68 32 2 116 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
P12529 5.88e-12 68 28 5 187 1 ampR HTH-type transcriptional activator AmpR Citrobacter freundii
P37459 7.49e-12 68 22 5 292 3 sinR Probable HTH-type transcriptional regulator SinR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57083 1.31e-11 67 24 8 298 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
Q85G62 1.67e-11 67 34 0 124 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
P52696 2.53e-11 67 33 4 138 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
O32255 3.42e-11 66 30 1 121 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
P37682 4.02e-11 66 23 7 271 3 yiaU Uncharacterized HTH-type transcriptional regulator YiaU Escherichia coli (strain K12)
P52666 6.2e-11 65 37 4 120 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
P20668 7.51e-11 65 28 2 145 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
P25545 7.99e-11 65 26 10 320 3 cbbR HTH-type transcriptional regulator CbbR Xanthobacter flavus
P52595 1.06e-10 65 24 7 291 3 cbbR HTH-type transcriptional regulator CbbR Rhodospirillum rubrum
Q4G384 1.26e-10 64 32 0 110 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
P52669 1.68e-10 64 34 2 143 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
Q8YQ82 3.69e-10 63 32 0 110 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P52670 3.72e-10 63 33 2 119 3 ilvR HTH-type transcriptional regulator IlvR Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q04778 3.92e-10 63 30 2 121 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
P96194 4.55e-10 60 40 0 91 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
P25544 7.11e-10 62 31 3 134 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
A5F9F9 8.58e-10 62 22 10 302 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P0C6D1 1.01e-09 62 22 10 302 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P96725 1.02e-09 62 27 1 122 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
Q3MCB5 1.06e-09 62 31 0 110 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
O78432 1.19e-09 62 32 0 124 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
P05051 1.35e-09 61 24 9 303 3 ampR HTH-type transcriptional activator AmpR Enterobacter cloacae
P16931 1.71e-09 61 33 2 125 3 dgdR HTH-type transcriptional regulator DgdR Burkholderia cepacia
P37499 1.98e-09 61 27 1 140 3 yybE Uncharacterized HTH-type transcriptional regulator YybE Bacillus subtilis (strain 168)
Q55459 2.16e-09 61 26 1 127 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P52665 2.27e-09 58 36 5 122 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
O34685 2.33e-09 60 28 4 171 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
P48271 2.57e-09 60 32 0 110 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
Q6B936 2.8e-09 60 32 0 110 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
P45349 2.8e-09 60 29 0 111 3 metR HTH-type transcriptional regulator MetR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P23841 3.07e-09 60 33 2 125 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
A0T0V5 3.69e-09 60 36 3 125 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
Q47005 3.71e-09 60 28 1 121 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
O19892 6.77e-09 59 33 1 117 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
P42722 7.36e-09 59 24 7 294 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P52683 7.54e-09 59 26 6 205 3 smeR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Serratia marcescens
A4QH19 8.35e-09 59 31 0 119 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
Q5N5I5 8.46e-09 59 28 1 127 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 8.46e-09 59 28 1 127 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P0ACR8 9.01e-09 59 31 1 145 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 9.01e-09 59 31 1 145 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
P77309 9.05e-09 59 28 1 122 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
P77700 9.19e-09 59 31 4 119 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
Q08597 1.01e-08 59 30 1 118 3 nac Nitrogen assimilation regulatory protein nac Klebsiella aerogenes
P0A2Q4 1.54e-08 58 28 5 182 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 1.54e-08 58 28 5 182 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
