Homologs in group_1725

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_14565 EHELCC_14565 100.0 Morganella morganii S2 fusA elongation factor G
NLDBIP_15665 NLDBIP_15665 100.0 Morganella morganii S4 fusA elongation factor G
LHKJJB_14950 LHKJJB_14950 100.0 Morganella morganii S3 fusA elongation factor G
HKOGLL_19340 HKOGLL_19340 100.0 Morganella morganii S5 fusA elongation factor G
F4V73_RS14920 F4V73_RS14920 96.0 Morganella psychrotolerans fusA elongation factor G
PMI_RS13795 PMI_RS13795 89.5 Proteus mirabilis HI4320 fusA elongation factor G

Distribution of the homologs in the orthogroup group_1725

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1725

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EYV7 0 1321 88 1 708 3 fusA Elongation factor G Proteus mirabilis (strain HI4320)
C5BGM8 0 1299 88 2 705 3 fusA Elongation factor G Edwardsiella ictaluri (strain 93-146)
Q3YWT2 0 1275 86 2 706 3 fusA Elongation factor G Shigella sonnei (strain Ss046)
Q32B26 0 1275 86 2 706 3 fusA Elongation factor G Shigella dysenteriae serotype 1 (strain Sd197)
Q31VU9 0 1275 86 2 706 3 fusA Elongation factor G Shigella boydii serotype 4 (strain Sb227)
B2U2U7 0 1275 86 2 706 3 fusA Elongation factor G Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LS46 0 1275 86 2 706 3 fusA Elongation factor G Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R5U3 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli (strain UTI89 / UPEC)
B1LHE0 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli (strain SMS-3-5 / SECEC)
B6I240 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli (strain SE11)
P0A6M8 0 1275 86 2 706 1 fusA Elongation factor G Escherichia coli (strain K12)
B1IPV9 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6M9 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCB9 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGM7 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O1:K1 / APEC
A8A5E7 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O9:H4 (strain HS)
B1X6J0 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli (strain K12 / DH10B)
C4ZUJ5 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli (strain K12 / MC4100 / BW2952)
B7M1P1 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O8 (strain IAI1)
B7N0X6 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O81 (strain ED1a)
B7NLP5 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YTP7 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6N0 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O157:H7
B7L4L1 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli (strain 55989 / EAEC)
B7MCV5 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UK50 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZSL5 0 1275 86 2 706 3 fusA Elongation factor G Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83JC3 0 1273 86 2 706 3 fusA Elongation factor G Shigella flexneri
Q0SZX7 0 1273 86 2 706 3 fusA Elongation factor G Shigella flexneri serotype 5b (strain 8401)
C6DG80 0 1255 87 2 706 3 fusA Elongation factor G Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8AQM8 0 1254 86 2 706 3 fusA Elongation factor G Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A7MKJ6 0 1253 86 2 706 3 fusA Elongation factor G Cronobacter sakazakii (strain ATCC BAA-894)
Q6CZW5 0 1253 86 2 706 3 fusA Elongation factor G Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7NDU8 0 1252 86 2 706 3 fusA Elongation factor G Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A1H3 0 1251 86 2 706 3 fusA Elongation factor G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1H4 0 1251 86 2 706 3 fusA Elongation factor G Salmonella typhi
B4TXE8 0 1251 86 2 706 3 fusA Elongation factor G Salmonella schwarzengrund (strain CVM19633)
B5BGZ2 0 1251 86 2 706 3 fusA Elongation factor G Salmonella paratyphi A (strain AKU_12601)
C0Q0C2 0 1251 86 2 706 3 fusA Elongation factor G Salmonella paratyphi C (strain RKS4594)
A9MT06 0 1251 86 2 706 3 fusA Elongation factor G Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIW3 0 1251 86 2 706 3 fusA Elongation factor G Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SUU6 0 1251 86 2 706 3 fusA Elongation factor G Salmonella newport (strain SL254)
B4TKM1 0 1251 86 2 706 3 fusA Elongation factor G Salmonella heidelberg (strain SL476)
B5RH09 0 1251 86 2 706 3 fusA Elongation factor G Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R297 0 1251 86 2 706 3 fusA Elongation factor G Salmonella enteritidis PT4 (strain P125109)
B5FJM0 0 1251 86 2 706 3 fusA Elongation factor G Salmonella dublin (strain CT_02021853)
Q57J26 0 1251 86 2 706 3 fusA Elongation factor G Salmonella choleraesuis (strain SC-B67)
B5F8F8 0 1251 86 2 706 3 fusA Elongation factor G Salmonella agona (strain SL483)
A9MN39 0 1251 86 2 706 3 fusA Elongation factor G Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2VK36 0 1248 87 1 705 3 fusA Elongation factor G Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B1JIV5 0 1228 85 2 705 3 fusA Elongation factor G Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664R6 0 1228 85 2 705 3 fusA Elongation factor G Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGY6 0 1228 85 2 705 3 fusA Elongation factor G Yersinia pestis (strain Pestoides F)
Q1CCT8 0 1228 85 2 705 3 fusA Elongation factor G Yersinia pestis bv. Antiqua (strain Nepal516)
A9R462 0 1228 85 2 705 3 fusA Elongation factor G Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJB3 0 1228 85 2 705 3 fusA Elongation factor G Yersinia pestis
B2K5N5 0 1228 85 2 705 3 fusA Elongation factor G Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C2U0 0 1228 85 2 705 3 fusA Elongation factor G Yersinia pestis bv. Antiqua (strain Antiqua)
A7FNN9 0 1228 85 2 705 3 fusA Elongation factor G Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C4LBU4 0 1221 82 3 708 3 fusA Elongation factor G Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q7N9B2 0 1205 85 2 708 3 fusA Elongation factor G Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P43925 0 1205 83 3 705 1 fusA Elongation factor G Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5U9R0 0 1205 83 3 705 3 fusA Elongation factor G Haemophilus influenzae (strain PittEE)
A0KQ96 0 1205 83 2 708 3 fusA Elongation factor G Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q4QMT6 0 1204 83 3 705 3 fusA Elongation factor G Haemophilus influenzae (strain 86-028NP)
