Homologs in group_2472

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_19680 EHELCC_19680 100.0 Morganella morganii S2 murB UDP-N-acetylmuramate dehydrogenase
NLDBIP_19675 NLDBIP_19675 100.0 Morganella morganii S4 murB UDP-N-acetylmuramate dehydrogenase
LHKJJB_19625 LHKJJB_19625 100.0 Morganella morganii S3 murB UDP-N-acetylmuramate dehydrogenase
HKOGLL_19555 HKOGLL_19555 100.0 Morganella morganii S5 murB UDP-N-acetylmuramate dehydrogenase
F4V73_RS18865 F4V73_RS18865 79.4 Morganella psychrotolerans murB UDP-N-acetylmuramate dehydrogenase
PMI_RS16090 PMI_RS16090 64.7 Proteus mirabilis HI4320 murB UDP-N-acetylmuramate dehydrogenase

Distribution of the homologs in the orthogroup group_2472

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2472

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MYE5 7.65e-160 453 62 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8X711 1.42e-155 442 61 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Escherichia coli O157:H7
P08373 2.67e-155 442 61 1 339 1 murB UDP-N-acetylenolpyruvoylglucosamine reductase Escherichia coli (strain K12)
Q6DAP0 4.75e-155 441 61 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q32AE8 7.97e-155 441 61 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Shigella dysenteriae serotype 1 (strain Sd197)
Q3YV08 1.07e-154 440 61 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Shigella sonnei (strain Ss046)
Q83PC7 1.07e-154 440 61 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Shigella flexneri
Q8FB88 7.18e-154 438 61 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q31U21 3.87e-153 436 61 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Shigella boydii serotype 4 (strain Sb227)
Q4QNS0 1.49e-148 425 58 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Haemophilus influenzae (strain 86-028NP)
P37417 3.75e-148 424 60 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57H81 4.56e-148 424 60 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Salmonella choleraesuis (strain SC-B67)
P44605 4.66e-148 424 58 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8Z316 1.75e-147 422 60 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Salmonella typhi
Q5PK78 2.35e-147 422 60 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZAN4 7.46e-147 421 58 1 340 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Yersinia pestis
Q66FR3 2.96e-146 419 58 1 340 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q65WM5 5.24e-139 400 56 1 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P57952 7.89e-137 395 56 1 338 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pasteurella multocida (strain Pm70)
Q7VPJ2 1.54e-128 374 54 1 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6LLV2 1.02e-127 372 51 1 346 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Photobacterium profundum (strain SS9)
Q87KP5 8.45e-120 352 49 0 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DD33 2.13e-118 348 49 0 342 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Vibrio vulnificus (strain CMCP6)
A5F3P9 1.02e-117 347 51 1 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MGQ8 1.21e-117 347 48 0 342 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Vibrio vulnificus (strain YJ016)
Q9KV40 1.81e-117 346 50 1 337 1 murB UDP-N-acetylenolpyruvoylglucosamine reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A9KW85 9.48e-115 339 50 2 338 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Shewanella baltica (strain OS195)
A8G1G4 2.5e-114 338 50 1 338 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Shewanella sediminis (strain HAW-EB3)
P59450 1.08e-111 331 48 2 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A0KRK7 9.82e-110 326 48 1 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Shewanella sp. (strain ANA-3)
Q8KA63 1.83e-109 325 44 1 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57153 2.25e-109 326 44 2 338 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8EK85 6.9e-109 324 48 1 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q493L3 2.39e-108 323 47 3 332 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Blochmanniella pennsylvanica (strain BPEN)
Q0HNV5 5.9e-108 322 48 1 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Shewanella sp. (strain MR-4)
Q0I0C3 1.61e-107 320 48 1 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Shewanella sp. (strain MR-7)
Q5E225 2.84e-106 318 46 0 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A4JH86 1.27e-104 313 48 3 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q8D243 1.22e-103 311 44 3 338 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Wigglesworthia glossinidia brevipalpis
Q7VQF2 1.87e-102 308 45 3 338 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Blochmanniella floridana
Q0BCG5 1.15e-101 306 47 3 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A9AGJ5 5.32e-101 304 47 3 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia multivorans (strain ATCC 17616 / 249)
B1YVE7 1.36e-100 303 47 3 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia ambifaria (strain MC40-6)
Q1BU59 1.67e-100 303 47 3 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia orbicola (strain AU 1054)
A0K9X7 1.67e-100 303 47 3 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia cenocepacia (strain HI2424)
B1JXG4 1.33e-99 301 47 3 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia orbicola (strain MC0-3)
Q39DI6 1.64e-99 300 47 3 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q5P3R2 3.21e-99 300 46 3 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2T0L2 5.83e-99 299 46 5 332 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3JVB9 7.02e-99 299 46 5 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia pseudomallei (strain 1710b)