P0A9G1 1.8e-08 58 27 2 176 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 1.8e-08 58 27 2 176 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 1.8e-08 58 27 2 176 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
P77744 2.32e-08 58 28 0 114 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
P0ACR0 2.39e-08 58 34 2 127 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 2.39e-08 58 34 2 127 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
P42507 2.65e-08 57 23 7 297 3 hvrB AhcY transcriptional activator HvrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q9HWH8 3.27e-08 57 26 4 166 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1XDT2 4.14e-08 57 30 0 124 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
P73123 4.19e-08 57 29 0 124 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P51205 4.79e-08 57 30 0 124 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
P45461 5.32e-08 57 30 1 120 3 ampR HTH-type transcriptional activator AmpR Yersinia enterocolitica
A2CI69 5.81e-08 57 31 0 110 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
P34818 1.12e-07 55 25 11 305 3 trpI HTH-type transcriptional regulator TrpI Pseudomonas syringae pv. syringae
P11720 1.17e-07 55 24 11 304 1 trpI HTH-type transcriptional regulator TrpI Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P77171 1.39e-07 55 27 9 212 3 ydcI Uncharacterized HTH-type transcriptional regulator YdcI Escherichia coli (strain K12)
P52676 1.82e-07 55 27 7 204 3 nmcR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Enterobacter cloacae
Q1RF30 1.82e-07 55 33 2 127 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 1.82e-07 55 33 2 127 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
Q8FK66 1.83e-07 55 33 2 127 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 1.83e-07 55 33 2 127 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P70785 2.39e-07 55 28 4 177 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
P0ACR2 2.69e-07 54 30 0 118 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli (strain K12)
P0ACR3 2.69e-07 54 30 0 118 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli O157:H7
Q57S50 2.86e-07 54 33 1 121 3 allS HTH-type transcriptional activator AllS Salmonella choleraesuis (strain SC-B67)
Q9S4Y7 2.95e-07 54 33 1 121 3 allS HTH-type transcriptional activator AllS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCH2 2.95e-07 54 33 1 121 3 allS HTH-type transcriptional activator AllS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P52662 3.7e-07 54 29 1 128 3 pecT HTH-type transcriptional regulator PecT Dickeya dadantii (strain 3937)
Q8KA72 5.49e-07 53 26 5 172 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P49518 5.52e-07 53 29 0 124 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
O07906 5.59e-07 53 21 0 139 3 yraN Uncharacterized HTH-type transcriptional regulator YraN Bacillus subtilis (strain 168)
A0T0G2 5.83e-07 53 23 10 309 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
Q8Z8R3 6.77e-07 53 33 1 121 3 allS HTH-type transcriptional activator AllS Salmonella typhi
P94387 8.35e-07 53 29 2 125 3 ycgK Uncharacterized HTH-type transcriptional regulator YcgK Bacillus subtilis (strain 168)
Q06610 8.62e-07 53 21 7 297 3 rbcR RuBisCO operon transcriptional regulator Acidithiobacillus ferrooxidans
P52659 1.34e-06 52 24 9 277 3 abaB HTH-type transcriptional regulator AbaB Streptomyces antibioticus
O87883 2.27e-06 50 40 0 71 3 oxyR Probable hydrogen peroxide-inducible genes activator (Fragment) Mycobacterium xenopi
O35038 2.34e-06 52 35 6 124 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
P94678 2.67e-06 51 28 0 123 1 tsaR HTH-type transcriptional regulator TsaR Comamonas testosteroni
Q47141 3.2e-06 51 33 4 123 1 hcaR Hca operon transcriptional activator HcaR Escherichia coli (strain K12)
Q765S2 3.33e-06 51 32 1 121 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
P55181 3.43e-06 51 27 2 127 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
P52661 3.64e-06 51 28 0 122 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
P52660 3.84e-06 51 23 7 258 3 blaA HTH-type transcriptional regulator BlaA Proteus vulgaris