A4SHV8 0 1203 83 2 708 3 fusA Elongation factor G Aeromonas salmonicida (strain A449)
Q2NQL6 0 1195 83 3 708 3 fusA Elongation factor G Sodalis glossinidius (strain morsitans)
A6VL11 0 1189 82 3 705 3 fusA Elongation factor G Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q65W89 0 1184 82 3 705 3 fusA Elongation factor G Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8K948 0 1180 78 1 705 3 fusA Elongation factor G Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57938 0 1179 82 3 705 3 fusA Elongation factor G Pasteurella multocida (strain Pm70)
B0UWC4 0 1178 81 3 705 3 fusA Elongation factor G Histophilus somni (strain 2336)
Q0I537 0 1178 81 3 705 3 fusA Elongation factor G Histophilus somni (strain 129Pt)
A3N247 0 1176 82 3 708 3 fusA Elongation factor G Actinobacillus pleuropneumoniae serotype 5b (strain L20)
C4K4F9 0 1175 81 3 708 3 fusA Elongation factor G Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
B8D852 0 1170 79 2 705 3 fusA Elongation factor G Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57593 0 1170 79 2 705 3 fusA Elongation factor G Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9V0 0 1170 79 2 705 3 fusA Elongation factor G Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B8F7Z4 0 1164 81 3 705 3 fusA Elongation factor G Glaesserella parasuis serovar 5 (strain SH0165)
Q7VNA2 0 1143 80 3 708 3 fusA Elongation factor G Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q1LSY5 0 1113 75 4 711 3 fusA Elongation factor G Baumannia cicadellinicola subsp. Homalodisca coagulata
Q492B1 0 1106 74 6 710 3 fusA Elongation factor G Blochmanniella pennsylvanica (strain BPEN)
Q057A1 0 1093 74 3 706 3 fusA Elongation factor G Buchnera aphidicola subsp. Cinara cedri (strain Cc)
P59451 0 1078 72 2 712 3 fusA Elongation factor G Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q7VRN9 0 1072 73 4 708 3 fusA Elongation factor G Blochmanniella floridana
Q5QWB4 0 1066 74 4 710 3 fusA Elongation factor G Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q3ILP5 0 1064 73 4 706 3 fusA1 Elongation factor G 1 Pseudoalteromonas translucida (strain TAC 125)
Q7NQF0 0 1056 73 3 707 3 fusA Elongation factor G Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2L2H1 0 1055 72 3 706 3 fusA1 Elongation factor G 1 Bordetella avium (strain 197N)
Q8XV10 0 1055 71 3 709 3 fusA Elongation factor G 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q15YA7 0 1051 72 4 708 3 fusA2 Elongation factor G 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q3SLQ2 0 1051 72 4 702 3 fusA Elongation factor G Thiobacillus denitrificans (strain ATCC 25259)
Q13TG7 0 1050 71 3 707 3 fusA2 Elongation factor G 2 Paraburkholderia xenovorans (strain LB400)
A2S7H3 0 1050 72 4 707 3 fusA Elongation factor G Burkholderia mallei (strain NCTC 10229)
Q2SU24 0 1050 72 4 707 3 fusA2 Elongation factor G 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63Q08 0 1050 72 4 707 3 fusA2 Elongation factor G 2 Burkholderia pseudomallei (strain K96243)
Q3JMR0 0 1050 72 4 707 3 fusA2 Elongation factor G 2 Burkholderia pseudomallei (strain 1710b)
Q62GK2 0 1050 72 4 707 3 fusA2 Elongation factor G 2 Burkholderia mallei (strain ATCC 23344)
Q1LI29 0 1050 71 3 706 3 fusA1 Elongation factor G 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1BRU5 0 1049 71 3 707 3 fusA2 Elongation factor G 2 Burkholderia orbicola (strain AU 1054)
Q7WRC7 0 1049 72 3 706 3 fusA1 Elongation factor G 1 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VTD5 0 1047 72 3 706 3 fusA Elongation factor G Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W2F8 0 1047 72 3 706 3 fusA1 Elongation factor G 1 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q39KH0 0 1046 71 3 707 3 fusA1 Elongation factor G 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q46WE0 0 1045 71 3 706 3 fusA1 Elongation factor G 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q47UW3 0 1044 71 4 706 3 fusA2 Elongation factor G 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q87L45 0 1043 72 5 706 3 fusA1 Elongation factor G 1 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q089Q7 0 1041 71 5 707 3 fusA1 Elongation factor G 1 Shewanella frigidimarina (strain NCIMB 400)
Q8DCQ8 0 1040 73 4 706 1 fusA Elongation factor G Vibrio vulnificus (strain CMCP6)
Q7MH42 0 1040 73 4 706 3 fusA1 Elongation factor G 1 Vibrio vulnificus (strain YJ016)
B0V8Y3 0 1039 71 3 703 3 fusA Elongation factor G Acinetobacter baumannii (strain AYE)
A3M306 0 1039 71 3 703 3 fusA Elongation factor G Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HUQ4 0 1039 71 3 703 3 fusA Elongation factor G Acinetobacter baumannii (strain ACICU)
B7I7S1 0 1039 71 3 703 3 fusA Elongation factor G Acinetobacter baumannii (strain AB0057)
Q0I0A8 0 1039 71 5 707 3 fusA1 Elongation factor G 1 Shewanella sp. (strain MR-7)
Q0HNU0 0 1039 71 5 707 3 fusA1 Elongation factor G 1 Shewanella sp. (strain MR-4)
Q3BWY7 0 1039 70 2 703 3 fusA Elongation factor G Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B2FQ42 0 1038 70 2 711 3 fusA Elongation factor G Stenotrophomonas maltophilia (strain K279a)
B7GYM8 0 1038 71 3 703 3 fusA Elongation factor G Acinetobacter baumannii (strain AB307-0294)
Q5WZL5 0 1038 70 4 701 3 fusA Elongation factor G Legionella pneumophila (strain Lens)
Q5E8B9 0 1038 73 5 706 3 fusA1 Elongation factor G 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q2S909 0 1038 72 4 706 3 fusA1 Elongation factor G 1 Hahella chejuensis (strain KCTC 2396)
B1XSP8 0 1037 71 3 706 3 fusA Elongation factor G Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q8PNS6 0 1037 70 2 703 3 fusA Elongation factor G Xanthomonas axonopodis pv. citri (strain 306)
B0VTG3 0 1037 71 3 703 3 fusA Elongation factor G Acinetobacter baumannii (strain SDF)
Q12GX4 0 1036 70 4 706 3 fusA1 Elongation factor G 1 Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q8D3H2 0 1036 69 3 708 3 fusA Elongation factor G Wigglesworthia glossinidia brevipalpis
Q5X862 0 1036 70 4 701 3 fusA Elongation factor G Legionella pneumophila (strain Paris)
Q5GWS9 0 1035 70 2 703 3 fusA Elongation factor G Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NZY2 0 1035 70 2 703 3 fusA Elongation factor G Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8EK71 0 1035 71 5 707 3 fusA Elongation factor G 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q5ZYP6 0 1035 70 4 701 1 fusA Elongation factor G Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IHR7 0 1034 70 4 701 3 fusA Elongation factor G Legionella pneumophila (strain Corby)