A3NS80 3.01e-98 297 46 5 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia pseudomallei (strain 1106a)
A1V1B7 3.01e-98 297 46 5 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia mallei (strain SAVP1)
Q62M77 3.01e-98 297 46 5 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia mallei (strain ATCC 23344)
A2S948 3.01e-98 297 46 5 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia mallei (strain NCTC 10229)
A3MHG6 3.01e-98 297 46 5 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia mallei (strain NCTC 10247)
Q63WM3 3.74e-98 297 46 5 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia pseudomallei (strain K96243)
A3N6J6 2.54e-97 295 46 5 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Burkholderia pseudomallei (strain 668)
B2JDU4 1.11e-95 290 47 3 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q3IJU8 1.16e-93 285 44 4 333 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pseudoalteromonas translucida (strain TAC 125)
Q13UR0 2.57e-93 285 46 3 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Paraburkholderia xenovorans (strain LB400)
Q15NN9 1.52e-92 283 43 3 332 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7NXN4 3.8e-91 279 47 5 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B2SY64 2.27e-90 277 45 3 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q47UY2 3.24e-90 277 44 3 332 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q7WGH4 1.07e-85 265 44 4 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9X6Y8 1.23e-85 265 44 4 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W509 1.25e-85 265 44 4 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9JV28 1.99e-85 264 45 7 332 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q46XL1 3.02e-85 263 44 5 326 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5F9J9 7.89e-85 263 44 6 338 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A9M3P3 1.33e-84 262 44 6 332 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Neisseria meningitidis serogroup C (strain 053442)
Q9K016 1.74e-84 262 44 7 332 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A5FNG4 1.08e-82 257 39 5 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q5QY76 1.98e-82 256 41 4 329 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q8XWC4 6e-82 255 42 4 335 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A1KBU9 3.25e-81 254 44 5 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Azoarcus sp. (strain BH72)
B3ETU4 5.26e-81 253 40 4 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Amoebophilus asiaticus (strain 5a2)
Q47K28 5.9e-80 250 45 5 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Dechloromonas aromatica (strain RCB)
Q88LM5 9.38e-79 247 42 4 327 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P61433 7.61e-78 244 39 2 332 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q4ZVY7 1.01e-76 242 41 5 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pseudomonas syringae pv. syringae (strain B728a)
Q3K8J6 2.8e-76 241 41 7 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pseudomonas fluorescens (strain Pf0-1)
Q64RZ8 3.97e-76 240 42 6 329 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bacteroides fragilis (strain YCH46)
A4SVJ6 5.87e-76 240 42 9 330 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q5LBG5 2.26e-75 238 41 6 329 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q87YF8 3.01e-75 238 42 8 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9HZM7 5.95e-75 237 41 4 334 1 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q48L51 9.75e-74 234 41 7 335 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q0VQP1 1.03e-73 234 41 4 326 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4KFT1 7.03e-73 232 40 6 329 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q87A76 7.92e-72 229 40 5 335 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B0U5I2 7.92e-72 229 40 5 335 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xylella fastidiosa (strain M12)
B2I9T6 7.92e-72 229 40 5 335 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xylella fastidiosa (strain M23)
Q9PAE6 4.03e-71 228 40 5 335 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xylella fastidiosa (strain 9a5c)
Q8A806 2.33e-70 225 40 7 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B0V744 2.94e-70 226 38 3 330 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Acinetobacter baumannii (strain AYE)
B0VRK7 5.09e-70 225 38 3 330 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Acinetobacter baumannii (strain SDF)
Q8PLJ3 8e-70 224 40 4 333 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xanthomonas axonopodis pv. citri (strain 306)
B2RJV4 3.07e-69 223 38 4 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q3BUJ8 1.22e-68 221 39 4 333 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q7MUY2 1.78e-68 221 38 4 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q5H0N1 5.18e-68 219 40 5 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SLC0 7.93e-68 219 40 5 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P3M1 9.63e-68 219 40 5 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q6FAZ1 4.29e-67 217 36 3 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0RTS4 5.68e-67 217 39 7 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xanthomonas campestris pv. campestris (strain B100)
Q8P9R1 2.25e-66 216 39 7 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UTX4 2.25e-66 216 39 7 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Xanthomonas campestris pv. campestris (strain 8004)