Q8VWE6 4.02e-06 51 29 2 152 3 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli O157:H7
B4TNR5 4.26e-06 50 39 0 68 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)
P36771 4.29e-06 51 29 2 152 1 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli (strain K12)
B5FN59 4.59e-06 50 39 0 68 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
P45105 4.67e-06 51 27 7 174 3 cysB HTH-type transcriptional regulator CysB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A2Q0 4.67e-06 50 39 0 68 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 4.67e-06 50 39 0 68 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 4.67e-06 50 39 0 68 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 4.67e-06 50 39 0 68 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 4.67e-06 50 39 0 68 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 4.67e-06 50 39 0 68 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TAZ8 4.67e-06 50 39 0 68 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5EZ22 4.67e-06 50 39 0 68 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
B4SYF7 4.76e-06 50 39 0 68 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
A1JI47 7.71e-06 50 37 0 69 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P42427 7.99e-06 49 30 1 112 3 tfdT HTH-type transcriptional regulator TfdT Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q44311 1.01e-05 50 25 2 119 3 soxR HTH-type transcriptional regulator SoxR Arthrobacter sp. (strain TE1826)
B7LUJ5 1.11e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
O33945 1.11e-05 50 25 0 116 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
Q57748 1.15e-05 49 22 14 318 3 MJ0300 Uncharacterized HTH-type transcriptional regulator MJ0300 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q329U3 1.16e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B6I4A0 1.16e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7NF72 1.16e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7M5B2 1.16e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 1.16e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 1.16e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 1.16e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 1.16e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YVK2 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7NU32 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UMM1 1.2e-05 49 40 0 65 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1R4H3 1.25e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 1.25e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 1.25e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 1.25e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 1.25e-05 49 38 0 67 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
P52691 2.35e-05 48 30 2 120 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B1JQ39 3.24e-05 48 36 0 69 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 3.24e-05 48 36 0 69 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 3.24e-05 48 36 0 69 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 3.24e-05 48 36 0 69 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 3.24e-05 48 36 0 69 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 3.24e-05 48 36 0 69 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 3.24e-05 48 36 0 69 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 3.24e-05 48 36 0 69 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 3.24e-05 48 36 0 69 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2TU26 4.12e-05 48 39 0 63 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B4E8V9 4.14e-05 48 28 2 119 1 cysB HTH-type transcriptional regulator CysB Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q9X5P2 4.73e-05 48 32 5 128 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
P25547 4.78e-05 48 28 1 123 3 gbpR HTH-type transcriptional regulator GbpR Rhizobium radiobacter
P67668 4.95e-05 48 31 0 96 3 BQ2027_MB2303C Uncharacterized HTH-type transcriptional regulator Mb2303c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMF3 4.95e-05 48 31 0 96 1 Rv2282c Uncharacterized HTH-type transcriptional regulator Rv2282c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF2 4.95e-05 48 31 0 96 3 MT2340 Uncharacterized HTH-type transcriptional regulator MT2340 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0ACQ9 5.66e-05 47 25 0 120 3 tdcA HTH-type transcriptional regulator TdcA Shigella flexneri