Q1BU86 0 1034 72 3 708 3 fusA1 Elongation factor G 1 Burkholderia orbicola (strain AU 1054)
B4RQX2 0 1033 72 5 708 3 fusA Elongation factor G Neisseria gonorrhoeae (strain NCCP11945)
Q5F5S3 0 1033 72 5 708 3 fusA Elongation factor G Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A5EX85 0 1033 70 3 706 3 fusA Elongation factor G Dichelobacter nodosus (strain VCS1703A)
Q605A9 0 1032 71 3 703 3 fusA2 Elongation factor G 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A1KRH0 0 1032 72 5 708 3 fusA Elongation factor G Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JX07 0 1032 72 5 708 3 fusA Elongation factor G Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M3X0 0 1032 72 5 708 3 fusA Elongation factor G Neisseria meningitidis serogroup C (strain 053442)
C5BQ43 0 1031 71 4 706 3 fusA Elongation factor G Teredinibacter turnerae (strain ATCC 39867 / T7901)
B4SKW0 0 1031 70 2 711 3 fusA Elongation factor G Stenotrophomonas maltophilia (strain R551-3)
Q6FDS6 0 1031 70 3 703 3 fusA Elongation factor G Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9K1I8 0 1031 72 5 708 1 fusA Elongation factor G Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q39DL2 0 1030 72 4 708 3 fusA2 Elongation factor G 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q13UU8 0 1029 71 3 708 3 fusA1 Elongation factor G 1 Paraburkholderia xenovorans (strain LB400)
Q0ABH8 0 1028 72 2 703 3 fusA Elongation factor G Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q63WJ7 0 1026 72 4 709 3 fusA1 Elongation factor G 1 Burkholderia pseudomallei (strain K96243)
Q3JV86 0 1026 72 4 709 3 fusA1 Elongation factor G 1 Burkholderia pseudomallei (strain 1710b)
Q62HK4 0 1026 72 4 709 3 fusA1 Elongation factor G 1 Burkholderia mallei (strain ATCC 23344)
Q2YB00 0 1026 70 4 705 3 fusA Elongation factor G Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q83ES7 0 1025 68 4 705 3 fusA Elongation factor G Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAM1 0 1025 68 4 705 3 fusA Elongation factor G Coxiella burnetii (strain RSA 331 / Henzerling II)
Q2T0I7 0 1025 72 4 709 3 fusA1 Elongation factor G 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A4SUV8 0 1025 72 4 706 3 fusA Elongation factor G Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q1LAN7 0 1025 71 3 707 3 fusA2 Elongation factor G 2 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B6J266 0 1025 68 4 705 3 fusA Elongation factor G Coxiella burnetii (strain CbuG_Q212)
B6J5C9 0 1025 68 4 705 3 fusA Elongation factor G Coxiella burnetii (strain CbuK_Q154)
A9KD34 0 1024 68 4 705 3 fusA Elongation factor G Coxiella burnetii (strain Dugway 5J108-111)
A1TYJ4 0 1023 70 3 703 3 fusA Elongation factor G Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2KV83 0 1023 70 3 709 3 fusA2 Elongation factor G 2 Bordetella avium (strain 197N)
Q7WFL2 0 1022 70 4 704 3 fusA2 Elongation factor G 2 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9I244 0 1021 69 6 710 3 fusB Elongation factor G 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3J8R1 0 1021 70 3 703 3 fusA Elongation factor G Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q8XRM7 0 1019 71 3 709 3 fusB Elongation factor G 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q12SW2 0 1019 71 5 707 3 fusA1 Elongation factor G 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8PC52 0 1019 70 2 703 3 fusA Elongation factor G Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RU85 0 1019 70 2 703 3 fusA Elongation factor G Xanthomonas campestris pv. campestris (strain B100)
Q4URD6 0 1019 70 2 703 3 fusA Elongation factor G Xanthomonas campestris pv. campestris (strain 8004)
A5WGL0 0 1019 68 3 709 3 fusA Elongation factor G Psychrobacter sp. (strain PRwf-1)
B1Y7G9 0 1019 70 4 706 3 fusA Elongation factor G Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q46PQ4 0 1019 70 3 709 3 fusA2 Elongation factor G 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1AVJ7 0 1019 69 3 706 3 fusA Elongation factor G Ruthia magnifica subsp. Calyptogena magnifica
Q6LVC1 0 1019 71 4 706 3 fusA1 Elongation factor G 1 Photobacterium profundum (strain SS9)
A2SLG0 0 1018 70 4 706 3 fusA Elongation factor G Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A1KB30 0 1017 70 5 706 3 fusA Elongation factor G Azoarcus sp. (strain BH72)
Q1R0H8 0 1016 69 2 703 3 fusA Elongation factor G Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q9HWD2 0 1016 69 0 703 1 fusA Elongation factor G 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A4G9U1 0 1014 70 4 710 3 fusA Elongation factor G Herminiimonas arsenicoxydans
Q9KUZ7 0 1014 71 4 703 3 fusA1 Elongation factor G 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5CXN7 0 1014 69 3 706 3 fusA Elongation factor G Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A6T3K7 0 1013 69 4 710 3 fusA Elongation factor G Janthinobacterium sp. (strain Marseille)
Q0VSL8 0 1013 69 3 707 3 fusA Elongation factor G Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q82T70 0 1013 68 4 705 3 fusA Elongation factor G Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7W455 0 1013 70 5 704 3 fusA2 Elongation factor G 2 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q1H4P0 0 1012 69 5 706 3 fusA Elongation factor G Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
C1DAR4 0 1011 72 4 707 3 fusA Elongation factor G Laribacter hongkongensis (strain HLHK9)
Q1Q8P1 0 1010 68 4 709 3 fusA Elongation factor G Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FQG5 0 1007 68 4 709 3 fusA Elongation factor G Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A4VHM7 0 1004 67 0 703 3 fusA Elongation factor G Stutzerimonas stutzeri (strain A1501)
Q123W3 0 1004 68 4 708 3 fusA2 Elongation factor G 2 Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q21RV5 0 1003 69 4 706 3 fusA Elongation factor G Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A1W2Q4 0 1002 69 3 706 3 fusA Elongation factor G Acidovorax sp. (strain JS42)
A1WHC2 0 1001 69 4 706 3 fusA Elongation factor G Verminephrobacter eiseniae (strain EF01-2)
Q0AIJ8 0 1000 67 4 705 3 fusA Elongation factor G Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3K5Y5 0 1000 69 4 702 3 fusA Elongation factor G Pseudomonas fluorescens (strain Pf0-1)
B9MB70 0 1000 69 3 706 3 fusA Elongation factor G Acidovorax ebreus (strain TPSY)
