Homologs in group_2027

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_11260 EHELCC_11260 100.0 Morganella morganii S2 mltC membrane-bound lytic murein transglycosylase MltC
NLDBIP_11605 NLDBIP_11605 100.0 Morganella morganii S4 mltC membrane-bound lytic murein transglycosylase MltC
LHKJJB_11465 LHKJJB_11465 100.0 Morganella morganii S3 mltC membrane-bound lytic murein transglycosylase MltC
HKOGLL_10075 HKOGLL_10075 100.0 Morganella morganii S5 mltC membrane-bound lytic murein transglycosylase MltC
F4V73_RS12465 F4V73_RS12465 94.1 Morganella psychrotolerans mltC membrane-bound lytic murein transglycosylase MltC
PMI_RS01545 PMI_RS01545 71.6 Proteus mirabilis HI4320 mltC membrane-bound lytic murein transglycosylase MltC

Distribution of the homologs in the orthogroup group_2027

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2027

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A1JPV7 0.0 582 75 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7N7I2 0.0 579 76 1 356 3 mltC Membrane-bound lytic murein transglycosylase C Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8API2 0.0 568 74 1 359 3 mltC Membrane-bound lytic murein transglycosylase C Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A8GJ50 0.0 565 74 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Serratia proteamaculans (strain 568)
Q666M2 0.0 563 75 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TI58 0.0 563 75 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pestis (strain Pestoides F)
Q1CEV1 0.0 563 75 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6R2 0.0 563 75 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pestis bv. Antiqua (strain Angola)
Q8ZHE6 0.0 563 75 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pestis
B2K0V2 0.0 563 75 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CB94 0.0 563 75 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pestis bv. Antiqua (strain Antiqua)
A7FEX3 0.0 563 75 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q83Q83 0.0 555 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Shigella flexneri
Q0T0S4 0.0 555 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Shigella flexneri serotype 5b (strain 8401)
B7LYZ3 0.0 554 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O8 (strain IAI1)
Q32C32 0.0 553 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Shigella dysenteriae serotype 1 (strain Sd197)
Q31WM5 0.0 553 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Shigella boydii serotype 4 (strain Sb227)
B2U178 0.0 553 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7N7L9 0.0 553 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1ISK6 0.0 553 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A4A6 0.0 553 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O9:H4 (strain HS)
B7LFM1 0.0 553 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain 55989 / EAEC)
A7ZR89 0.0 553 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O139:H28 (strain E24377A / ETEC)
B7MZB8 0.0 553 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O81 (strain ED1a)
Q1R762 0.0 552 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain UTI89 / UPEC)
P0C066 0.0 552 75 0 358 1 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain K12)
P0C067 0.0 552 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TDN8 0.0 552 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AFE9 0.0 552 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O1:K1 / APEC
B1XFC3 0.0 552 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain K12 / DH10B)
C5A0N2 0.0 552 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain K12 / MC4100 / BW2952)
B7MN10 0.0 552 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UI10 0.0 552 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5YQG2 0.0 552 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCS6 0.0 552 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O157:H7
B7LPT3 0.0 551 74 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q3YXF0 0.0 551 75 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Shigella sonnei (strain Ss046)
A4WEA0 0.0 551 75 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Enterobacter sp. (strain 638)
B6I7A0 0.0 551 74 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain SE11)
B7NI32 0.0 551 74 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1LDH3 0.0 550 74 0 358 3 mltC Membrane-bound lytic murein transglycosylase C Escherichia coli (strain SMS-3-5 / SECEC)
A9MQR3 0.0 549 72 1 359 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8ZM39 0.0 549 72 1 359 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N4R0 0.0 549 72 1 359 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PMM0 0.0 549 72 1 359 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z3T9 0.0 548 72 1 359 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella typhi