Q67RL6 6.89e-61 202 38 7 331 3 murB1 UDP-N-acetylenolpyruvoylglucosamine reductase 1 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q1QAQ4 1.27e-60 201 39 6 315 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FT57 1.07e-58 196 39 6 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A5WDI5 1.12e-57 194 36 6 301 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Psychrobacter sp. (strain PRwf-1)
P9WJL9 1.9e-44 159 34 10 328 1 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJL8 1.9e-44 159 34 10 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5TZL0 1.9e-44 159 34 10 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AKG0 1.9e-44 159 34 10 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KFV6 1.9e-44 159 34 10 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P65461 1.9e-44 159 34 10 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1BEB0 6.73e-43 154 35 11 304 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium sp. (strain MCS)
A1UAM4 6.73e-43 154 35 11 304 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium sp. (strain KMS)
A8LZF8 2.15e-42 154 35 13 340 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Salinispora arenicola (strain CNS-205)
A0QQZ3 4.13e-42 153 32 9 347 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A3PU80 4.15e-42 152 35 11 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium sp. (strain JLS)
A4T318 4.55e-42 152 34 10 338 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycolicibacterium gilvum (strain PYR-GCK)
Q9CB48 4.96e-41 150 34 10 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium leprae (strain TN)
B8ZT90 4.96e-41 150 34 10 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium leprae (strain Br4923)
A0PVY7 1.38e-39 146 34 9 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium ulcerans (strain Agy99)
B2HQU8 1.9e-39 146 34 9 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q5YP42 1.68e-38 144 36 11 311 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Nocardia farcinica (strain IFM 10152)
A4FQ15 4.55e-37 139 35 17 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q73SU8 8e-37 139 31 10 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QLK9 9.65e-37 139 31 10 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mycobacterium avium (strain 104)
Q6A6J8 3.73e-35 134 32 11 342 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Cutibacterium acnes (strain DSM 16379 / KPA171202)
P61434 7.21e-35 134 31 8 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q9L0L7 1.52e-34 133 31 9 345 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q82DR4 6.95e-34 131 31 11 347 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q47LH5 2.43e-33 129 34 13 317 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Thermobifida fusca (strain YX)
Q8NTB0 1.77e-31 124 31 11 312 3 murB2 UDP-N-acetylenolpyruvoylglucosamine reductase 2 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QB37 2.45e-31 124 31 11 312 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Corynebacterium glutamicum (strain R)
Q6AH30 5.03e-30 121 30 11 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Leifsonia xyli subsp. xyli (strain CTCB07)
Q8ESR4 9.97e-28 113 30 8 330 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q83FK5 1.65e-26 110 29 7 309 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Tropheryma whipplei (strain Twist)
Q83HA7 3.37e-26 110 29 9 312 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Tropheryma whipplei (strain TW08/27)
A4ILI2 3.39e-26 109 31 12 311 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Geobacillus thermodenitrificans (strain NG80-2)
Q5L1H7 1.11e-24 105 32 11 293 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Geobacillus kaustophilus (strain HTA426)
Q8R8Z6 5.28e-24 103 27 9 327 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q4JSV7 5.61e-23 102 27 13 394 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Corynebacterium jeikeium (strain K411)
A9KSS3 1.77e-22 99 28 8 330 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q6MAQ1 1.94e-22 99 28 10 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Protochlamydia amoebophila (strain UWE25)
Q38VZ2 2.74e-22 98 27 9 312 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Latilactobacillus sakei subsp. sakei (strain 23K)
B9MN03 7.62e-22 97 27 9 327 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A8MLW8 7.82e-22 97 29 10 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Alkaliphilus oremlandii (strain OhILAs)
B3QWU0 1.3e-21 96 27 8 295 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A8ZXW1 1.3e-21 96 29 8 327 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q2JTH4 2.98e-21 95 29 11 304 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Synechococcus sp. (strain JA-3-3Ab)
Q7NI66 4.71e-21 95 27 7 296 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8DLV6 1.32e-20 94 27 6 330 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A6TVF6 1.49e-20 93 28 10 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Alkaliphilus metalliredigens (strain QYMF)
Q88YF4 2.07e-20 93 27 10 338 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q5HHT2 2.49e-20 93 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain COL)
B0CCD5 2.65e-20 93 26 7 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Acaryochloris marina (strain MBIC 11017)
Q3MAP7 3.67e-20 93 29 9 295 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B0TGC2 4e-20 92 27 6 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A5G8J8 4.36e-20 92 29 9 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Geotalea uraniireducens (strain Rf4)
