Homologs in group_2947

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_15875 EHELCC_15875 100.0 Morganella morganii S2 tar Methyl-accepting chemotaxis protein (MCP)
NLDBIP_16495 NLDBIP_16495 100.0 Morganella morganii S4 tar Methyl-accepting chemotaxis protein (MCP)
LHKJJB_16310 LHKJJB_16310 100.0 Morganella morganii S3 tar Methyl-accepting chemotaxis protein (MCP)
HKOGLL_16080 HKOGLL_16080 100.0 Morganella morganii S5 tar Methyl-accepting chemotaxis protein (MCP)
F4V73_RS17630 F4V73_RS17630 84.6 Morganella psychrotolerans - methyl-accepting chemotaxis protein

Distribution of the homologs in the orthogroup group_2947

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2947

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P07018 1.42e-70 233 39 1 338 1 tap Methyl-accepting chemotaxis protein IV Escherichia coli (strain K12)
P21823 3.51e-67 224 40 1 317 3 tas Methyl-accepting chemotaxis aspartate transducer Klebsiella aerogenes (strain ATCC 13048 / DSM 30053 / CCUG 1429 / JCM 1235 / KCTC 2190 / NBRC 13534 / NCIMB 10102 / NCTC 10006 / CDC 819-56)
P07017 2.23e-66 223 43 0 275 1 tar Methyl-accepting chemotaxis protein II Escherichia coli (strain K12)
P02941 6.92e-65 219 44 0 275 1 tar Methyl-accepting chemotaxis protein II Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P02942 9.3e-62 211 41 0 294 1 tsr Methyl-accepting chemotaxis protein I Escherichia coli (strain K12)
P21822 1.7e-61 210 41 0 295 3 tse Methyl-accepting chemotaxis serine transducer Klebsiella aerogenes (strain ATCC 13048 / DSM 30053 / CCUG 1429 / JCM 1235 / KCTC 2190 / NBRC 13534 / NCIMB 10102 / NCTC 10006 / CDC 819-56)
Q02755 4.72e-59 203 38 0 307 3 tcp Methyl-accepting chemotaxis citrate transducer Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P05704 9.81e-58 200 35 1 328 1 trg Methyl-accepting chemotaxis protein III Escherichia coli (strain K12)
Q9I6V6 2.14e-56 199 45 0 251 1 mcpB Methyl-accepting chemotaxis protein McpB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q00986 1.98e-42 160 33 1 303 3 mcpA Chemoreceptor McpA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P50466 3.17e-40 152 34 2 332 1 aer Aerotaxis receptor Escherichia coli (strain K12)
Q02929 8.23e-34 135 35 2 258 3 Cthe_0039 Putative sensory transducer protein Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
P55439 2.96e-30 126 32 4 298 3 NGR_a03800 Probable chemoreceptor y4fA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P39214 5.34e-28 119 27 6 360 1 mcpA Methyl-accepting chemotaxis protein McpA Bacillus subtilis (strain 168)
Q88KP1 3.56e-27 116 29 5 347 1 mcpA Methyl-accepting chemotaxis protein McpA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q882Z2 1.02e-26 115 28 9 339 3 pscA Methyl-accepting chemotaxis protein PscA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P39217 3.31e-26 114 26 6 356 3 tlpB Methyl-accepting chemotaxis protein TlpB Bacillus subtilis (strain 168)
P39216 4.55e-26 113 26 9 390 3 tlpA Methyl-accepting chemotaxis protein TlpA Bacillus subtilis (strain 168)
P55652 5.45e-26 113 37 1 181 3 NGR_a01640 Probable chemoreceptor y4sI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9X1E2 4.23e-25 110 28 5 318 1 mcp4 Methyl-accepting chemotaxis protein 4 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q6HNQ4 1.17e-24 109 31 2 247 3 BT9727_0469 Probable methyl-accepting chemotaxis protein BT9727_0469 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q9X0M7 1.96e-24 108 31 3 224 1 mcp2 Methyl-accepting chemotaxis protein 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P39215 1.97e-24 108 31 2 238 1 mcpB Methyl-accepting chemotaxis protein McpB Bacillus subtilis (strain 168)
Q88E10 2.06e-24 108 36 6 230 1 mcpS Methyl-accepting chemotaxis protein McpS Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88N45 1.75e-23 105 27 7 333 1 mcpG Methyl-accepting chemotaxis protein McpG Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
