Homologs in group_3105

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_16885 EHELCC_16885 100.0 Morganella morganii S2 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
NLDBIP_17565 NLDBIP_17565 100.0 Morganella morganii S4 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
LHKJJB_17485 LHKJJB_17485 100.0 Morganella morganii S3 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
HKOGLL_17300 HKOGLL_17300 100.0 Morganella morganii S5 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
F4V73_RS10395 F4V73_RS10395 87.3 Morganella psychrotolerans - PLP-dependent aminotransferase family protein

Distribution of the homologs in the orthogroup group_3105

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3105

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P49309 3.12e-93 295 35 5 470 3 mocR Probable rhizopine catabolism regulatory protein MocR Rhizobium meliloti
P96669 6.15e-72 238 29 6 471 3 ydeL Uncharacterized HTH-type transcriptional regulator YdeL Bacillus subtilis (strain 168)
O07578 7.03e-72 238 30 7 472 3 yhdI Uncharacterized HTH-type transcriptional regulator YhdI Bacillus subtilis (strain 168)
P94426 2.46e-67 227 31 11 485 1 gabR HTH-type transcriptional regulatory protein GabR Bacillus subtilis (strain 168)
Q796Q6 5.99e-45 167 28 7 393 3 yisV Uncharacterized HTH-type transcriptional regulator YisV Bacillus subtilis (strain 168)
H3ZPL1 1.43e-43 162 25 1 363 1 OCC_04335 Aromatic-amino-acid aminotransferase 1 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
P96681 1.95e-42 160 29 8 408 3 ydfD Uncharacterized HTH-type transcriptional regulator YdfD Bacillus subtilis (strain 168)
Q8NS92 2.34e-41 157 28 13 464 3 pdxR HTH-type pyridoxine biosynthesis transcriptional regulator PdxR Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
D5AKX9 4.07e-38 148 31 4 394 1 tauR HTH-type transcriptional regulator TauR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P77730 3.96e-37 145 27 10 473 3 ydcR Uncharacterized HTH-type transcriptional regulator YdcR Escherichia coli (strain K12)
Q08792 3.38e-33 134 23 7 469 3 ycxD Uncharacterized HTH-type transcriptional regulator YcxD Bacillus subtilis (strain 168)
P95957 1.33e-31 129 24 3 357 3 SSO0104 Uncharacterized aminotransferase SSO0104 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q72LL6 1.41e-29 123 26 5 362 1 lysN 2-aminoadipate transaminase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
P39389 1.34e-25 112 26 13 440 3 yjiR Uncharacterized HTH-type transcriptional regulator YjiR Escherichia coli (strain K12)
Q5HJR1 1.68e-24 109 21 7 371 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain COL)
Q2G1P1 1.68e-24 109 21 7 371 1 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKF1 1.68e-24 109 21 7 371 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain USA300)
Q7A875 2.69e-24 108 21 7 371 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain N315)
Q99XA5 2.69e-24 108 21 7 371 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YUS3 3.1e-24 108 21 8 372 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8N5Z0 6.68e-19 92 25 8 314 1 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Homo sapiens
Q5E9N4 1.39e-15 82 24 8 316 2 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Bos taurus
P96663 1.54e-15 82 21 9 398 3 ydeF Uncharacterized HTH-type transcriptional regulator YdeF Bacillus subtilis (strain 168)
Q54K00 5.07e-15 80 19 7 327 3 DDB_G0287711 Aromatic amino acid aminotransferase DDB_G0287711 Dictyostelium discoideum
Q01856 1.45e-14 79 23 9 474 3 RHOS4_30730 Uncharacterized HTH-type transcriptional regulator RHOS4_30730 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A7XRY8 6.97e-14 77 24 8 282 1 tdiD Aminotransferase tdiD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O94570 9.17e-14 77 26 6 269 3 SPBC1773.13 Aromatic amino acid aminotransferase C1773.13 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
D4AU29 2.76e-13 75 26 7 251 3 swnA Aminotransferase swnA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q9WVM8 1.42e-12 73 23 5 252 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Mus musculus
P16524 2.11e-12 72 27 6 218 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
Q86AG8 9.32e-12 70 22 13 377 3 DDB_G0272014 Aromatic amino acid aminotransferase DDB_G0272014 Dictyostelium discoideum