A5ILF5 4.81e-20 92 28 9 284 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
C1CL98 5.9e-20 92 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pneumoniae (strain P1031)
C1CEX8 5.9e-20 92 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pneumoniae (strain JJA)
Q9X239 6.11e-20 91 29 10 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B2GAN2 7.22e-20 91 29 12 315 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q67Q47 9.88e-20 91 28 10 332 3 murB2 UDP-N-acetylenolpyruvoylglucosamine reductase 2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q180P9 1e-19 91 27 8 308 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridioides difficile (strain 630)
Q9CGD5 1.18e-19 91 28 9 308 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Lactococcus lactis subsp. lactis (strain IL1403)
Q5NFD4 1.21e-19 90 24 6 321 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
A3DBM4 1.49e-19 90 27 11 311 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q6GIQ3 1.63e-19 90 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain MRSA252)
Q72Y09 1.87e-19 90 28 9 332 3 murB2 UDP-N-acetylenolpyruvoylglucosamine reductase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
B1ICI9 1.93e-19 90 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pneumoniae (strain Hungary19A-6)
C1C7Z0 2.01e-19 90 28 9 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pneumoniae (strain 70585)
P61432 2.06e-19 90 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain MW2)
P61431 2.06e-19 90 28 8 289 1 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus
A8Z012 2.06e-19 90 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GB92 2.06e-19 90 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain MSSA476)
A6QF47 2.06e-19 90 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain Newman)
Q2YSJ1 2.06e-19 90 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G069 2.06e-19 90 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIQ3 2.06e-19 90 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain USA300)
Q6HBI9 2.15e-19 90 28 9 332 3 murB2 UDP-N-acetylenolpyruvoylglucosamine reductase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1CQW7 2.18e-19 90 28 9 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pneumoniae (strain Taiwan19F-14)
P65467 2.18e-19 90 28 9 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P65466 2.18e-19 90 28 9 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZKN7 2.18e-19 90 28 9 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q04JV9 2.18e-19 90 28 9 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A2RKV4 2.43e-19 90 28 9 308 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Lactococcus lactis subsp. cremoris (strain MG1363)
Q8YM74 2.44e-19 90 28 9 295 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q49VT7 2.52e-19 90 28 8 294 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q81XC5 3.07e-19 90 28 9 332 3 murB2 UDP-N-acetylenolpyruvoylglucosamine reductase 2 Bacillus anthracis
B2IQK6 3.6e-19 89 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pneumoniae (strain CGSP14)
Q5MZH9 4.05e-19 89 28 10 335 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P95837 4.05e-19 89 28 10 335 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P65463 4.67e-19 89 28 8 289 1 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain N315)
P65462 4.67e-19 89 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQU2 4.67e-19 89 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain JH9)
A6TZL7 4.67e-19 89 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain JH1)
A7WZM9 4.67e-19 89 28 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q02Z11 5.24e-19 89 28 9 308 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Lactococcus lactis subsp. cremoris (strain SK11)
A3CMQ6 6.25e-19 89 28 9 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus sanguinis (strain SK36)
B2J718 6.43e-19 89 29 8 285 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B9DJN5 7.16e-19 89 27 8 298 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus carnosus (strain TM300)
Q815R9 8.12e-19 89 28 9 332 3 murB2 UDP-N-acetylenolpyruvoylglucosamine reductase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B1LAW8 9.05e-19 88 28 9 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Thermotoga sp. (strain RQ2)
Q631P8 1.46e-18 88 28 9 332 3 murB2 UDP-N-acetylenolpyruvoylglucosamine reductase 2 Bacillus cereus (strain ZK / E33L)
Q01NJ5 1.95e-18 87 28 13 288 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Solibacter usitatus (strain Ellin6076)
Q5L5A3 2.18e-18 87 26 9 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chlamydia abortus (strain DSM 27085 / S26/3)
Q04BG3 2.3e-18 87 26 9 327 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GB18 2.3e-18 87 26 9 327 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q03JH0 2.36e-18 87 28 9 304 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q1WSZ5 2.63e-18 87 27 9 309 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Ligilactobacillus salivarius (strain UCC118)
Q8DUF8 2.81e-18 87 28 9 304 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q7VEJ2 3.43e-18 87 23 6 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q1ASA8 4.26e-18 86 26 9 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
B5E5P6 4.28e-18 87 27 9 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pneumoniae serotype 19F (strain G54)