Q31IY5 0 999 68 4 702 3 fusA Elongation factor G Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A1WVC5 0 999 69 3 703 3 fusA Elongation factor G Halorhodospira halophila (strain DSM 244 / SL1)
Q47JA6 0 998 69 5 706 3 fusA Elongation factor G Dechloromonas aromatica (strain RCB)
Q88FI4 0 998 67 4 704 1 fusB Elongation factor G 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5P335 0 998 70 5 707 3 fusA Elongation factor G Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B0U0Z1 0 997 71 4 709 3 fusA Elongation factor G Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
C3K2X9 0 996 69 4 702 3 fusA Elongation factor G Pseudomonas fluorescens (strain SBW25)
A1TJ04 0 995 69 4 706 3 fusA Elongation factor G Paracidovorax citrulli (strain AAC00-1)
A4XZ93 0 995 67 1 712 3 fusA Elongation factor G Pseudomonas mendocina (strain ymp)
Q88QN8 0 994 67 1 712 3 fusA Elongation factor G 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0BNS9 0 993 70 2 707 3 fusA Elongation factor G Francisella tularensis subsp. holarctica (strain OSU18)
A0Q4I1 0 993 70 2 707 3 fusA Elongation factor G Francisella tularensis subsp. novicida (strain U112)
Q2A5H2 0 993 70 2 707 3 fusA Elongation factor G Francisella tularensis subsp. holarctica (strain LVS)
Q4K530 0 993 67 3 713 3 fusA Elongation factor G Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
C5CP58 0 991 70 5 706 3 fusA Elongation factor G Variovorax paradoxus (strain S110)
A4IZT6 0 991 70 2 707 3 fusA Elongation factor G Francisella tularensis subsp. tularensis (strain WY96-3418)
B2SDY7 0 991 70 2 707 3 fusA Elongation factor G Francisella tularensis subsp. mediasiatica (strain FSC147)
Q5NHX0 0 990 70 2 707 3 fusA Elongation factor G Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JC2 0 990 70 2 707 3 fusA Elongation factor G Francisella tularensis subsp. tularensis (strain FSC 198)
B0U5X3 0 989 68 2 705 3 fusA Elongation factor G Xylella fastidiosa (strain M12)
Q48D33 0 989 69 4 702 3 fusA Elongation factor G Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A7N9S4 0 989 70 2 707 3 fusA Elongation factor G Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q889X4 0 989 69 4 702 3 fusA Elongation factor G Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZMP1 0 988 69 4 702 3 fusA Elongation factor G Pseudomonas syringae pv. syringae (strain B728a)
Q87A35 0 988 68 2 705 3 fusA Elongation factor G Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PA90 0 988 68 2 705 3 fusA Elongation factor G Xylella fastidiosa (strain 9a5c)
B2IA64 0 988 68 2 705 3 fusA Elongation factor G Xylella fastidiosa (strain M23)
Q21M89 0 983 68 4 708 3 fusA1 Elongation factor G 1 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
O50565 0 965 69 7 701 3 fusA Elongation factor G Thiomonas delicata
A7I3T6 0 965 67 6 707 3 fusA Elongation factor G Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q39Y09 0 965 67 5 702 3 fusA1 Elongation factor G 1 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A6Q1M7 0 962 67 5 707 3 fusA Elongation factor G Nitratiruptor sp. (strain SB155-2)
Q7MA53 0 954 65 6 709 3 fusA Elongation factor G Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A1VYJ8 0 952 65 4 707 3 fusA Elongation factor G Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q748Y8 0 951 66 5 702 3 fusA2 Elongation factor G 2 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
P56002 0 950 65 5 707 3 fusA Elongation factor G Helicobacter pylori (strain ATCC 700392 / 26695)
Q17VN9 0 949 65 5 707 3 fusA Elongation factor G Helicobacter acinonychis (strain Sheeba)
A7H4P5 0 949 65 4 707 3 fusA Elongation factor G Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q1CS71 0 948 65 5 707 3 fusA Elongation factor G Helicobacter pylori (strain HPAG1)
B5Z8J0 0 948 65 5 707 3 fusA Elongation factor G Helicobacter pylori (strain G27)
B6JN34 0 948 65 5 707 3 fusA Elongation factor G Helicobacter pylori (strain P12)
B9KFH1 0 948 64 4 707 3 fusA Elongation factor G Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q5HVX6 0 948 65 4 707 3 fusA Elongation factor G Campylobacter jejuni (strain RM1221)
Q9PI16 0 948 65 4 707 3 fusA Elongation factor G Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FKR7 0 948 65 4 707 3 fusA Elongation factor G Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
B2UUV6 0 948 65 5 707 3 fusA Elongation factor G Helicobacter pylori (strain Shi470)
Q9ZK24 0 947 65 5 707 3 fusA Elongation factor G Helicobacter pylori (strain J99 / ATCC 700824)
B3E7T2 0 945 65 5 702 3 fusA Elongation factor G Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q7VJ85 0 945 65 5 707 3 fusA Elongation factor G Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B5EFP7 0 944 65 5 702 3 fusA Elongation factor G Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B5ELX6 0 944 64 4 704 3 fusA Elongation factor G Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J464 0 944 64 4 704 3 fusA Elongation factor G Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B9L7K0 0 938 65 6 708 3 fusA Elongation factor G Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
A8EW86 0 936 65 6 710 3 fusA Elongation factor G Aliarcobacter butzleri (strain RM4018)
A0RQI0 0 936 64 4 707 3 fusA Elongation factor G Campylobacter fetus subsp. fetus (strain 82-40)
A8Z6I6 0 932 63 4 705 3 fusA Elongation factor G Campylobacter concisus (strain 13826)
Q8R602 0 929 64 4 706 3 fusA Elongation factor G Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q18CF4 0 927 64 6 705 3 fusA Elongation factor G Clostridioides difficile (strain 630)
Q2RFP4 0 925 64 6 707 3 fusA Elongation factor G Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B8D0C1 0 924 63 5 702 3 fusA Elongation factor G Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A7GZJ4 0 923 63 6 705 3 fusA Elongation factor G Campylobacter curvus (strain 525.92)
A3DIZ9 0 916 64 6 705 3 fusA Elongation factor G Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B9MQH0 0 914 62 5 706 3 fusA Elongation factor G Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B4S5N0 0 914 63 6 711 3 fusA Elongation factor G Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B3EP64 0 913 63 5 710 3 fusA Elongation factor G Chlorobium phaeobacteroides (strain BS1)
Q8KAG9 0 912 63 5 710 3 fusA-1 Elongation factor G Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A4XI36 0 912 62 5 706 3 fusA Elongation factor G Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q2IJ93 0 912 63 5 702 3 fusA1 Elongation factor G 1 Anaeromyxobacter dehalogenans (strain 2CP-C)