A7MLX9 0.0 548 72 1 359 3 mltC Membrane-bound lytic murein transglycosylase C Cronobacter sakazakii (strain ATCC BAA-894)
Q57K03 0.0 547 72 1 359 3 mltC Membrane-bound lytic murein transglycosylase C Salmonella choleraesuis (strain SC-B67)
Q6D8K0 0.0 546 72 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NRB3 0.0 545 71 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Sodalis glossinidius (strain morsitans)
B5XU88 0.0 538 72 1 359 3 mltC Membrane-bound lytic murein transglycosylase C Klebsiella pneumoniae (strain 342)
A6TDX1 0.0 536 72 1 359 3 mltC Membrane-bound lytic murein transglycosylase C Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C5BCE9 0.0 525 72 1 358 3 mltC Membrane-bound lytic murein transglycosylase C Edwardsiella ictaluri (strain 93-146)
Q65VT8 1.26e-139 404 56 4 348 3 mltC Membrane-bound lytic murein transglycosylase C Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VLS0 1.81e-138 401 54 5 361 3 mltC Membrane-bound lytic murein transglycosylase C Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0UWE6 2.45e-135 393 52 4 358 3 mltC Membrane-bound lytic murein transglycosylase C Histophilus somni (strain 2336)
Q0I513 2.45e-135 393 52 4 358 3 mltC Membrane-bound lytic murein transglycosylase C Histophilus somni (strain 129Pt)
Q9CLB8 1.69e-133 388 51 5 360 3 mltC Membrane-bound lytic murein transglycosylase C Pasteurella multocida (strain Pm70)
Q4QMD8 4.87e-132 384 53 4 343 3 mltC Membrane-bound lytic murein transglycosylase C Haemophilus influenzae (strain 86-028NP)
A5UHR5 5.56e-132 384 53 4 343 3 mltC Membrane-bound lytic murein transglycosylase C Haemophilus influenzae (strain PittGG)
P44049 8.41e-132 384 53 4 343 3 mltC Membrane-bound lytic murein transglycosylase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B8F6F0 1.65e-131 384 52 5 362 3 mltC Membrane-bound lytic murein transglycosylase C Glaesserella parasuis serovar 5 (strain SH0165)
A5UDW4 7.7e-131 382 53 4 343 3 mltC Membrane-bound lytic murein transglycosylase C Haemophilus influenzae (strain PittEE)
B0BSH0 5.55e-126 369 52 5 348 3 mltC Membrane-bound lytic murein transglycosylase C Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GYW8 5.55e-126 369 52 5 348 3 mltC Membrane-bound lytic murein transglycosylase C Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N339 5.55e-126 369 52 5 348 3 mltC Membrane-bound lytic murein transglycosylase C Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q7VKB7 7.78e-125 367 50 6 368 3 mltC Membrane-bound lytic murein transglycosylase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B5XQ85 9.92e-39 140 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Klebsiella pneumoniae (strain 342)
A6TAW0 3.38e-38 139 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q7CQE4 2.13e-37 137 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGT6 2.13e-37 137 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella typhi
B5BI54 2.13e-37 137 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella paratyphi A (strain AKU_12601)
C0Q334 2.13e-37 137 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella paratyphi C (strain RKS4594)
A9MVX1 2.13e-37 137 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PN08 2.13e-37 137 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5R901 2.13e-37 137 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R2X1 2.13e-37 137 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella enteritidis PT4 (strain P125109)
Q57NL3 2.13e-37 137 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Salmonella choleraesuis (strain SC-B67)
B7UQ77 6.3e-37 135 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7MKC3 1.07e-36 135 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Cronobacter sakazakii (strain ATCC BAA-894)
Q3Z2V5 1.4e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Shigella sonnei (strain Ss046)
P0C960 1.4e-36 134 41 0 163 1 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain K12)
B1IU99 1.4e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XAN4 1.4e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain K12 / DH10B)
C4ZTN4 1.4e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain K12 / MC4100 / BW2952)
Q1RCQ2 1.93e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain UTI89 / UPEC)
B1LHX3 1.93e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain SMS-3-5 / SECEC)
P59243 1.93e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TII2 1.93e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AAB6 1.93e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O1:K1 / APEC