B7GGI1 4.56e-18 86 26 10 316 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q0AY75 4.65e-18 86 24 7 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A4XIM9 5.81e-18 86 26 7 326 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B2UZY4 5.87e-18 86 29 11 317 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium botulinum (strain Alaska E43 / Type E3)
Q9Z6S1 6.66e-18 86 28 10 325 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chlamydia pneumoniae
Q822B0 7.14e-18 85 25 9 325 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
P65465 1.16e-17 85 28 9 302 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65464 1.16e-17 85 28 9 302 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y5 1.16e-17 85 28 9 302 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B1YJK3 1.37e-17 85 27 11 301 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A7HJQ1 1.52e-17 85 26 8 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q0SW37 1.53e-17 85 28 9 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium perfringens (strain SM101 / Type A)
P0DC49 1.56e-17 85 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M3 (strain SSI-1)
Q1JGY8 1.56e-17 85 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M2 (strain MGAS10270)
P0DC48 1.56e-17 85 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B9DRZ6 1.57e-17 85 28 11 304 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q5WAV8 1.57e-17 85 29 8 298 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Shouchella clausii (strain KSM-K16)
Q46I41 1.61e-17 85 25 6 333 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Prochlorococcus marinus (strain NATL2A)
A0LNZ0 1.73e-17 85 27 9 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B2TQS2 1.82e-17 85 29 12 318 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium botulinum (strain Eklund 17B / Type B)
Q8XNI0 1.91e-17 85 28 9 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium perfringens (strain 13 / Type A)
Q0TU88 1.91e-17 85 28 9 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q5M396 2.39e-17 84 27 9 304 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYN3 2.39e-17 84 27 9 304 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus thermophilus (strain CNRZ 1066)
Q39YL7 3.11e-17 84 27 7 294 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
C4ZEG7 3.13e-17 84 26 9 317 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
B9EAD2 3.27e-17 84 26 9 301 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Macrococcus caseolyticus (strain JCSC5402)
Q72MQ5 3.38e-17 84 28 10 291 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A2REL5 3.4e-17 84 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J6Q7 3.4e-17 84 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q5XCA5 3.4e-17 84 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
B5XLF2 3.44e-17 84 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M49 (strain NZ131)
A8AWE3 3.48e-17 84 27 7 302 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8EZC5 3.72e-17 84 28 10 291 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
A7Z4E6 3.74e-17 84 29 8 288 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q97LP4 3.76e-17 84 27 9 309 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B2G632 4.74e-17 83 27 9 308 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIJ8 4.74e-17 83 27 9 308 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Limosilactobacillus reuteri (strain DSM 20016)
Q48TP5 5.33e-17 83 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q3AAE8 5.39e-17 83 28 9 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A5N360 6.78e-17 83 26 9 315 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DWV2 6.78e-17 83 26 9 315 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium kluyveri (strain NBRC 12016)
A5GPX0 7.07e-17 83 28 10 293 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Synechococcus sp. (strain RCC307)
Q8P150 7.94e-17 83 28 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q313Q1 7.96e-17 83 27 9 294 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B9M174 9.05e-17 83 26 10 314 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q4L4G3 9.97e-17 82 27 8 294 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus haemolyticus (strain JCSC1435)
Q71ZQ0 1.15e-16 82 26 9 324 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Listeria monocytogenes serotype 4b (strain F2365)
C1L2X6 1.15e-16 82 26 9 324 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q9ZDS7 1.52e-16 82 28 10 327 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia prowazekii (strain Madrid E)
O66805 1.64e-16 82 26 11 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Aquifex aeolicus (strain VF5)
C0MEX9 1.96e-16 82 27 7 307 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus equi subsp. zooepidemicus (strain H70)
Q68XC1 2e-16 82 26 10 330 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A8GRC0 2.08e-16 82 27 11 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia rickettsii (strain Sheila Smith)
B0BWS1 2.08e-16 82 27 11 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia rickettsii (strain Iowa)
Q92BT5 2.12e-16 82 26 9 309 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q6AJ55 2.27e-16 82 28 11 335 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A6LN73 2.29e-16 81 27 9 283 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q3J791 2.55e-16 81 29 11 297 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q8Y776 2.55e-16 81 26 9 324 1 murB UDP-N-acetylenolpyruvoylglucosamine reductase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q1JLT8 2.84e-16 81 27 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV7 2.84e-16 81 27 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q99ZS9 2.87e-16 81 27 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus pyogenes serotype M1