B0TC53 0 910 64 5 707 3 fusA Elongation factor G Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q3A9R2 0 910 64 5 708 3 fusA Elongation factor G Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3APH0 0 906 62 5 710 3 fusA Elongation factor G Chlorobium chlorochromatii (strain CaD3)
A6TWI5 0 902 62 5 705 3 fusA Elongation factor G Alkaliphilus metalliredigens (strain QYMF)
Q3B6G4 0 902 61 6 718 3 fusA Elongation factor G Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A0L5X0 0 901 63 5 701 3 fusA Elongation factor G Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A4SCQ6 0 901 61 6 718 3 fusA Elongation factor G Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A4J108 0 900 64 5 707 3 fusA Elongation factor G Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B8I5N7 0 899 63 6 706 3 fusA Elongation factor G Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q97EH4 0 899 62 6 702 3 fusA Elongation factor G Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B3QY21 0 898 61 5 711 3 fusA Elongation factor G Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B3QR64 0 898 62 5 710 3 fusA Elongation factor G Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B4SBU4 0 897 61 5 710 3 fusA Elongation factor G Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q3A6Q0 0 897 61 5 702 3 fusA2 Elongation factor G 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B2A4D6 0 895 61 5 705 3 fusA Elongation factor G Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
C1A6Q2 0 894 62 2 707 3 fusA Elongation factor G Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
B3EH94 0 894 61 6 715 3 fusA Elongation factor G Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q30TP3 0 894 62 5 710 3 fusA Elongation factor G Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
B8G1W3 0 893 62 5 705 3 fusA Elongation factor G Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q250N5 0 892 62 5 705 3 fusA Elongation factor G Desulfitobacterium hafniense (strain Y51)
A6Q6I6 0 891 63 6 710 3 fusA Elongation factor G Sulfurovum sp. (strain NBC37-1)
Q890N8 0 890 61 6 703 3 fusA Elongation factor G Clostridium tetani (strain Massachusetts / E88)
A1BJ37 0 888 61 5 710 3 fusA Elongation factor G Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q8R7V1 0 888 62 6 706 3 fusA Elongation factor G Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A0PXU3 0 887 62 6 702 3 fusA Elongation factor G Clostridium novyi (strain NT)
A8MLD7 0 887 63 7 706 3 fusA Elongation factor G Alkaliphilus oremlandii (strain OhILAs)
C0ZIH5 0 885 62 5 703 3 fusA Elongation factor G Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A7GK17 0 884 62 6 703 3 fusA Elongation factor G Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q6HPR1 0 881 63 6 703 3 fusA Elongation factor G Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1ET36 0 881 63 6 703 3 fusA Elongation factor G Bacillus cereus (strain 03BB102)
Q81VT3 0 881 63 6 703 3 fusA Elongation factor G Bacillus anthracis
C3P9Q2 0 881 63 6 703 3 fusA Elongation factor G Bacillus anthracis (strain A0248)
A6LPQ8 0 881 61 6 705 3 fusA Elongation factor G Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B0K5P0 0 880 61 7 706 3 fusA Elongation factor G Thermoanaerobacter sp. (strain X514)
B0KCJ7 0 880 61 7 706 3 fusA Elongation factor G Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A5D5I7 0 880 61 6 705 3 fusA Elongation factor G Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q0RRS4 0 880 62 3 698 3 fusA Elongation factor G Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q63H93 0 880 62 6 703 3 fusA Elongation factor G Bacillus cereus (strain ZK / E33L)
Q814C5 0 880 62 6 703 3 fusA Elongation factor G Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B9IZJ1 0 880 62 6 703 3 fusA Elongation factor G Bacillus cereus (strain Q1)
B7HQU1 0 880 62 6 703 3 fusA Elongation factor G Bacillus cereus (strain AH187)
B7HJ45 0 880 62 6 703 3 fusA Elongation factor G Bacillus cereus (strain B4264)
Q73F99 0 879 62 6 703 3 fusA Elongation factor G Bacillus cereus (strain ATCC 10987 / NRS 248)
C3LJ79 0 879 62 6 703 3 fusA Elongation factor G Bacillus anthracis (strain CDC 684 / NRRL 3495)
B7JKB6 0 879 62 6 703 3 fusA Elongation factor G Bacillus cereus (strain AH820)
B7GJ64 0 879 62 6 703 3 fusA Elongation factor G Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q5L400 0 879 61 5 703 3 fusA Elongation factor G Geobacillus kaustophilus (strain HTA426)
A9VP74 0 879 62 6 703 3 fusA Elongation factor G Bacillus mycoides (strain KBAB4)
B7IT16 0 878 62 6 703 3 fusA Elongation factor G Bacillus cereus (strain G9842)
A0LRL7 0 878 60 2 699 3 fusA Elongation factor G Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A4IJI6 0 876 61 5 703 3 fusA Elongation factor G Geobacillus thermodenitrificans (strain NG80-2)
Q67JU0 0 876 61 4 708 3 fusA Elongation factor G Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B2V7L6 0 875 60 5 706 3 fusA Elongation factor G Sulfurihydrogenibium sp. (strain YO3AOP1)
Q8Y421 0 875 61 6 704 3 fusA Elongation factor G Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DAY6 0 875 61 6 704 3 fusA Elongation factor G Listeria monocytogenes serotype 4a (strain HCC23)
Q71WB8 0 875 61 6 704 3 fusA Elongation factor G Listeria monocytogenes serotype 4b (strain F2365)
C1KZK7 0 875 61 6 704 3 fusA Elongation factor G Listeria monocytogenes serotype 4b (strain CLIP80459)
A0ALY9 0 875 61 6 704 3 fusA Elongation factor G Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A8LC59 0 874 62 3 692 3 fusA Elongation factor G Parafrankia sp. (strain EAN1pec)
Q927I5 0 874 61 6 704 3 fusA Elongation factor G Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q2JFH9 0 873 62 3 692 3 fusA Elongation factor G Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A9KRZ3 0 872 60 7 711 3 fusA Elongation factor G Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q01W89 0 871 60 3 708 3 fusA Elongation factor G Solibacter usitatus (strain Ellin6076)
C0QQM0 0 871 59 6 706 3 fusA Elongation factor G Persephonella marina (strain DSM 14350 / EX-H1)
Q9Z9L7 0 871 61 6 708 3 fusA Elongation factor G Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0TMP3 0 870 61 6 706 3 fusA Elongation factor G Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q1MPS9 0 870 60 4 706 3 fusA Elongation factor G Lawsonia intracellularis (strain PHE/MN1-00)