B7MTX1 1.93e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O81 (strain ED1a)
B7NUV4 1.93e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MK90 1.93e-36 134 41 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O45:K1 (strain S88 / ExPEC)
A4WBE8 2.82e-36 134 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Enterobacter sp. (strain 638)
A8AFS5 3.94e-36 133 39 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q83RP9 4.67e-36 133 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Shigella flexneri
Q0T5K7 4.67e-36 133 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Shigella flexneri serotype 5b (strain 8401)
Q31ZN3 4.67e-36 133 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Shigella boydii serotype 4 (strain Sb227)
B7N3Z9 4.67e-36 133 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LXA7 4.67e-36 133 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O8 (strain IAI1)
B5YXL7 4.67e-36 133 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XDJ7 4.67e-36 133 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli O157:H7
B7LGV3 4.67e-36 133 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia coli (strain 55989 / EAEC)
Q83RQ0 6.87e-36 133 40 0 163 3 emtA2 Endo-type membrane-bound lytic murein transglycosylase A-like protein Shigella flexneri
B7LSJ1 1.32e-35 132 39 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q32H22 1.34e-35 132 40 0 163 3 emtA Endo-type membrane-bound lytic murein transglycosylase A Shigella dysenteriae serotype 1 (strain Sd197)
P57352 1.68e-29 116 43 1 130 3 mltE Membrane-bound lytic murein transglycosylase E Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AM2 5.08e-26 107 38 0 160 3 mltE Membrane-bound lytic murein transglycosylase E Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O31608 3.56e-14 73 38 2 113 1 cwlQ Bifunctional muramidase/lytic transglycosylase CwlQ Bacillus subtilis (strain 168)
A8ZWR8 1.5e-12 72 30 6 171 3 mltF Membrane-bound lytic murein transglycosylase F Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
O31976 4.62e-10 65 36 3 118 3 yomI SPbeta prophage-derived uncharacterized transglycosylase YomI Bacillus subtilis (strain 168)
O64046 4.66e-10 65 36 3 118 3 yomI Probable tape measure protein Bacillus phage SPbeta
P0AGC3 6.61e-08 58 30 7 171 1 slt Soluble lytic murein transglycosylase Escherichia coli (strain K12)
P0AGC4 6.61e-08 58 30 7 171 3 slt Soluble lytic murein transglycosylase Escherichia coli O157:H7
P44888 1.12e-07 57 35 3 105 3 slt Putative soluble lytic murein transglycosylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A4VP14 3.08e-07 55 27 6 169 3 mltF Membrane-bound lytic murein transglycosylase F Stutzerimonas stutzeri (strain A1501)
Q3KHL5 3.3e-07 55 25 8 255 3 mltF Membrane-bound lytic murein transglycosylase F Pseudomonas fluorescens (strain Pf0-1)
A4XXV1 2.09e-06 53 27 5 169 3 mltF Membrane-bound lytic murein transglycosylase F Pseudomonas mendocina (strain ymp)
Q4KHS7 2.2e-06 53 24 10 285 3 mltF Membrane-bound lytic murein transglycosylase F Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P39434 2.4e-06 53 29 7 171 3 slt Soluble lytic murein transglycosylase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P27380 3.36e-06 51 38 2 86 1 VII Transglycosylase Enterobacteria phage PRD1
Q2SK06 4.62e-06 52 26 3 145 3 mltF Membrane-bound lytic murein transglycosylase F Hahella chejuensis (strain KCTC 2396)
Q0VRG6 6.04e-06 51 31 3 123 3 mltF Membrane-bound lytic murein transglycosylase F Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0A9W6 8.82e-06 51 28 4 145 3 mltF1 Membrane-bound lytic murein transglycosylase F 1 Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1QZB1 1.88e-05 50 27 3 134 3 mltF Membrane-bound lytic murein transglycosylase F Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q48LX4 8.22e-05 48 24 7 233 3 mltF Membrane-bound lytic murein transglycosylase F Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q886W7 9.64e-05 47 24 6 218 3 mltF Membrane-bound lytic murein transglycosylase F Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZX03 0.000114 47 24 5 218 3 mltF Membrane-bound lytic murein transglycosylase F Pseudomonas syringae pv. syringae (strain B728a)
Q9KTN5 0.000442 45 29 5 144 3 mltF Membrane-bound lytic murein transglycosylase F Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F353 0.000442 45 29 5 144 3 mltF Membrane-bound lytic murein transglycosylase F Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_14985
Feature type CDS
Gene mltC
Product membrane-bound lytic murein transglycosylase MltC
Location 9321 - 10436 (strand: -1)
Length 1116 (nucleotides) / 371 (amino acids)
In genomic island GI27