Q255M5 2.9e-16 81 25 10 326 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chlamydia felis (strain Fe/C-56)
Q92IT8 3.31e-16 81 27 11 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A6M2Y4 3.92e-16 81 29 9 291 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A0PYB4 4.17e-16 81 27 8 293 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium novyi (strain NT)
A0AIM3 4.33e-16 80 27 9 290 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q03GV3 4.94e-16 80 27 10 310 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A4VUI1 4.97e-16 80 27 6 302 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus suis (strain 05ZYH33)
A4W0S3 4.97e-16 80 27 6 302 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus suis (strain 98HAH33)
B8DE89 5.07e-16 80 26 8 308 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Listeria monocytogenes serotype 4a (strain HCC23)
P74529 5.34e-16 80 25 10 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A8FCY2 5.53e-16 80 25 8 314 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bacillus pumilus (strain SAFR-032)
C0MA63 5.7e-16 80 27 7 307 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Streptococcus equi subsp. equi (strain 4047)
Q830P3 6.36e-16 80 26 9 289 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Enterococcus faecalis (strain ATCC 700802 / V583)
A2C5M2 8.04e-16 80 24 7 332 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Prochlorococcus marinus (strain MIT 9303)
C4K125 8.08e-16 80 27 11 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia peacockii (strain Rustic)
Q3A2G8 8.89e-16 80 27 10 296 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A8GMP7 1.19e-15 79 27 9 302 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia akari (strain Hartford)
A8F109 1.43e-15 79 27 9 302 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia massiliae (strain Mtu5)
Q8CPZ7 1.59e-15 79 27 9 294 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQZ1 1.59e-15 79 27 9 294 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q890Y6 1.75e-15 79 28 12 297 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium tetani (strain Massachusetts / E88)
Q4UKP0 2.25e-15 79 26 12 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q7V9C4 3e-15 78 24 8 332 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Prochlorococcus marinus (strain MIT 9313)
Q8NTF4 3.62e-15 79 22 9 353 3 murB1 UDP-N-acetylenolpyruvoylglucosamine reductase 1 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q04VG7 4.23e-15 78 26 9 290 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q04Y07 4.4e-15 78 26 9 290 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q73RJ5 4.57e-15 78 26 10 293 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A9BJV3 8.05e-15 77 26 9 332 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q65JX9 9.18e-15 77 28 8 284 1 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q2LR56 1.59e-14 76 24 8 333 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Syntrophus aciditrophicus (strain SB)
Q9PL89 2.71e-14 75 25 12 337 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chlamydia muridarum (strain MoPn / Nigg)
A1AU59 3.47e-14 75 26 10 316 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B1IFW4 3.71e-14 75 26 10 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium botulinum (strain Okra / Type B1)
B9LKI9 5.34e-14 75 24 9 338 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WG69 5.34e-14 75 24 9 338 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q604V9 5.53e-14 75 28 11 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A5GHN8 5.54e-14 75 26 12 310 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Synechococcus sp. (strain WH7803)
B3CSQ9 5.58e-14 75 29 11 304 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Orientia tsutsugamushi (strain Ikeda)
Q8RDQ3 5.79e-14 74 24 10 291 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B1L271 6.88e-14 74 26 9 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium botulinum (strain Loch Maree / Type A3)
A7GIX4 6.88e-14 74 26 9 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
C1FMJ6 6.88e-14 74 26 9 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium botulinum (strain Kyoto / Type A2)
A5I7A3 7.08e-14 74 26 9 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FYX2 7.08e-14 74 26 9 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium botulinum (strain ATCC 19397 / Type A)
C3KV11 7.15e-14 74 26 9 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Clostridium botulinum (strain 657 / Type Ba4)
A7HH69 8.39e-14 74 30 13 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Anaeromyxobacter sp. (strain Fw109-5)
Q1D0T2 9.88e-14 74 29 10 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Myxococcus xanthus (strain DK1622)
B3E3Y0 1.38e-13 73 28 9 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q7UA72 1.54e-13 73 27 9 296 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Parasynechococcus marenigrum (strain WH8102)
B0T826 1.57e-13 73 29 7 297 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Caulobacter sp. (strain K31)
Q45305 1.94e-13 71 28 7 226 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase (Fragment) Bacillus licheniformis
Q2Y640 2.17e-13 73 27 8 297 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q3ANM5 2.97e-13 72 24 8 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Synechococcus sp. (strain CC9605)