Q47LJ0 0 869 61 4 699 3 fusA Elongation factor G Thermobifida fusca (strain YX)
C5D3R4 0 869 61 5 703 3 fusA Elongation factor G Geobacillus sp. (strain WCH70)
Q0SQE1 0 867 61 6 706 3 fusA Elongation factor G Clostridium perfringens (strain SM101 / Type A)
Q8XHS1 0 867 61 6 706 3 fusA Elongation factor G Clostridium perfringens (strain 13 / Type A)
A7GJ77 0 867 60 7 706 3 fusA Elongation factor G Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IGF7 0 867 60 7 706 3 fusA Elongation factor G Clostridium botulinum (strain Okra / Type B1)
A5I7K9 0 867 60 7 706 3 fusA Elongation factor G Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZ72 0 867 60 7 706 3 fusA Elongation factor G Clostridium botulinum (strain ATCC 19397 / Type A)
B1KSM8 0 865 60 7 706 3 fusA Elongation factor G Clostridium botulinum (strain Loch Maree / Type A3)
C1FMV4 0 865 60 7 706 3 fusA Elongation factor G Clostridium botulinum (strain Kyoto / Type A2)
C3KVQ4 0 865 60 7 706 3 fusA Elongation factor G Clostridium botulinum (strain 657 / Type Ba4)
B0S0I4 0 864 60 6 709 3 fusA Elongation factor G Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
B2UYA7 0 864 61 6 701 3 fusA Elongation factor G Clostridium botulinum (strain Alaska E43 / Type E3)
Q2W2I8 0 863 60 5 703 3 fusA Elongation factor G Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q1ISC5 0 862 59 6 704 3 fusA Elongation factor G Koribacter versatilis (strain Ellin345)
B1W417 0 862 62 6 706 3 fusA Elongation factor G Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q5WLR5 0 861 59 6 707 3 fusA Elongation factor G Shouchella clausii (strain KSM-K16)
A1T4L5 0 861 60 3 699 3 fusA Elongation factor G Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A7HWQ8 0 859 60 4 701 3 fusA Elongation factor G Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A4T1R3 0 858 60 3 699 3 fusA Elongation factor G Mycolicibacterium gilvum (strain PYR-GCK)
Q2RQV7 0 858 60 4 701 3 fusA Elongation factor G Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
C5C0J4 0 857 60 3 704 3 fusA Elongation factor G Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
C5CC67 0 857 61 3 704 3 fusA Elongation factor G Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
C1F645 0 857 58 6 706 3 fusA Elongation factor G Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
B1GZ80 0 857 59 5 703 3 fusA Elongation factor G Endomicrobium trichonymphae
Q8FS85 0 856 59 3 705 3 fusA Elongation factor G Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q1GP96 0 856 60 5 701 3 fusA Elongation factor G Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q30Z38 0 856 61 3 708 3 fusA Elongation factor G Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1BDD4 0 856 60 3 699 3 fusA Elongation factor G Mycobacterium sp. (strain MCS)
A1UBL0 0 856 60 3 699 3 fusA Elongation factor G Mycobacterium sp. (strain KMS)
A3PV95 0 856 60 3 699 3 fusA Elongation factor G Mycobacterium sp. (strain JLS)
B2J5B0 0 855 59 6 702 3 fusA Elongation factor G Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A4QBG9 0 855 60 4 708 3 fusA Elongation factor G Corynebacterium glutamicum (strain R)
A7Z0N4 0 855 60 6 703 3 fusA Elongation factor G Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P80868 0 854 60 6 703 1 fusA Elongation factor G Bacillus subtilis (strain 168)
C1AYS4 0 854 60 3 699 3 fusA Elongation factor G Rhodococcus opacus (strain B4)
Q7NEF2 0 854 59 7 714 3 fusA Elongation factor G Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8NT19 0 854 59 4 708 3 fusA Elongation factor G Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q7VA04 0 853 59 6 702 3 fusA Elongation factor G Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B1HMZ1 0 853 59 6 703 3 fusA Elongation factor G Lysinibacillus sphaericus (strain C3-41)
C4KZQ0 0 853 60 6 709 3 fusA Elongation factor G Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q65PB0 0 853 60 6 703 3 fusA Elongation factor G Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q5NQ66 0 852 60 6 698 3 fusA Elongation factor G Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
C0ZVT6 0 852 60 3 699 3 fusA Elongation factor G Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q4JT40 0 852 58 5 706 3 fusA Elongation factor G Corynebacterium jeikeium (strain K411)
Q0SFF3 0 852 60 3 699 3 fusA Elongation factor G Rhodococcus jostii (strain RHA1)
B1MGH8 0 852 60 4 699 3 fusA Elongation factor G Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q3MDM4 0 852 59 6 702 3 fusA Elongation factor G Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A5V605 0 851 60 5 701 3 fusA Elongation factor G Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q5YPG3 0 851 60 3 699 3 fusA Elongation factor G Nocardia farcinica (strain IFM 10152)
B8DN94 0 850 61 3 705 3 fusA Elongation factor G Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A4XBP9 0 850 60 5 703 3 fusA Elongation factor G Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
B2GIL1 0 850 59 4 704 3 fusA Elongation factor G Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
A8F981 0 850 60 6 703 3 fusA Elongation factor G Bacillus pumilus (strain SAFR-032)
A4VSN3 0 850 60 6 703 3 fusA Elongation factor G Streptococcus suis (strain 05ZYH33)
A4VYX6 0 850 60 6 703 3 fusA Elongation factor G Streptococcus suis (strain 98HAH33)
A6W5T4 0 850 60 3 700 3 fusA Elongation factor G Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q1AU26 0 849 58 7 721 3 fusA Elongation factor G Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q8YP62 0 849 59 5 702 3 fusA Elongation factor G Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8KTB0 0 848 59 6 697 3 fusA Elongation factor G Rickettsia bellii
A8GV17 0 848 59 6 697 3 fusA Elongation factor G Rickettsia bellii (strain OSU 85-389)
A8M532 0 848 59 4 703 3 fusA Elongation factor G Salinispora arenicola (strain CNS-205)
A8G709 0 848 59 6 702 3 fusA Elongation factor G Prochlorococcus marinus (strain MIT 9215)
Q2JUX5 0 847 60 6 710 3 fusA Elongation factor G Synechococcus sp. (strain JA-3-3Ab)
A3PEZ8 0 847 59 6 702 3 fusA Elongation factor G Prochlorococcus marinus (strain MIT 9301)
A1VEB9 0 847 59 3 705 3 fusA Elongation factor G Nitratidesulfovibrio vulgaris (strain DP4)
Q72CI3 0 847 59 3 705 3 fusA Elongation factor G Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A0PM41 0 847 59 3 699 3 fusA Elongation factor G Mycobacterium ulcerans (strain Agy99)
B2HSL2 0 847 59 3 699 3 fusA Elongation factor G Mycobacterium marinum (strain ATCC BAA-535 / M)
