Homologs in group_1635

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_15095 EHELCC_15095 100.0 Morganella morganii S2 pstA phosphate ABC transporter permease PstA
NLDBIP_14925 NLDBIP_14925 100.0 Morganella morganii S4 pstA phosphate ABC transporter permease PstA
LHKJJB_14420 LHKJJB_14420 100.0 Morganella morganii S3 pstA phosphate ABC transporter permease PstA
HKOGLL_13040 HKOGLL_13040 100.0 Morganella morganii S5 pstA phosphate ABC transporter permease PstA
F4V73_RS14475 F4V73_RS14475 96.9 Morganella psychrotolerans pstA phosphate ABC transporter permease PstA
PMI_RS14310 PMI_RS14310 88.4 Proteus mirabilis HI4320 pstA phosphate ABC transporter permease PstA

Distribution of the homologs in the orthogroup group_1635

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1635

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P07654 0.0 508 85 0 295 1 pstA Phosphate transport system permease protein PstA Escherichia coli (strain K12)
P58655 0.0 503 86 0 295 3 pstA Phosphate transport system permease protein PstA Yersinia pestis
Q9CNJ6 6.29e-117 340 61 1 272 3 pstA Phosphate transport system permease protein PstA Pasteurella multocida (strain Pm70)
P45190 1.87e-111 326 59 1 281 3 pstA Phosphate transport system permease protein PstA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q98FL4 2.72e-109 321 57 1 273 3 pstA Phosphate transport system permease protein PstA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q87C89 4.22e-96 288 53 2 282 3 pstA Phosphate transport system permease protein PstA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PBK1 1.96e-95 286 53 2 282 3 pstA Phosphate transport system permease protein PstA Xylella fastidiosa (strain 9a5c)
Q58419 3.26e-35 131 34 3 271 3 pstA Probable phosphate transport system permease protein PstA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q50097 1.17e-34 130 37 6 271 3 pstA Phosphate transport system permease protein PstA Mycobacterium leprae (strain TN)
P9WG10 3.67e-33 126 35 5 270 3 pstA1 Phosphate transport system permease protein PstA 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WG11 4.21e-33 126 35 5 270 2 pstA1 Phosphate transport system permease protein PstA 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG09 6.84e-27 109 34 5 227 1 pstA2 Phosphate transport system permease protein PstA 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG08 6.84e-27 109 34 5 227 3 pstA2 Phosphate transport system permease protein PstA 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A627 6.84e-27 109 34 5 227 3 pstA2 Phosphate transport system permease protein PstA 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P46340 7.6e-27 109 31 7 233 3 yqgI Probable ABC transporter permease protein YqgI Bacillus subtilis (strain 168)
P75185 1.29e-16 83 31 5 229 3 pstA Phosphate transport system permease protein PstA homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75185 5.16e-05 48 27 3 163 3 pstA Phosphate transport system permease protein PstA homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P46339 8e-15 76 27 3 223 3 yqgH Probable ABC transporter permease protein YqgH Bacillus subtilis (strain 168)
P47651 1.2e-14 77 34 1 141 3 pstA Phosphate transport system permease protein PstA homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q98FL3 2.73e-09 60 27 5 208 3 pstC Phosphate transport system permease protein PstC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9CNJ5 2.46e-08 57 25 6 211 3 pstC Phosphate transport system permease protein PstC Pasteurella multocida (strain Pm70)
P9WG07 6.02e-08 56 27 8 229 2 pstC1 Phosphate transport system permease protein PstC 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG06 6.02e-08 56 27 8 229 3 pstC1 Phosphate transport system permease protein PstC 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A629 6.02e-08 56 27 8 229 3 pstC1 Phosphate transport system permease protein PstC 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P45191 1.78e-06 52 22 8 257 3 pstC Phosphate transport system permease protein PstC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9PBK2 1.85e-06 52 26 8 268 3 pstC Phosphate transport system permease protein PstC Xylella fastidiosa (strain 9a5c)
Q87C90 2.9e-06 51 25 9 267 3 pstC Phosphate transport system permease protein PstC Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P45322 5.48e-06 50 29 3 115 3 modB Molybdenum transport system permease protein ModB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P46492 9.77e-06 49 34 0 72 3 metI Probable D-methionine transport system permease protein MetI Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q50098 1.45e-05 49 26 4 165 3 pstC Phosphate transport system permease protein PstC Mycobacterium leprae (strain TN)
P0AF01 3.18e-05 47 37 0 74 1 modB Molybdenum transport system permease protein ModB Escherichia coli (strain K12)
P0AF02 3.18e-05 47 37 0 74 3 modB Molybdenum transport system permease protein ModB Escherichia coli O157:H7
P0AGI0 4.09e-05 48 32 2 92 3 pstC Phosphate transport system permease protein PstC Shigella flexneri
P0AGH8 4.09e-05 48 32 2 92 1 pstC Phosphate transport system permease protein PstC Escherichia coli (strain K12)
P0AGH9 4.09e-05 48 32 2 92 3 pstC Phosphate transport system permease protein PstC Escherichia coli O157:H7
Q8RVC7 5.75e-05 47 26 3 133 1 SULP1 Sulfate permease 1, chloroplastic Chlamydomonas reinhardtii
P16701 6.78e-05 47 30 2 90 3 cysU Sulfate transport system permease protein CysT Escherichia coli (strain K12)
A2CI71 9.76e-05 46 25 5 176 3 cysT Probable sulfate transport system permease protein cysT Chlorokybus atmophyticus
P9WG05 0.000238 45 24 4 163 1 pstC2 Phosphate transport system permease protein PstC 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG04 0.000238 45 24 4 163 3 pstC2 Phosphate transport system permease protein PstC 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A631 0.000238 45 24 4 163 3 pstC2 Phosphate transport system permease protein PstC 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9MUL9 0.000265 45 26 1 89 3 cysT Probable sulfate transport system permease protein cysT Mesostigma viride
P56343 0.000408 44 24 3 159 3 cysT Probable sulfate transport system permease protein cysT Chlorella vulgaris
Q6D3B2 0.000571 44 29 3 148 3 gsiD Glutathione transport system permease protein GsiD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
E0SCY2 0.001 43 28 3 125 1 ousW Glycine betaine/choline transport system permease protein OusW Dickeya dadantii (strain 3937)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_10760
Feature type CDS
Gene pstA
Product phosphate ABC transporter permease PstA
Location 120516 - 121403 (strand: 1)
Length 888 (nucleotides) / 295 (amino acids)