Q7UVF9 4.21e-13 72 24 8 319 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q660S4 4.58e-13 72 24 12 342 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q9K9T1 4.72e-13 72 26 8 285 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B8J8F0 9.37e-13 71 27 8 301 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q3SMH1 1.12e-12 71 27 14 331 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Thiobacillus denitrificans (strain ATCC 25259)
A5CD21 1.26e-12 70 29 10 291 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Orientia tsutsugamushi (strain Boryong)
O51544 1.27e-12 70 24 12 341 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q1RHX1 1.37e-12 70 25 8 304 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia bellii (strain RML369-C)
Q03SJ8 1.55e-12 70 29 8 234 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
A8YUF1 1.6e-12 70 23 9 329 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Lactobacillus helveticus (strain DPC 4571)
P18579 1.69e-12 70 24 8 310 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bacillus subtilis (strain 168)
B8G5Y4 2.1e-12 70 24 7 334 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chloroflexus aggregans (strain MD-66 / DSM 9485)
A8GW95 2.22e-12 70 25 11 314 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia bellii (strain OSU 85-389)
Q2IG34 2.26e-12 70 27 8 301 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q2G993 2.33e-12 70 28 9 298 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q728V0 2.47e-12 70 26 9 291 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B4UES3 2.88e-12 70 27 10 304 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Anaeromyxobacter sp. (strain K)
A5D143 5.3e-12 69 29 5 227 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A4J2B3 5.52e-12 68 27 8 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q4FPK7 8.42e-12 68 23 9 326 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pelagibacter ubique (strain HTCC1062)
A8F4M2 1.4e-11 67 25 10 328 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q2NCY8 2.04e-11 67 27 9 303 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Erythrobacter litoralis (strain HTCC2594)
Q732F9 2.98e-11 67 25 7 290 3 murB1 UDP-N-acetylenolpyruvoylglucosamine reductase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
C0R2M2 3.09e-11 66 25 4 231 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
A4YZK1 3.59e-11 66 27 10 290 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bradyrhizobium sp. (strain ORS 278)
Q5FL42 4.91e-11 66 23 12 329 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B3CPS8 1.04e-10 65 24 5 229 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q1GIU8 1.06e-10 65 28 5 223 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Ruegeria sp. (strain TM1040)
Q74K66 1.25e-10 65 23 7 315 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q82VS1 1.28e-10 65 26 9 312 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q2RK77 1.46e-10 64 28 10 301 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q81WD1 1.57e-10 64 24 7 290 3 murB1 UDP-N-acetylenolpyruvoylglucosamine reductase 1 Bacillus anthracis
Q1GRY1 1.69e-10 64 27 10 290 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q163J3 1.85e-10 64 24 8 307 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q03VW0 2.8e-10 63 28 6 231 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q6HEQ5 2.84e-10 63 24 7 290 3 murB1 UDP-N-acetylenolpyruvoylglucosamine reductase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q636B7 3.11e-10 63 24 7 290 3 murB1 UDP-N-acetylenolpyruvoylglucosamine reductase 1 Bacillus cereus (strain ZK / E33L)
Q5FUJ3 3.17e-10 63 28 7 227 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Gluconobacter oxydans (strain 621H)
P61435 3.93e-10 63 26 9 307 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q7V3P9 4.07e-10 63 22 7 339 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q0A6K4 5.83e-10 63 27 10 313 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q819Q4 6.24e-10 63 23 7 290 3 murB1 UDP-N-acetylenolpyruvoylglucosamine reductase 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A1BAL1 7.77e-10 62 28 7 224 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Paracoccus denitrificans (strain Pd 1222)
Q3KKK8 1.1e-09 62 24 8 333 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
A0L5M9 1.27e-09 62 25 10 301 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B0BAT9 1.59e-09 61 24 8 333 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B960 1.59e-09 61 24 8 333 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q0BV27 1.7e-09 61 25 11 316 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q042G6 2.01e-09 61 24 9 316 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q0AJE3 2.14e-09 61 26 10 314 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
P0CD77 2.42e-09 61 24 12 336 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
A5VDC3 3.52e-09 60 27 11 308 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B4RFG1 4.72e-09 60 27 8 298 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Phenylobacterium zucineum (strain HLK1)
A8EXZ7 5.42e-09 60 27 11 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rickettsia canadensis (strain McKiel)
Q133X3 1.83e-08 58 25 8 299 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rhodopseudomonas palustris (strain BisB5)
A5FUL2 1.99e-08 58 27 10 307 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Acidiphilium cryptum (strain JF-5)