C0SP89 2.97e-23 104 27 4 322 2 yoaH Putative methyl-accepting chemotaxis protein YoaH Bacillus subtilis (strain 168)
G3XD24 5.15e-23 104 29 4 282 1 pctA Methyl-accepting chemotaxis protein PctA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HW91 5.3e-23 104 27 5 305 1 pctB Methyl-accepting chemotaxis protein PctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q52877 6.48e-23 103 30 5 305 3 mcpE Probable chemoreceptor McpE Rhizobium meliloti (strain 1021)
Q9HW93 9.04e-23 103 32 3 224 1 pctC Methyl-accepting chemotaxis protein PctC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88D09 1.17e-22 103 30 2 223 1 mcpQ Methyl-accepting chemotaxis protein McpQ Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9HUB1 2.02e-22 102 29 9 355 1 mcpK Methyl-accepting chemotaxis protein McpK Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P15492 4.41e-22 101 28 6 299 3 hlyB Methyl-accepting chemotaxis protein HlyB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q88JK6 1.97e-21 99 27 3 249 1 pcaY Methyl-accepting chemotaxis protein PcaY Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W2C8 2.38e-21 99 27 3 249 2 pcaY Methyl-accepting chemotaxis protein PcaY Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9I055 4.89e-21 98 30 11 310 1 mcpN Methyl-accepting chemotaxis protein McpN Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P54576 3.11e-20 96 31 5 241 1 mcpC Methyl-accepting chemotaxis protein McpC Bacillus subtilis (strain 168)
Q9I0I6 8.49e-20 94 30 5 230 1 ctpM Methyl-accepting chemotaxis protein CtpM Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I3F6 1.14e-19 94 35 4 198 1 aer Methyl-accepting chemotaxis protein Aer Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P43500 1.81e-19 92 27 4 298 1 frzCD Frizzy aggregation protein FrzCD Myxococcus xanthus
G3XDA3 2.11e-19 93 30 7 288 1 ctpH Methyl-accepting chemotaxis protein CtpH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B0R474 6.75e-19 92 30 4 239 1 htr18 Transducer protein Htr18 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q55445 1.22e-18 91 27 5 280 3 sll0041 Putative methyl-accepting chemotaxis protein sll0041 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9HPR6 2.73e-18 89 29 6 262 3 hemAT Heme-based aerotactic transducer HemAT Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P39209 5.14e-18 89 27 4 257 3 tlpC Methyl-accepting chemotaxis protein TlpC Bacillus subtilis (strain 168)
O32239 1.17e-17 88 26 10 338 3 yvaQ Putative sensory transducer protein YvaQ Bacillus subtilis (strain 168)
Q88R14 4.34e-17 86 27 7 330 1 mcpH Methyl-accepting chemotaxis protein McpH Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9I0I4 6.93e-17 85 28 7 287 1 tlpQ Methyl-accepting chemotaxis protein TlpQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9R9U8 1.59e-16 84 27 10 298 3 alkN Putative methyl-accepting chemotaxis AlkN Pseudomonas oleovorans
B0R9Z1 1.64e-16 84 29 2 215 1 car Transducer protein Car Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9HUW6 1.97e-16 84 35 5 190 1 ctpL Methyl-accepting chemotaxis protein CtpL Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HP84 2.59e-16 84 26 6 300 3 cosT Transducer protein CosT Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R6A7 2.59e-16 84 26 6 300 1 cosT Transducer protein CosT Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9WYR0 2.71e-16 84 27 5 272 1 mcp1 Methyl-accepting chemotaxis protein 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X0N0 4.43e-16 83 25 10 390 1 mcp3 Methyl-accepting chemotaxis protein 3 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q88NI1 5.82e-16 83 26 6 336 1 mcpU Methyl-accepting chemotaxis protein McpU Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P35841 6.27e-16 83 29 4 235 3 dcrA Chemoreceptor protein A Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q0VTI9 1.18e-15 82 30 1 192 3 ABO_0106 Putative methyl-accepting chemotaxis AlkN Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B0R5T0 1.78e-15 81 25 6 289 1 htr8 Transducer protein Htr8 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B0R367 2e-15 81 27 8 335 1 mpcT Transducer protein MpcT Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9I3S1 2.42e-15 80 37 0 129 1 bdlA Biofilm dispersion protein BdlA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9Z429 2.75e-15 80 27 6 306 3 nahY Methyl-accepting chemotaxis protein NahY Pseudomonas putida
P42257 4.02e-15 80 26 3 286 1 pilJ Protein PilJ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B0R6I4 5.26e-15 80 29 6 260 1 basT Transducer protein BasT Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q2W8M7 5.49e-15 79 33 1 155 1 amb0994 Methyl-accepting chemotaxis protein Amb0994 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B0R461 1.09e-14 79 27 2 248 1 htr6 Transducer protein Htr6 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9I6V2 1.34e-14 78 29 9 264 1 mcpA Methyl-accepting chemotaxis protein McpA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HP81 1.92e-14 78 27 5 247 3 htr2 Sensory rhodopsin II transducer Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R6B1 1.92e-14 78 27 5 247 1 htr2 Sensory rhodopsin II transducer Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q2W4T8 2.03e-14 78 31 2 172 1 amb2333 Methyl-accepting chemotaxis protein Amb2333 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9HQ00 2.55e-14 77 31 0 167 3 htr9 Halobacterial transducer protein 9 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P42259 3.85e-14 77 32 2 196 1 htr2 Sensory rhodopsin II transducer Natronomonas pharaonis
Q88IY8 7.16e-14 76 29 6 232 1 mcpP Methyl-accepting chemotaxis protein McpP Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5V5V4 8.82e-14 76 24 7 321 2 htr2 Sensory rhodopsin II transducer Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
A5F389 2.02e-13 75 36 2 138 3 tcpI Toxin coregulated pilus biosynthesis protein I Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q6HP15 2.09e-13 75 25 6 335 3 BT9727_0355 Probable methyl-accepting chemotaxis protein BT9727_0355 Bacillus thuringiensis subsp. konkukian (strain 97-27)
P0C6D8 2.09e-13 75 36 2 138 3 tcpI Toxin coregulated pilus biosynthesis protein I Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P42258 3.06e-13 74 24 7 321 3 htrII Sensory rhodopsin II transducer (Fragment) Haloarcula vallismortis
Q5UXM8 1.13e-12 72 25 6 282 1 htr1 Sensory rhodopsin I transducer Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
B0R4N9 1.97e-12 71 30 2 176 1 htr13 Transducer protein Htr13 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P0DMI4 4.29e-12 71 28 4 227 3 htr4 Transducer protein Htr4 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R470 4.29e-12 71 28 4 227 1 htr4 Transducer protein Htr4 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P0DMI5 6.68e-12 70 27 4 281 3 htr7 Transducer protein Htr7 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R6A6 6.68e-12 70 27 4 281 1 htr7 Transducer protein Htr7 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
O07621 8.03e-12 70 32 3 130 1 hemAT Heme-based aerotactic transducer HemAT Bacillus subtilis (strain 168)
P0DMI3 2.19e-11 68 25 9 310 1 htr1 Sensory rhodopsin I transducer Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R632 2.19e-11 68 25 9 310 1 htr1 Sensory rhodopsin I transducer Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
O06477 3.43e-11 67 31 0 122 2 yfmS Putative sensory transducer protein YfmS Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_15515
Feature type CDS
Gene tar
Product Methyl-accepting chemotaxis protein (MCP)
Location 29416 - 30576 (strand: 1)
Length 1161 (nucleotides) / 386 (amino acids)