O58489 2.55e-11 68 26 11 249 3 aspC Aspartate aminotransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q64602 4.8e-11 68 24 5 265 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Rattus norvegicus
O14192 7.18e-11 67 24 9 268 3 SPAC56E4.03 Aromatic amino acid aminotransferase C56E4.03 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q60013 7.21e-11 67 25 6 261 3 aspC Aspartate aminotransferase Streptomyces virginiae
P40193 9.68e-11 67 23 13 411 1 ptsJ Vitamin B6 salvage pathway transcriptional repressor PtsJ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9Y7S6 4.91e-10 65 23 8 249 3 SPCC569.07 Aromatic amino acid aminotransferase C569.07 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O52815 1.29e-09 63 30 5 175 1 hpgT (S)-3,5-dihydroxyphenylglycine transaminase Amycolatopsis orientalis
H3ZPU1 9.99e-09 60 27 8 198 1 OCC_04737 Aromatic-amino-acid aminotransferase 2 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q9HUI9 3.07e-08 59 24 11 301 1 aruH Arginine--pyruvate transaminase AruH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q82DR2 4.58e-08 58 25 4 196 1 aspC1 Aspartate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q60317 5e-08 58 23 5 193 3 MJ0001 Probable aspartate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P04694 6.67e-08 58 25 4 184 1 Tat Tyrosine aminotransferase Rattus norvegicus
Q9LVY1 9.09e-08 58 26 8 199 1 TAT Tyrosine aminotransferase Arabidopsis thaliana
Q9SIE1 1.08e-07 57 25 10 259 1 PAT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Arabidopsis thaliana
Q8QZR1 1.22e-07 57 24 4 184 1 Tat Tyrosine aminotransferase Mus musculus
Q58CZ9 1.35e-07 57 23 4 184 2 TAT Tyrosine aminotransferase Bos taurus
P17735 2.38e-07 56 24 4 184 1 TAT Tyrosine aminotransferase Homo sapiens
P14909 2.46e-07 56 23 6 198 1 aspC Aspartate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P0ACL8 3.26e-07 55 42 0 64 3 lldR Putative L-lactate dehydrogenase operon regulatory protein Shigella flexneri
P0ACL7 3.26e-07 55 42 0 64 2 lldR Putative L-lactate dehydrogenase operon regulatory protein Escherichia coli (strain K12)
P36692 3.38e-07 54 29 4 144 3 aspC Probable aspartate aminotransferase (Fragment) Streptomyces griseus
Q795M6 4.13e-07 55 22 8 254 3 yugH Putative aminotransferase YugH Bacillus subtilis (strain 168)
A6L2V8 4.28e-07 55 26 10 256 3 hisC Histidinol-phosphate aminotransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
O34712 6.24e-07 52 28 0 88 2 ytrA HTH-type transcriptional repressor YtrA Bacillus subtilis (strain 168)
O87320 7.14e-07 55 27 8 248 3 aatC Putative aminotransferase AatC Rhizobium meliloti (strain 1021)
A0A0P0VI36 1.39e-06 54 23 5 181 1 NAAT1 Nicotianamine aminotransferase 1 Oryza sativa subsp. japonica
E9F8L8 1.61e-06 54 27 8 211 1 swnA Aminotransferase swnA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
O86331 1.94e-06 53 44 0 63 1 Rv0792c HTH-type transcriptional regulator Rv0792c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5F4K8 2.62e-06 53 25 11 269 1 AAT Aspartate aminotransferase Pinus pinaster
B2A250 3.1e-06 53 23 9 263 3 dapL LL-diaminopimelate aminotransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q9FN30 4.79e-06 52 24 4 190 2 At5g53970 Probable aminotransferase TAT2 Arabidopsis thaliana
Q9X0Y2 5.65e-06 52 22 3 188 1 aspC Aspartate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
E9L7A5 6.5e-06 52 24 9 248 1 PPA-AT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Petunia hybrida
Q8EQB9 8.78e-06 51 24 6 210 3 hisC2 Histidinol-phosphate aminotransferase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q3IRT1 9.16e-06 51 23 11 277 3 hisC Histidinol-phosphate aminotransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
P0CL10 1.39e-05 50 38 0 68 3 pdhR Pyruvate dehydrogenase complex repressor Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1W823 1.39e-05 50 38 0 68 3 pdhR Pyruvate dehydrogenase complex repressor Salmonella typhimurium (strain SL1344)
P0A2S3 1.39e-05 50 38 0 68 3 pdhR Pyruvate dehydrogenase complex repressor Salmonella typhi
P0ACL9 1.39e-05 50 38 0 68 1 pdhR Pyruvate dehydrogenase complex repressor Escherichia coli (strain K12)