A8LS61 2.35e-08 58 28 7 229 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q3STS5 2.66e-08 58 27 10 299 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q2W0H1 2.74e-08 58 27 11 290 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9RWN8 2.95e-08 57 24 10 298 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q9RNM8 5.73e-08 57 26 10 291 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q5LU58 6.33e-08 57 27 6 224 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1QNU0 6.76e-08 57 26 8 294 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A5EPK0 1e-07 56 26 10 290 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q5GRK8 1.54e-07 55 23 9 314 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Wolbachia sp. subsp. Brugia malayi (strain TRS)
A5IAW3 1.61e-07 55 26 11 307 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Legionella pneumophila (strain Corby)
Q5ZSA6 1.76e-07 55 26 11 307 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q2IYK4 1.77e-07 55 24 8 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rhodopseudomonas palustris (strain HaA2)
Q5PAK9 1.77e-07 55 27 7 232 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Anaplasma marginale (strain St. Maries)
B9KIR5 1.77e-07 55 27 7 232 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Anaplasma marginale (strain Florida)
Q5WTI8 1.84e-07 55 26 11 307 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Legionella pneumophila (strain Lens)
Q5HSB7 1.86e-07 55 24 8 259 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Campylobacter jejuni (strain RM1221)
A9KER1 2.17e-07 55 25 11 309 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Coxiella burnetii (strain Dugway 5J108-111)
Q28NP1 2.32e-07 55 25 11 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Jannaschia sp. (strain CCS1)
O83128 3.03e-07 55 24 9 347 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Treponema pallidum (strain Nichols)
B6J5K1 4.03e-07 54 25 11 309 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Coxiella burnetii (strain CbuK_Q154)
Q83F16 4.21e-07 54 25 11 309 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NA46 4.21e-07 54 25 11 309 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J2Q1 5.74e-07 54 25 11 309 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Coxiella burnetii (strain CbuG_Q212)
A4WQD8 6.17e-07 53 24 8 308 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q0AMW9 6.31e-07 53 27 12 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Maricaulis maris (strain MCS10)
B9KNK2 1.28e-06 53 24 7 298 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q211U0 2.1e-06 52 28 9 222 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Rhodopseudomonas palustris (strain BisB18)
Q3J4L9 2.26e-06 52 24 7 298 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PHT1 2.71e-06 52 24 7 298 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q98KB5 4.08e-06 51 26 9 307 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9PM01 4.19e-06 51 23 9 292 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q11GS7 1.19e-05 50 26 8 305 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Chelativorans sp. (strain BNC1)
Q72JP7 4.55e-05 48 25 9 306 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SJC8 4.72e-05 48 25 10 305 1 murB UDP-N-acetylenolpyruvoylglucosamine reductase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A9IWA3 5.38e-05 48 26 9 302 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q1IXV7 5.81e-05 47 23 9 298 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q0IE56 9.03e-05 47 25 9 300 3 murB UDP-N-acetylenolpyruvoylglucosamine reductase Synechococcus sp. (strain CC9311)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_20340
Feature type CDS
Gene murB
Product UDP-N-acetylmuramate dehydrogenase
Location 521 - 1558 (strand: 1)
Length 1038 (nucleotides) / 345 (amino acids)
In genomic island -

Contig

Accession contig_51
Length 4582 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2472
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01565 FAD binding domain
PF02873 UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0812 Cell wall/membrane/envelope biogenesis (M) M UDP-N-acetylenolpyruvoylglucosamine reductase

Kegg Ortholog Annotation(s)

Protein Sequence

MSLKPADSLRQLHTFGIEAGARHIDVAETISDLCRLWLAAQTEKSPFLLLGGGSNVLFTENFNGTVVINRIPGKTVRETPDVWFIEVGAGENWHELIRWMLANSIYGMENLALIPGCAGTAPIQNIGAYGTEFKDVCDYVDVTSLSDGQTTRLTAEECRFGYRDSIFKHDYQQGYAITAVGLKLPKVWKPNLSYGDLKSLDPATVTPQQVFDMVCQMRMSKLPDPAVTGNAGSFFKNPVVTAECAQKIKAQYPDCPQYVVADGIKLAAGWLIDQCQLKGHQEGGAAVHMNQALVLINRDNATGDDVIRLARYVRQQVAARFGVQLEPEVRFIGTDGEICATEAIA

Flanking regions ( +/- flanking 50bp)

TCTGCGGACTGATAAACTAGACAGCATATTTGTCAGATGAGTTTTTCATTATGTCCCTCAAACCTGCTGATTCACTCCGCCAGTTACATACATTTGGTATCGAAGCCGGTGCCCGGCATATTGATGTCGCAGAGACCATTTCTGATCTCTGCCGCTTATGGCTGGCTGCACAAACGGAAAAATCCCCCTTCCTGCTGTTAGGCGGCGGCAGTAATGTACTGTTTACTGAGAATTTCAATGGCACCGTTGTCATTAACCGGATCCCCGGCAAGACCGTCCGGGAAACACCGGATGTCTGGTTTATCGAAGTTGGTGCCGGCGAAAACTGGCATGAATTAATCCGCTGGATGCTGGCGAACAGTATTTACGGCATGGAAAACCTGGCGCTGATCCCGGGCTGTGCCGGTACTGCACCGATTCAGAATATCGGGGCATACGGTACCGAATTTAAAGACGTATGTGACTATGTGGATGTCACCTCTCTGTCAGACGGGCAGACAACACGCCTGACTGCAGAGGAATGTCGCTTTGGCTACCGTGACAGTATTTTCAAACATGATTATCAGCAGGGATATGCTATCACAGCGGTGGGACTGAAACTGCCGAAAGTATGGAAACCGAATCTGAGCTACGGTGATTTGAAATCGCTGGATCCAGCGACTGTCACACCTCAGCAGGTATTTGATATGGTCTGTCAGATGCGGATGAGCAAACTGCCGGATCCGGCTGTAACCGGCAATGCAGGCAGCTTTTTTAAAAATCCGGTTGTGACTGCTGAGTGTGCGCAGAAAATCAAAGCACAGTATCCGGACTGCCCGCAGTATGTGGTGGCGGACGGAATCAAACTCGCTGCCGGCTGGCTTATCGACCAGTGTCAGCTGAAAGGCCATCAGGAAGGTGGTGCAGCGGTGCATATGAACCAGGCGCTGGTATTGATTAACCGTGATAATGCAACAGGTGATGATGTTATCCGTCTCGCCCGTTATGTCCGTCAGCAGGTTGCTGCCCGTTTCGGGGTTCAGCTGGAGCCGGAAGTCCGTTTTATCGGCACGGACGGTGAAATCTGTGCCACAGAGGCTATTGCATGAAAGATTACAGTGTACCGCTGACGCTGATCGGCATTTTATCCGACGGTGAG