Contig

Accession contig_21
Length 81362 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2947
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00015 Methyl-accepting chemotaxis protein (MCP) signalling domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0840 Signal transduction mechanisms (T) T Methyl-accepting chemotaxis protein (MCP)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03406 methyl-accepting chemotaxis protein Two-component system
Bacterial chemotaxis
-

Protein Sequence

MLKHISIRTVIVVFLICNFTTINIIFLLPLSALIKLVMLNIVSVFTFACSWFYITKYLVMPINAVKNSIDEVNAGNLSVRIPVFGNNCAGRLIPGVNQLAESLSLLVSEIRSSSDSASVLSEQLAMRSFELSAKTEQQSAMLVETAANMEEIAAGTKNNAENTVLVSEHAQEATVFAGYGGKLMEEVATNMHSINECTNKMTEIITLIDSIAFQTNILALNAAVEAARAGEHGRGFTVVAGEVRNLAHRSSESAKNIKSLIAVTTDNVKQGEDIVHRAEVNMNKIVEGAERVNGLMAQISVSTQQQQQGIEQIATALSELEQATQGSVMIADELAGSSDALKAQVADLQSRTRDFRLTDHAVAQSHSKPALNTGKRVARFAASAQA

Flanking regions ( +/- flanking 50bp)

TAAGATTCAGGCACTAAAAATATCGCAAAATACCAATACTGGAGTAAGTTATGCTTAAACATATCAGTATAAGAACCGTCATTGTCGTCTTTCTCATCTGTAATTTCACTACAATTAATATTATCTTTCTCTTGCCCCTGTCCGCACTAATTAAATTAGTAATGCTTAATATTGTTAGTGTTTTTACGTTCGCCTGCTCATGGTTTTACATTACGAAGTATCTGGTTATGCCGATCAATGCCGTGAAAAACAGTATTGATGAGGTTAACGCCGGTAACTTGTCGGTGCGGATCCCGGTATTTGGTAATAACTGTGCCGGACGCCTGATCCCCGGGGTGAATCAGCTGGCGGAAAGCCTTTCTCTGCTGGTCAGTGAAATTCGCAGCTCATCAGATTCCGCATCTGTGTTGTCTGAGCAACTGGCAATGCGCAGTTTTGAGCTGTCTGCCAAGACGGAGCAGCAATCAGCCATGCTGGTGGAAACAGCGGCCAATATGGAGGAGATTGCCGCCGGGACTAAAAATAATGCGGAGAATACGGTGCTGGTCAGTGAGCATGCACAGGAAGCAACGGTGTTTGCCGGATATGGCGGTAAGCTGATGGAGGAAGTGGCCACCAATATGCATTCTATTAATGAATGCACCAATAAGATGACTGAAATCATCACCCTGATTGATTCCATTGCCTTCCAGACCAACATTCTGGCGCTGAATGCCGCTGTAGAGGCCGCCCGTGCCGGTGAGCACGGCAGAGGGTTTACTGTTGTGGCCGGTGAGGTCAGAAATCTGGCTCACCGCAGTTCAGAATCAGCGAAAAATATTAAATCCCTGATTGCGGTGACAACCGATAATGTTAAGCAGGGAGAGGATATTGTTCACCGCGCCGAAGTGAATATGAATAAGATTGTTGAGGGTGCGGAGCGGGTAAACGGCCTGATGGCGCAGATCTCTGTTTCCACACAACAGCAGCAGCAGGGGATTGAGCAGATAGCAACGGCCCTTTCCGAGCTGGAACAGGCAACTCAGGGCAGTGTGATGATCGCCGATGAGCTTGCCGGTTCTTCTGATGCGCTTAAGGCTCAGGTTGCGGATTTACAGTCACGGACACGGGATTTCCGCCTGACGGATCACGCCGTTGCTCAGTCACACAGCAAACCGGCATTAAACACCGGTAAACGGGTTGCGCGGTTTGCCGCATCAGCTCAGGCATGATTGCCGAAAACCTGAATTGCCTGCTGTAATCGCGAGGAGCGCCGTGTCAG