P0ACQ7 5.66e-05 47 25 0 120 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli (strain K12)
P0ACQ8 5.66e-05 47 25 0 120 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli O157:H7
P07774 6.46e-05 47 27 1 119 1 catM HTH-type transcriptional regulator CatM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P52675 7.9e-05 45 31 1 110 3 cysB HTH-type transcriptional regulator CysB (Fragment) Thiocapsa roseopersicina
Q9KPI4 9.03e-05 47 37 0 66 3 VC_2383 Uncharacterized HTH-type transcriptional regulator VC_2383 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P52693 9.05e-05 47 26 3 151 3 ntcB Probable nitrogen assimilation transcriptional activator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O32186 0.000106 47 23 2 132 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
P52677 0.000115 47 35 0 80 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium avium
P43160 0.000135 46 37 0 70 3 mprR Small neutral protease regulatory protein Streptomyces coelicolor
P71318 0.00014 46 28 2 121 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
Q9X725 0.000201 46 28 2 121 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
Q46M57 0.000242 45 42 0 68 1 tfdR HTH-type transcriptional regulator TdfR Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46M54 0.000248 45 42 0 68 1 tfdS HTH-type transcriptional regulator TfdS Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P52684 0.000262 45 22 0 110 3 mauR Malonate utilization transcriptional regulator Klebsiella pneumoniae
P0ACQ4 0.000319 45 28 3 122 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 0.000319 45 28 3 122 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 0.000319 45 28 3 122 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
P74422 0.000347 45 31 5 123 3 ntcB Probable nitrogen assimilation transcriptional activator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P44418 0.000551 44 27 3 144 3 oxyR Hydrogen peroxide-inducible genes activator Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q88JX7 0.000702 44 29 3 119 3 galR HTH-type transcriptional regulator GalR Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P45600 0.000703 44 27 3 111 1 cysB HTH-type transcriptional regulator CysB Klebsiella pneumoniae

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_02955
Feature type CDS
Gene lysR
Product DNA-binding transcriptional regulator, LysR family
Location 198975 - 199928 (strand: -1)
Length 954 (nucleotides) / 317 (amino acids)

Contig

Accession ZDB_680
Length 282413 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2476
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MPRHFDDLMLGTLELFCRAAELQSFSQAAQALNISPAAVSKTIARLEQKLGSPLFVRTTRHVRLTEAGEQYLSYCRTALDAMYDAENALLDMKTIPAGKIRVCLPNDYAYLKVFPLMPKFRRRYPQIEVDFHLRFRIPRQESTDCDIVMTSWLNYLPDWIATPVDFAMFRIYASPDYLKKAPPLNTPEDLRHHNCLQMHLQEQTRSLRWPLVINNKIEHIETRGDAAFYEDVMAAYYMAVSGNGVAIMHDFIARKAVANGQLVPVLEPWTTVSHIYHIACPAESRKSPRIRAFIDFLTEELRPAGAFPEHSVIVPVR

Flanking regions ( +/- flanking 50bp)

CGTGAAATAAACTACCCTGATATCACATCATTACCAACCTGAGGTTAATAATGCCGCGTCATTTTGATGATTTGATGCTGGGTACGCTGGAATTGTTCTGCCGTGCCGCCGAACTGCAAAGCTTTTCACAGGCGGCACAGGCGCTGAATATTTCTCCGGCTGCGGTCAGCAAAACCATTGCGAGGCTGGAACAGAAGCTGGGCAGTCCGCTGTTTGTCAGAACCACCCGCCATGTGCGGCTGACAGAAGCGGGAGAACAATACCTCAGCTATTGCAGGACAGCGCTGGACGCGATGTATGATGCAGAGAATGCCCTGCTGGACATGAAAACCATTCCGGCCGGGAAAATCCGTGTTTGCCTGCCCAATGATTACGCCTATCTGAAAGTGTTTCCGCTGATGCCGAAATTCCGCCGCCGTTATCCGCAAATCGAGGTCGATTTTCATCTCCGCTTCCGCATTCCGCGCCAGGAAAGCACGGATTGCGATATCGTCATGACCAGTTGGCTGAATTACCTGCCCGACTGGATTGCCACCCCGGTTGATTTCGCTATGTTCCGGATTTATGCCTCACCGGATTATCTGAAAAAAGCACCGCCACTGAATACCCCGGAAGATCTCCGCCATCACAACTGCCTGCAGATGCATTTGCAGGAACAGACCAGATCACTGCGCTGGCCACTGGTGATAAACAATAAGATTGAACATATCGAAACCCGTGGTGACGCTGCATTTTATGAAGATGTGATGGCCGCATACTATATGGCGGTATCCGGTAACGGCGTCGCAATAATGCATGACTTTATTGCCCGCAAAGCCGTGGCAAACGGGCAACTGGTTCCGGTACTGGAGCCCTGGACTACCGTATCCCATATTTATCATATTGCCTGTCCGGCAGAATCGCGCAAATCTCCGCGTATCCGCGCATTCATTGATTTTCTGACAGAAGAACTGCGGCCGGCCGGCGCTTTTCCGGAACATTCGGTGATAGTCCCTGTCCGCTGACTTGTATCCGGCACAAAAAAAGGCCGTCGCAGTGACGGCCAAAGGAATTC