Homologs in group_3578

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_19295 EHELCC_19295 100.0 Morganella morganii S2 - Phage tail protein
NLDBIP_19425 NLDBIP_19425 100.0 Morganella morganii S4 - Phage tail protein
LHKJJB_19380 LHKJJB_19380 100.0 Morganella morganii S3 - Phage tail protein
HKOGLL_19230 HKOGLL_19230 100.0 Morganella morganii S5 - Phage tail protein

Distribution of the homologs in the orthogroup group_3578

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3578

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_19365
Feature type CDS
Gene -
Product Phage tail protein
Location 7825 - 8175 (strand: -1)
Length 351 (nucleotides) / 116 (amino acids)
In genomic island -

Contig

Accession contig_40
Length 21612 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3578
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF16462 Phage tail assembly chaperone protein, TAC

Protein Sequence

MKGLKASLLAAKPEIREVEILCGVKVNIRRMTANELITLEQEVADLNMDGKVREASLMNVDMLLNCIVDDGGKPVDKSLLPTADEMVNVHDNAILIDAINIVKRHSVGTLEEAKKN

Flanking regions ( +/- flanking 50bp)

TGGGGTGTTGCAGGTGCTGCGGGTGATCAGACCAAAGGAGCAACAAAATAATGAAAGGCCTGAAAGCATCACTGCTGGCGGCAAAGCCGGAAATCCGTGAAGTGGAAATCCTCTGCGGGGTTAAGGTAAATATCCGCCGTATGACCGCCAATGAGTTGATCACCCTGGAGCAGGAAGTAGCCGATCTGAACATGGACGGTAAAGTGCGCGAAGCGTCTCTGATGAACGTCGATATGCTGCTGAACTGCATTGTTGATGACGGCGGTAAACCGGTTGATAAATCACTGCTGCCGACCGCTGATGAAATGGTGAATGTTCATGACAACGCCATTCTGATCGATGCCATTAACATCGTGAAACGACACTCTGTCGGTACGCTCGAAGAGGCAAAAAAAAACTGACGGACAGCCCGTTGCTTTTCTTTGCTCACCAACTCGCGGAAGAGCTCAAA