Contig

Accession contig_12
Length 141735 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1635
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0581 Inorganic ion transport and metabolism (P) P ABC-type phosphate transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02038 phosphate transport system permease protein ABC transporters -

Protein Sequence

MAEMNIQQPKVDISARQKRQFWRRQKNRVALFLSMSTMAFGLFWLIWILFSTVTKGMDGMSLALFTEMTPPPNTEGGGLANAIVGSGLLILWATVIGTPLGILAGIYLAEYGRKSWLAEVTRFINDILLSAPSIVVGLFVYTIVVMQMQHFSGWAGVIALALLQIPIVIRTTENMLRLVPDSLREAAYALGTPKWKMISAITLKASVSGIITGVLLAIARIAGETAPLLFTSLSNQFWSTDLMQPIANLPVTIFKFAMSPFAEWQSLAWAGVLLITLCVLLINIVARVLFAKKKH

Flanking regions ( +/- flanking 50bp)

TATCTCCAAATTTATGGTGATGCGTCTGAATAAGAAAGAGGGGCGCTGAGATGGCTGAAATGAATATTCAACAACCGAAAGTGGATATCAGCGCACGGCAGAAACGCCAGTTCTGGCGCCGTCAGAAAAACCGCGTTGCCCTGTTTTTATCCATGTCCACCATGGCATTCGGGCTGTTCTGGTTAATCTGGATCCTGTTCTCGACCGTCACCAAAGGGATGGACGGCATGTCGCTGGCGCTGTTCACCGAAATGACACCGCCGCCGAATACCGAAGGCGGGGGTCTGGCGAACGCCATTGTCGGTTCCGGCCTGCTGATCTTATGGGCGACCGTTATCGGGACACCGCTGGGTATTCTTGCCGGGATTTATCTGGCGGAATACGGCCGTAAATCCTGGCTGGCGGAAGTCACCCGGTTTATTAATGACATTTTGTTATCCGCACCGTCGATTGTGGTCGGACTGTTTGTTTACACCATCGTGGTGATGCAGATGCAGCACTTCTCCGGCTGGGCGGGGGTGATTGCCCTGGCACTGTTACAGATCCCGATTGTTATCCGTACCACGGAAAACATGCTGCGTCTGGTGCCGGATAGCCTGCGCGAAGCGGCGTATGCCCTCGGCACACCAAAATGGAAAATGATTTCAGCGATTACCCTGAAAGCCTCGGTCTCCGGGATTATCACCGGGGTGCTGCTGGCGATTGCCCGTATTGCCGGGGAAACGGCGCCGCTGCTCTTTACCTCCCTCTCCAACCAGTTCTGGAGTACGGATCTGATGCAGCCGATTGCTAACCTGCCGGTCACTATCTTCAAGTTTGCCATGAGTCCGTTTGCGGAGTGGCAGAGTCTGGCCTGGGCGGGTGTCCTGCTGATCACACTGTGTGTGCTGTTAATTAATATCGTGGCGCGTGTGCTGTTTGCGAAGAAAAAGCACTGATTAAATGACTGCGGATGAATGAGAGAGAGTCATGAGTAAAATTCAAAACG