Homologs in group_2283

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_18030 EHELCC_18030 100.0 Morganella morganii S2 secE preprotein translocase subunit SecE
NLDBIP_18120 NLDBIP_18120 100.0 Morganella morganii S4 secE preprotein translocase subunit SecE
LHKJJB_18315 LHKJJB_18315 100.0 Morganella morganii S3 secE preprotein translocase subunit SecE
HKOGLL_17885 HKOGLL_17885 100.0 Morganella morganii S5 secE preprotein translocase subunit SecE
F4V73_RS14930 F4V73_RS14930 96.0 Morganella psychrotolerans secE preprotein translocase subunit SecE
PMI_RS13785 PMI_RS13785 76.0 Proteus mirabilis HI4320 secE preprotein translocase subunit SecE

Distribution of the homologs in the orthogroup group_2283

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2283

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A2D3 3.13e-62 189 76 0 125 3 secE Protein translocase subunit SecE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D4 3.13e-62 189 76 0 125 3 secE Protein translocase subunit SecE Salmonella typhi
P0AG96 1.27e-55 172 74 0 125 1 secE Protein translocase subunit SecE Escherichia coli (strain K12)
P0AG97 1.27e-55 172 74 0 125 3 secE Protein translocase subunit SecE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AG98 1.27e-55 172 74 0 125 3 secE Protein translocase subunit SecE Escherichia coli O157:H7
Q9KV36 1.33e-41 137 55 0 120 3 secE Protein translocase subunit SecE Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9ZNE7 9.55e-34 117 56 0 120 3 secE Protein translocase subunit SecE Vibrio alginolyticus
P57152 6.15e-23 89 31 0 124 3 secE Protein translocase subunit SecE Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8KA64 9.92e-23 89 32 0 124 3 secE Protein translocase subunit SecE Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P43805 2.17e-17 74 36 1 102 3 secE Protein translocase subunit SecE Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HWC3 1.01e-16 73 46 1 94 3 secE Protein translocase subunit SecE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q89B14 3.38e-15 69 35 0 109 3 secE Protein translocase subunit SecE Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_17545
Feature type CDS
Gene secE
Product preprotein translocase subunit SecE
Location 1024 - 1401 (strand: 1)
Length 378 (nucleotides) / 125 (amino acids)

Contig

Accession contig_29
Length 39360 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2283
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00584 SecE/Sec61-gamma subunits of protein translocation complex

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0690 Intracellular trafficking, secretion, and vesicular transport (U) U Preprotein translocase subunit SecE

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03073 preprotein translocase subunit SecE Quorum sensing
Protein export
Bacterial secretion system
-

Protein Sequence

MSANSEAQQNGRGADIAKWLVVAVLLIAAIGGNYYFREFNLALRALAVVVVIALAGGIALWTTKGKATLTFAREARVEMRKVIWPTRQETLHTTLIVAAVTAVMSLVLWGLDGILVRLVSYITSF

Flanking regions ( +/- flanking 50bp)

CAGCGAGGCAGTCCGGCTGACTTTTTTATTTCATGGTTACAGGTTGGTTTATGAGTGCGAATAGCGAAGCTCAACAAAACGGCCGTGGTGCTGACATTGCCAAATGGTTAGTGGTCGCAGTTCTGCTGATCGCTGCTATCGGCGGTAACTACTACTTCCGCGAATTTAATCTCGCGCTGCGTGCGCTGGCAGTTGTTGTCGTCATCGCATTAGCCGGTGGTATTGCACTGTGGACAACGAAAGGCAAAGCGACACTGACTTTTGCCCGCGAAGCACGGGTTGAAATGCGTAAAGTGATCTGGCCTACACGTCAGGAAACACTGCATACAACACTGATCGTTGCGGCAGTCACAGCGGTTATGTCGTTAGTGTTATGGGGCCTTGATGGTATCCTTGTCCGTCTTGTTTCCTATATAACATCCTTCTGAGGTTCTAAAGATGTCGGATTCTCCTAAAAAACGTTGGTATGTCATCCAGG