Q8DI43 0 847 61 7 706 3 fusA Elongation factor G Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q73SD2 0 847 59 3 699 3 fusA Elongation factor G Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QL36 0 847 59 3 699 3 fusA Elongation factor G Mycobacterium avium (strain 104)
B2TIH2 0 847 60 6 701 3 fusA Elongation factor G Clostridium botulinum (strain Eklund 17B / Type B)
Q7UZY6 0 846 59 6 702 3 fusA Elongation factor G Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q2JMX8 0 846 59 7 714 3 fusA Elongation factor G Synechococcus sp. (strain JA-2-3B'a(2-13))
A2BT84 0 846 59 6 702 3 fusA Elongation factor G Prochlorococcus marinus (strain AS9601)
Q318N4 0 846 59 6 702 3 fusA Elongation factor G Prochlorococcus marinus (strain MIT 9312)
B1I1I5 0 846 59 5 702 3 fusA Elongation factor G Desulforudis audaxviator (strain MP104C)
B8HVR8 0 845 60 8 714 3 fusA Elongation factor G Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B8HD12 0 845 60 5 706 3 fusA Elongation factor G Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q1RHC3 0 844 59 7 698 3 fusA Elongation factor G Rickettsia bellii (strain RML369-C)
Q8KTA8 0 844 58 7 711 3 fusA Elongation factor G Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A8GMA0 0 843 59 7 711 3 fusA Elongation factor G Rickettsia akari (strain Hartford)
Q2G8Y3 0 843 59 5 698 3 fusA Elongation factor G Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B1VET0 0 843 58 3 705 3 fusA Elongation factor G Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
P40173 0 843 60 4 703 3 fusA Elongation factor G 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B4U0V9 0 842 60 6 703 3 fusA Elongation factor G Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0MF25 0 842 60 6 703 3 fusA Elongation factor G Streptococcus equi subsp. zooepidemicus (strain H70)
C0M937 0 842 60 6 703 3 fusA Elongation factor G Streptococcus equi subsp. equi (strain 4047)
A8F0P0 0 842 58 6 709 3 fusA Elongation factor G Rickettsia massiliae (strain Mtu5)
Q7U4D2 0 842 59 6 702 3 fusA Elongation factor G Parasynechococcus marenigrum (strain WH8102)
Q118Z3 0 842 59 9 704 3 fusA1 Elongation factor G 1 Trichodesmium erythraeum (strain IMS101)
Q3AMT5 0 842 58 6 702 3 fusA Elongation factor G Synechococcus sp. (strain CC9605)
A7NR66 0 842 58 6 713 3 fusA Elongation factor G Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q0ID58 0 841 59 8 703 3 fusA Elongation factor G Synechococcus sp. (strain CC9311)
A9WSW6 0 840 61 4 704 3 fusA Elongation factor G Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
A4FPM8 0 840 60 5 705 3 fusA Elongation factor G Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
A8GQV7 0 839 58 7 709 3 fusA Elongation factor G Rickettsia rickettsii (strain Sheila Smith)
B0BWA2 0 839 58 7 709 3 fusA Elongation factor G Rickettsia rickettsii (strain Iowa)
C3PMH0 0 839 58 7 711 3 fusA Elongation factor G Rickettsia africae (strain ESF-5)
B6JET0 0 839 58 4 701 3 fusA Elongation factor G Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q8KTB8 0 839 58 8 711 3 fusA Elongation factor G Rickettsia sibirica (strain ATCC VR-151 / 246)
A5CUB7 0 839 58 3 704 3 fusA Elongation factor G Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
P0DA85 0 838 59 6 703 3 fus Elongation factor G Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48VB6 0 838 59 6 703 3 fusA Elongation factor G Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1J8I4 0 838 59 6 703 3 fusA Elongation factor G Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JIM6 0 838 59 6 703 3 fusA Elongation factor G Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JNH7 0 838 59 6 703 3 fusA Elongation factor G Streptococcus pyogenes serotype M12 (strain MGAS9429)
P69948 0 838 59 6 703 3 fus Elongation factor G Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDW4 0 838 59 6 703 1 fus Elongation factor G Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DA84 0 838 59 6 703 3 fus Elongation factor G Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P69946 0 838 59 6 703 3 fus Elongation factor G Streptococcus pyogenes serotype M1
Q82DQ1 0 838 60 4 703 3 fusA Elongation factor G Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q92J93 0 838 58 7 711 3 fusA Elongation factor G Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A9B746 0 838 61 7 709 3 fusA Elongation factor G Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q6NJD6 0 838 58 3 705 3 fusA Elongation factor G Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
O66428 0 838 56 6 708 3 fusA Elongation factor G Aquifex aeolicus (strain VF5)
C4K1P6 0 838 58 7 711 3 fusA Elongation factor G Rickettsia peacockii (strain Rustic)
A5GIP1 0 838 59 9 704 3 fusA Elongation factor G Synechococcus sp. (strain WH7803)
A5GW13 0 837 58 6 702 3 fusA Elongation factor G Synechococcus sp. (strain RCC307)
B5XJR1 0 837 59 6 703 3 fusA Elongation factor G Streptococcus pyogenes serotype M49 (strain NZ131)
Q8KTC1 0 837 58 7 711 3 fusA Elongation factor G Rickettsia rickettsii
P30767 0 837 58 3 699 3 fusA Elongation factor G Mycobacterium leprae (strain TN)
B8ZSC2 0 837 58 3 699 3 fusA Elongation factor G Mycobacterium leprae (strain Br4923)
Q8DVV4 0 837 59 7 707 3 fusA Elongation factor G Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8DXS7 0 837 59 6 708 3 fusA Elongation factor G Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZB5 0 837 59 6 708 3 fusA Elongation factor G Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8KTB7 0 837 58 6 709 3 fusA Elongation factor G Rickettsia rhipicephali
A3CQM2 0 836 59 6 703 3 fusA Elongation factor G Streptococcus sanguinis (strain SK36)
A2RCI2 0 836 59 6 703 3 fusA Elongation factor G Streptococcus pyogenes serotype M5 (strain Manfredo)
A8AUR6 0 836 59 6 703 3 fusA Elongation factor G Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8E3E7 0 836 59 6 708 3 fusA Elongation factor G Streptococcus agalactiae serotype III (strain NEM316)
Q8KTB6 0 836 58 7 711 3 fusA Elongation factor G Rickettsia montanensis
B0RB35 0 836 58 3 704 3 fusA Elongation factor G Clavibacter sepedonicus
P74228 0 836 59 6 702 3 fusB Elongation factor G 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P18667 0 836 58 8 709 3 fusA Elongation factor G Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31PV4 0 836 58 8 709 3 fusA Elongation factor G Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8KTB4 0 836 58 8 711 3 fusA Elongation factor G Rickettsia helvetica