P0ACM0 1.39e-05 50 38 0 68 3 pdhR Pyruvate dehydrogenase complex repressor Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACM1 1.39e-05 50 38 0 68 3 pdhR Pyruvate dehydrogenase complex repressor Escherichia coli O157:H7
Q18F03 1.96e-05 50 23 13 273 3 hisC Histidinol-phosphate aminotransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
P58350 2.11e-05 50 25 10 227 1 aatB Aspartate aminotransferase Rhizobium meliloti (strain 1021)
Q8KDS8 2.34e-05 50 21 7 253 1 CT0966 Aspartate/prephenate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8FY98 2.37e-05 50 29 8 189 3 hisC Histidinol-phosphate aminotransferase Brucella suis biovar 1 (strain 1330)
A5VSV7 2.37e-05 50 29 8 189 3 hisC Histidinol-phosphate aminotransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57AR7 2.37e-05 50 29 8 189 3 hisC Histidinol-phosphate aminotransferase Brucella abortus biovar 1 (strain 9-941)
Q2YR81 2.37e-05 50 29 8 189 3 hisC Histidinol-phosphate aminotransferase Brucella abortus (strain 2308)
Q8YJK3 2.98e-05 50 29 8 189 3 hisC Histidinol-phosphate aminotransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A4IQ80 3.46e-05 49 24 3 182 3 hisC Histidinol-phosphate aminotransferase Geobacillus thermodenitrificans (strain NG80-2)
Q06191 3.52e-05 49 25 10 227 1 aatB Aspartate aminotransferase Rhizobium meliloti
Q84CG1 4.62e-05 49 27 7 194 1 vioD Capreomycidine synthase Streptomyces vinaceus
P67740 5.52e-05 48 36 0 66 4 BQ2027_MB0505 Uncharacterized HTH-type transcriptional regulator Mb0505 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMG7 5.52e-05 48 36 0 66 1 Rv0494 Uncharacterized HTH-type transcriptional regulator Rv0494 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMG6 5.52e-05 48 36 0 66 4 MT0514 Uncharacterized HTH-type transcriptional regulator MT0514 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q56232 6.56e-05 48 23 9 265 1 aspC Aspartate/prephenate aminotransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q67Y55 0.0001 48 21 3 182 2 At4g28420 Probable aminotransferase TAT1 Arabidopsis thaliana
P39643 0.000104 48 23 8 247 1 bacF Transaminase BacF Bacillus subtilis (strain 168)
F8P1W6 0.000117 48 23 4 174 2 amt1 L-tyrosine:2-oxoglutarate aminotransferase amt1 Serpula lacrymans var. lacrymans (strain S7.9)
P10356 0.000122 48 24 4 176 1 YER152C Uncharacterized protein YER152C Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9X9E0 0.000127 47 27 2 119 4 exuR Exu regulon transcriptional regulator Dickeya chrysanthemi
P39161 0.000129 47 28 1 96 4 uxuR Uxu operon transcriptional regulator Escherichia coli (strain K12)
Q8DTM1 0.000129 48 22 4 199 1 aspB Asparagine--oxo-acid transaminase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O33822 0.000138 47 22 13 341 3 aspC Probable aspartate/prephenate aminotransferase Thermus aquaticus
Q9SK47 0.00014 48 20 7 245 2 TAT3 Probable aminotransferase TAT3 Arabidopsis thaliana
C6C2Z3 0.000142 47 21 8 236 1 Dd703_1457 Aspartate aminotransferase Musicola paradisiaca (strain Ech703)
O34817 0.000223 46 34 0 79 1 nagR HTH-type transcriptional repressor NagR Bacillus subtilis (strain 168)
A3PMF8 0.000264 47 26 8 198 1 Rsph17029_2422 Aspartate/prephenate aminotransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q5KXV3 0.000438 46 24 7 183 3 hisC Histidinol-phosphate aminotransferase Geobacillus kaustophilus (strain HTA426)
P77806 0.00045 46 20 12 338 1 ybdL Methionine aminotransferase Escherichia coli (strain K12)
P67742 0.000567 45 33 0 66 4 BQ2027_MB0601 Uncharacterized HTH-type transcriptional regulator Mb0601 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMG5 0.000567 45 33 0 66 1 mce2R HTH-type transcriptional regulator Mce2R Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMG4 0.000567 45 33 0 66 3 mce2R HTH-type transcriptional regulator Mce2R Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0ACL4 0.000632 45 28 1 103 3 exuR Exu regulon transcriptional regulator Shigella flexneri
P0ACL2 0.000632 45 28 1 103 4 exuR Exu regulon transcriptional regulator Escherichia coli (strain K12)
P0ACL3 0.000632 45 28 1 103 3 exuR Exu regulon transcriptional regulator Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_19595
Feature type CDS
Gene aRO8
Product DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
Location 3509 - 4996 (strand: 1)
Length 1488 (nucleotides) / 495 (amino acids)