Contig

Accession contig_20
Length 84833 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2027
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01464 Transglycosylase SLT domain
PF11873 Membrane-bound lytic murein transglycosylase C, N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0741 Cell wall/membrane/envelope biogenesis (M) M Soluble lytic murein transglycosylase or regulatory protein s ( may contain LysM/invasin domain)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K08306 peptidoglycan lytic transglycosylase C [EC:4.2.2.29] - -

Protein Sequence

MLYLNPDHTVFIPMKKLAALIIIAPLLASCTGSQEQTDYRPEYVKDTNGFDILMGQFAHNIENIWGIKEVLIAGPKDYVKYTDQYYTRSHINFDAGTVTIETLAGVEPEAHLRQAIINTLLMGEDPGSVDLYSDANDVTISKEPFLFGQVLDHTGQPIRWEWRATKFADYLVTNRLQRRQSGSQMITYITLKLVPNHLDQRAHKYLPLVRQASAKYGVEESLILAIMQTESSFNPYAVSRSDALGLMQIMPNTAGRDVFKSQGRSGVPGRSYLFDPASNIDTGTAYLAILQNTYLGEISNPTSRRYAVITAYNGGAGSVLRVFHSDKKQAARIISGMEPGKVYETLTTKHPSGESRNYLRKVNDLQKGYRR

Flanking regions ( +/- flanking 50bp)

ATACACCGCCTGAAAAATAACCCTGTCATCAGAGCCCTTTCCCGGCTCTGATGTTGTATCTGAACCCGGATCACACCGTATTTATACCCATGAAAAAACTTGCTGCACTGATCATTATTGCGCCGCTGCTGGCTTCCTGTACCGGTTCACAGGAACAGACTGATTACCGTCCTGAATATGTTAAGGATACCAACGGATTTGATATTCTGATGGGTCAGTTTGCCCATAACATTGAAAATATATGGGGTATAAAAGAAGTTCTGATCGCCGGTCCGAAAGATTATGTCAAATACACCGATCAGTACTACACCCGTTCCCATATCAACTTTGATGCCGGTACCGTCACTATTGAGACGCTGGCGGGGGTTGAGCCGGAAGCGCATCTGCGTCAGGCGATTATCAATACCCTGCTGATGGGAGAGGATCCGGGCTCGGTTGACCTCTATTCTGATGCCAACGATGTCACCATCAGTAAAGAGCCGTTCCTGTTCGGCCAGGTGCTGGATCATACCGGACAGCCGATCCGCTGGGAGTGGCGCGCCACCAAATTCGCGGATTATCTGGTGACCAACCGTTTACAGCGCCGCCAGTCCGGCTCACAGATGATCACCTATATCACCCTGAAACTGGTGCCGAACCATCTGGATCAGCGTGCTCACAAATACCTGCCGCTGGTTCGTCAGGCATCCGCCAAATACGGCGTGGAAGAGTCTCTGATCCTTGCGATTATGCAGACGGAATCCAGCTTTAACCCGTATGCGGTCAGCCGCTCTGATGCGCTGGGACTGATGCAGATTATGCCGAACACCGCCGGACGTGATGTGTTTAAATCACAGGGCCGCTCCGGTGTACCGGGCCGCAGCTATCTGTTTGACCCGGCAAGCAACATCGATACCGGTACCGCATATCTGGCGATTCTGCAGAATACCTATCTCGGTGAGATCAGCAACCCGACATCACGGCGCTATGCGGTGATCACTGCCTACAACGGCGGTGCGGGCAGTGTGCTGCGTGTCTTCCACAGTGATAAGAAACAGGCCGCCCGCATTATCAGCGGTATGGAGCCGGGTAAAGTGTATGAAACCCTGACGACAAAACACCCGTCCGGAGAATCCCGCAATTACCTGCGTAAAGTAAACGACCTGCAAAAAGGTTACCGCCGTTAAACTTTCCGGCGGGCAGCATCCGCAGTTGTCCGCCGGTAATTTTACGTGTT