Homologs in group_390

Help

7 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_15730 EHELCC_15730 97.7 Morganella morganii S2 - hypothetical protein
EHELCC_19240 EHELCC_19240 100.0 Morganella morganii S2 - hypothetical protein
NLDBIP_16260 NLDBIP_16260 97.7 Morganella morganii S4 - hypothetical protein
NLDBIP_19210 NLDBIP_19210 100.0 Morganella morganii S4 - hypothetical protein
LHKJJB_15580 LHKJJB_15580 97.7 Morganella morganii S3 - hypothetical protein
LHKJJB_19100 LHKJJB_19100 100.0 Morganella morganii S3 - hypothetical protein
HKOGLL_14700 HKOGLL_14700 100.0 Morganella morganii S5 - hypothetical protein

Distribution of the homologs in the orthogroup group_390

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_390

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_14925
Feature type CDS
Gene -
Product hypothetical protein
Location 85002 - 85133 (strand: 1)
Length 132 (nucleotides) / 43 (amino acids)

Contig

Accession contig_19
Length 86773 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_390
Orthogroup size 8
N. genomes 5

Actions

Genomic region

Protein Sequence

MTIDTVVMIAHVLHVSVNELLSDYLASEYSDIMLLMNHRNTDR

Flanking regions ( +/- flanking 50bp)

TGGGGCTTACACAACAGCAGATATCCCGTTACGAGTCAGGCCAATCATTAATGACCATAGATACTGTCGTTATGATTGCTCATGTGCTTCATGTTTCTGTAAACGAGTTACTGAGTGATTACCTTGCCTCAGAATACAGTGACATCATGCTTTTAATGAACCATCGTAATACAGATAGATAGCCGCGCCGGACATCCACCAGCGCGGCTTTGTTTTATTCCTCTGAGTCTAC