B1YGU7 0 836 60 5 707 3 fusA Elongation factor G Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q839G9 0 836 60 6 703 1 fusA Elongation factor G Enterococcus faecalis (strain ATCC 700802 / V583)
C3PKP1 0 836 58 4 705 3 fusA Elongation factor G Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
P13550 0 836 58 7 708 3 fusA Elongation factor G Arthrospira platensis
A5USJ2 0 835 57 6 713 3 fusA Elongation factor G Roseiflexus sp. (strain RS-1)
C1CIF3 0 835 59 6 703 3 fusA Elongation factor G Streptococcus pneumoniae (strain P1031)
A9BCK1 0 835 60 6 702 3 fusA Elongation factor G Prochlorococcus marinus (strain MIT 9211)
P41084 0 834 58 6 708 1 fusA Elongation factor G Rickettsia prowazekii (strain Madrid E)
Q6ACY9 0 834 58 3 704 3 fusA Elongation factor G Leifsonia xyli subsp. xyli (strain CTCB07)
A1A0T0 0 834 58 3 702 3 fusA Elongation factor G Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
B8ZKU0 0 833 59 6 703 3 fusA Elongation factor G Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B3QZH4 0 833 58 6 709 3 fusA Elongation factor G Phytoplasma mali (strain AT)
Q7NAV3 0 833 57 7 711 3 fusA Elongation factor G Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
C1CC62 0 833 59 6 703 3 fusA Elongation factor G Streptococcus pneumoniae (strain JJA)
B1I8Z9 0 833 59 6 703 3 fusA Elongation factor G Streptococcus pneumoniae (strain Hungary19A-6)
Q6F0J4 0 833 58 5 703 3 fusA Elongation factor G Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q83NA0 0 832 57 4 701 3 fusA Elongation factor G Tropheryma whipplei (strain TW08/27)
C1CPE5 0 832 59 6 703 3 fusA Elongation factor G Streptococcus pneumoniae (strain Taiwan19F-14)
B9DVS2 0 832 58 6 708 3 fusA Elongation factor G Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B2ISJ9 0 832 59 6 703 3 fusA Elongation factor G Streptococcus pneumoniae (strain CGSP14)
P09952 0 832 60 5 705 3 fusA Elongation factor G Micrococcus luteus
Q83FP1 0 832 57 4 701 3 fusA Elongation factor G Tropheryma whipplei (strain Twist)
P64023 0 832 59 7 705 3 fusA Elongation factor G Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P64022 0 832 59 7 705 3 fusA Elongation factor G Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1CB46 0 832 59 7 705 3 fusA Elongation factor G Streptococcus pneumoniae (strain 70585)
B5E6U5 0 832 59 7 705 3 fusA Elongation factor G Streptococcus pneumoniae serotype 19F (strain G54)
Q04MH7 0 832 59 7 705 3 fusA Elongation factor G Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q89J81 0 831 58 5 701 3 fusA Elongation factor G Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8KTB9 0 830 58 7 709 3 fusA Elongation factor G Rickettsia parkeri

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_11740
Feature type CDS
Gene fusA
Product elongation factor G
Location 220 - 2346 (strand: -1)
Length 2127 (nucleotides) / 708 (amino acids)
In genomic island -

Contig

Accession contig_14
Length 134564 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1725
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF00679 Elongation factor G C-terminus
PF03144 Elongation factor Tu domain 2
PF03764 Elongation factor G, domain IV
PF14492 Elongation Factor G, domain III

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0480 Translation, ribosomal structure and biogenesis (J) J Translation elongation factor EF-G, a GTPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02355 elongation factor G - -

Protein Sequence

MARQTPISRYRNIGISAHIDAGKTTTTERILFYTGVNHKIGETHEGSATMDWMEQEQERGITITSAATTAFWSGMGKQFEPHRINIIDTPGHVDFTIEVERSMRVLDGAVMVYCAVGGVQPQSETVWRQANKYHVPRIAFVNKMDRMGANFLKVVDQIKTRLAATPVPLQLAIGAEESFTGVVDLVKMKAIQWSEEDQGVTFVYEDIPANMQELAAEWHQNLVEAAAEASEELMEKYLGGEELTEAEIKSALRQRVLANEIILVTCGSAFKNKGVQAMLDAVVEYLPSPTEVPAIKGILDDGKDTPAERHSSDEEPFASLAFKIATDPFVGNLTFFRVYSGVVNSGDTVLNPVKSKKERFGRIVQMHANKREEIKEVRAGDIAAAIGLKDVTTGDTLCAIDAPIILERMEFPEPVISVAIEPKTKADQEKMGIALGRLAQEDPSFRVSSDEETNQTIIAGMGELHLDVLVDRMRREFKVEANVGKPQVAYREAITMKVTDIEGKHAKQSGGRGQYGHVVIDMYPLNKKDAEGVNMEYEFVNEIKGGVIPGEYIPAVDKGIQEQLKSGPLAGYPVVNMGVRLHFGSYHDVDSSELAFKLAASLAFKDGFKKAKPVLLEPIMKVEVETPEDYMGDVIGDLNRRRGMIEGMDDMPTGKIVRAQVPLSEMFGYATDLRSQTQGRASYSMEFLKYNEAPNNVAQAVIEARNAK

Flanking regions ( +/- flanking 50bp)

CCGTAAGGCTGCCCGACCAAATTAAACGAACGTCCAAGAGAGAGGAAAAAATGGCTCGTCAAACACCCATTTCACGTTACCGTAATATCGGTATCAGTGCACATATCGACGCCGGTAAAACCACCACAACAGAACGTATTCTGTTTTATACAGGTGTGAACCATAAAATTGGTGAGACCCACGAAGGTTCAGCAACGATGGACTGGATGGAGCAGGAACAAGAGCGTGGTATTACTATCACCTCCGCAGCAACCACTGCGTTCTGGTCCGGTATGGGCAAACAATTTGAACCACACCGCATCAACATCATCGACACCCCGGGGCACGTTGACTTCACAATCGAAGTAGAACGTTCCATGCGTGTTCTTGATGGTGCTGTAATGGTTTACTGTGCCGTTGGTGGTGTTCAGCCACAGTCTGAAACCGTATGGCGCCAGGCAAACAAATATCATGTACCTCGTATCGCGTTCGTTAACAAAATGGACCGTATGGGTGCAAACTTCCTGAAAGTTGTTGATCAGATCAAAACCCGCTTAGCGGCTACTCCGGTTCCTCTTCAGTTAGCTATCGGCGCTGAAGAATCATTCACCGGTGTTGTTGACCTGGTTAAAATGAAAGCGATTCAGTGGAGTGAAGAAGACCAGGGCGTTACTTTCGTCTACGAAGATATCCCGGCAAACATGCAGGAATTAGCTGCTGAATGGCACCAGAATCTGGTTGAAGCCGCAGCTGAAGCCTCAGAAGAGCTGATGGAAAAATATCTCGGCGGTGAAGAACTGACTGAAGCTGAAATCAAATCAGCATTACGTCAGCGCGTACTGGCGAACGAAATTATCCTGGTAACCTGTGGTTCTGCATTTAAGAACAAAGGTGTTCAGGCGATGCTGGATGCGGTTGTTGAGTACCTGCCATCTCCGACAGAAGTTCCTGCAATTAAAGGTATTCTGGACGACGGTAAAGATACCCCGGCTGAGCGTCACTCTTCTGATGAAGAGCCGTTTGCATCTCTGGCATTTAAAATTGCAACCGACCCGTTCGTGGGTAACCTGACGTTCTTCCGCGTGTACTCTGGTGTTGTTAACTCCGGTGATACCGTACTGAACCCGGTTAAATCCAAGAAAGAACGTTTCGGCCGTATCGTTCAGATGCACGCTAACAAACGTGAAGAGATTAAAGAAGTTCGCGCTGGTGACATCGCGGCTGCAATCGGTCTGAAAGACGTCACTACAGGTGATACTCTGTGTGCGATTGATGCACCAATCATCCTGGAGCGTATGGAATTCCCTGAGCCGGTAATCTCCGTTGCAATCGAGCCGAAAACCAAAGCTGACCAGGAAAAAATGGGTATCGCGCTGGGCCGTCTGGCACAGGAAGATCCATCATTCCGCGTATCAAGTGATGAAGAGACTAACCAGACTATCATCGCCGGTATGGGTGAATTACACCTGGACGTTCTGGTCGACCGTATGCGTCGTGAGTTCAAAGTTGAAGCGAACGTGGGTAAACCACAGGTTGCTTACCGCGAAGCAATCACTATGAAAGTGACTGATATCGAAGGTAAACACGCTAAACAGTCCGGTGGTCGTGGTCAGTACGGTCATGTTGTTATCGACATGTACCCGCTGAACAAGAAAGATGCCGAAGGCGTCAATATGGAATACGAATTTGTCAACGAAATCAAAGGTGGTGTGATTCCTGGTGAATACATCCCTGCGGTTGACAAAGGTATCCAGGAGCAGCTGAAATCTGGTCCGTTAGCAGGCTACCCTGTTGTTAACATGGGTGTTCGTCTGCACTTCGGTTCATACCATGATGTTGACTCCTCTGAACTGGCGTTTAAACTGGCAGCATCTCTGGCGTTTAAAGACGGCTTCAAAAAAGCGAAACCAGTTCTGCTGGAACCAATCATGAAAGTTGAGGTGGAAACACCGGAAGACTACATGGGTGACGTCATTGGTGACCTGAACCGTCGTCGCGGTATGATCGAAGGTATGGATGACATGCCTACCGGTAAAATCGTCCGTGCGCAAGTGCCACTGTCTGAAATGTTTGGTTATGCAACTGACCTGCGTTCACAGACTCAGGGCCGTGCTTCTTACTCCATGGAATTCCTGAAGTATAATGAAGCGCCAAACAACGTAGCTCAGGCTGTTATTGAAGCTCGTAATGCAAAATAATCGGTAACTTACCGGTTTAACTCGTTAATTTCAGTCCCTTCTCACAGTGA