Contig

Accession contig_42
Length 20536 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3105
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II
PF00392 Bacterial regulatory proteins, gntR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1167 Transcription (K)
Amino acid transport and metabolism (E)		 KE DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00375 GntR family transcriptional regulator / MocR family aminotransferase - -

Protein Sequence

MRKSGAAAFPELLTGNGIIKDQVYHALREAILSGRLHAGSKVPSGRALAEMMGISRNSVIAGFERLQDEGYLITRRGAGTFVADNLPDHAISGPVASPADETGELVTANISPLAETLLSQRVASGAPSDALFMVGTGCVDLFPHDVWGRLLGRVWRQSRYALHTHSEPHGYLPLRRAICHYVRATRGLQCDEDQILIVNGTQQAINLTVQTLLQPGDEVWLDDPGYDGARGAFLSQRLTVRPVRADEEGMDVYDGLRRWPDAKLVFTAPSHQFPGGGTLSLARRSALLSWAAKHHVWILEDDYNGEFRYADRPLQALQGLDRHQRVIYAGTFSKMLYPAFRLGFLVVPKALIPAFEVTKYYADTGCGYLEQATLTRFINEGHYARHVRRVRKACYERRQAVTDAISQYLPALLAIVPSDSGIHLLCRMKNGVPAQTVIQAGQQCGMGMQPLARYCRPDAPQEGVLFGFAAYPAEKLTDGIRRLAEALQAQGVVTV

Flanking regions ( +/- flanking 50bp)

CTTTATAAGATACACTTTTTATATTTTTAACAGATCCACTTCAGGCCACTATGCGAAAATCCGGCGCGGCAGCGTTTCCCGAATTACTGACAGGTAACGGGATCATCAAAGATCAGGTGTATCACGCTCTGCGTGAGGCGATCCTCAGCGGCCGCCTGCATGCGGGCAGCAAAGTACCGTCCGGGCGGGCGCTGGCGGAGATGATGGGGATCTCCCGTAACTCGGTGATTGCCGGGTTTGAGCGGTTGCAGGATGAGGGTTATCTCATCACCCGGCGCGGCGCGGGTACCTTTGTGGCGGATAATCTGCCGGATCACGCCATCAGCGGACCGGTGGCATCCCCGGCGGATGAAACCGGGGAACTGGTAACCGCCAATATCAGCCCGCTGGCAGAAACATTGCTGTCGCAGCGTGTTGCATCCGGTGCGCCGTCCGATGCACTGTTTATGGTCGGTACCGGATGTGTGGATCTGTTTCCGCATGATGTCTGGGGGCGGCTGCTCGGCCGTGTCTGGCGTCAGTCCCGCTATGCGCTGCATACGCACAGTGAGCCGCACGGCTACCTGCCGCTGCGCCGGGCAATCTGTCATTATGTCCGTGCCACCCGCGGATTGCAGTGCGATGAGGACCAGATCCTGATTGTCAACGGCACCCAGCAGGCGATTAACCTGACAGTGCAGACGCTGTTACAGCCCGGGGATGAAGTCTGGCTGGATGACCCCGGCTATGATGGTGCGCGCGGGGCGTTTTTATCACAGCGGCTGACAGTACGTCCGGTACGCGCGGATGAAGAGGGCATGGATGTGTATGACGGCCTGCGCCGCTGGCCGGACGCGAAACTGGTGTTCACCGCACCGTCACATCAGTTTCCCGGCGGCGGCACACTCAGCCTGGCCCGGCGATCGGCGCTGCTCTCCTGGGCGGCAAAACACCATGTCTGGATCCTGGAGGATGATTATAACGGTGAGTTCCGTTATGCCGATCGTCCGCTTCAGGCATTGCAGGGGCTGGACAGGCATCAGCGGGTGATTTATGCGGGAACGTTTTCCAAAATGCTCTATCCGGCCTTCCGGCTGGGATTTCTCGTCGTACCGAAAGCGCTGATCCCGGCCTTTGAGGTGACAAAATATTATGCCGATACCGGCTGCGGCTATCTGGAGCAGGCCACGCTGACCCGGTTTATTAACGAAGGGCACTATGCGCGGCATGTGCGCCGGGTACGCAAAGCCTGTTATGAGCGGCGGCAGGCGGTGACGGATGCCATCAGTCAGTATCTTCCTGCGCTGCTGGCGATTGTCCCGAGTGACTCGGGGATCCACCTGTTATGCAGGATGAAAAACGGTGTTCCGGCACAGACGGTGATTCAGGCGGGACAGCAGTGCGGTATGGGCATGCAGCCGCTGGCCCGTTACTGCCGCCCGGATGCACCGCAGGAAGGGGTTTTGTTCGGGTTTGCCGCCTATCCGGCGGAGAAACTCACCGATGGCATCCGCCGCCTCGCGGAGGCGTTACAGGCTCAGGGTGTGGTGACGGTTTAGAACAGATTCAGTGTCATCATCACTGCGCTGCACAGGATAAGGATCAGCGT