Homologs in group_2780

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_13950 EHELCC_13950 100.0 Morganella morganii S2 bisC Anaerobic selenocysteine-containing dehydrogenase
NLDBIP_14395 NLDBIP_14395 100.0 Morganella morganii S4 bisC Anaerobic selenocysteine-containing dehydrogenase
LHKJJB_08455 LHKJJB_08455 100.0 Morganella morganii S3 bisC Anaerobic selenocysteine-containing dehydrogenase
HKOGLL_08005 HKOGLL_08005 100.0 Morganella morganii S5 bisC Anaerobic selenocysteine-containing dehydrogenase
F4V73_RS12885 F4V73_RS12885 94.0 Morganella psychrotolerans - molybdopterin-dependent oxidoreductase

Distribution of the homologs in the orthogroup group_2780

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2780

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77374 1.02e-95 318 33 23 779 1 ynfE Putative dimethyl sulfoxide reductase chain YnfE Escherichia coli (strain K12)
P18775 2.72e-94 315 32 30 791 1 dmsA Dimethyl sulfoxide reductase DmsA Escherichia coli (strain K12)
P77783 2.18e-92 310 32 25 780 1 ynfF Probable dimethyl sulfoxide reductase chain YnfF Escherichia coli (strain K12)
P45004 1.23e-83 286 31 22 769 3 dmsA Dimethyl sulfoxide reductase DmsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44798 4.71e-71 252 28 25 783 1 torZ Trimethylamine-N-oxide reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P20099 2.63e-70 249 30 28 786 1 bisC Biotin sulfoxide reductase Escherichia coli (strain K12)
Q57366 3.18e-69 247 29 31 800 1 dmsA Dimethyl sulfoxide/trimethylamine N-oxide reductase Cereibacter sphaeroides
Q8CVZ3 3.63e-65 235 28 25 785 3 torZ Trimethylamine-N-oxide reductase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P46923 6.07e-65 234 28 25 786 1 torZ Trimethylamine-N-oxide reductase 2 Escherichia coli (strain K12)
P58362 9.47e-65 234 28 25 786 3 torZ Trimethylamine-N-oxide reductase 2 Escherichia coli O157:H7
Q8ZKZ7 2.04e-60 222 28 29 792 3 torA Trimethylamine-N-oxide reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q52675 3.35e-60 221 27 26 810 1 dorA Dimethyl sulfoxide/trimethylamine N-oxide reductase Rhodobacter capsulatus
Q8Z2M4 3.91e-60 221 28 29 792 3 torA Trimethylamine-N-oxide reductase Salmonella typhi
Q8CW73 8.22e-59 218 28 31 799 3 torA Trimethylamine-N-oxide reductase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P33225 1.94e-58 216 28 30 795 1 torA Trimethylamine-N-oxide reductase 1 Escherichia coli (strain K12)
P58360 3.7e-58 216 28 30 795 3 torA Trimethylamine-N-oxide reductase 1 Escherichia coli O157:H7
Q9CK41 2.09e-53 202 27 32 794 3 torA Trimethylamine-N-oxide reductase Pasteurella multocida (strain Pm70)
Q8D8S3 1.39e-48 187 27 33 794 3 torA Trimethylamine-N-oxide reductase Vibrio vulnificus (strain CMCP6)
Q87QI7 2.1e-48 187 27 30 787 3 torA Trimethylamine-N-oxide reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MLQ2 3.6e-47 183 26 33 794 3 torA Trimethylamine-N-oxide reductase Vibrio vulnificus (strain YJ016)
Q9KRF0 5.57e-47 183 26 30 790 3 torA Trimethylamine-N-oxide reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8EHI9 7.56e-42 167 25 26 803 3 torA Trimethylamine-N-oxide reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
O87948 8.59e-42 167 25 27 801 1 torA Trimethylamine-N-oxide reductase Shewanella massilia
Q9HR74 1.68e-37 154 25 27 779 2 dmsA Putative dimethyl sulfoxide reductase catalytic subunit A Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P80563 3.83e-37 153 24 37 860 1 athL Pyrogallol hydroxytransferase large subunit Pelobacter acidigallici
P54934 7.99e-35 145 24 23 761 3 None Biotin sulfoxide reductase Cereibacter sphaeroides
P37519 5.41e-32 136 23 27 761 3 yyaE Probable oxidoreductase YyaE Bacillus subtilis (strain 168)
P37600 2.61e-26 119 23 26 725 1 phsA Thiosulfate reductase molybdopterin-containing subunit PhsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0SP82 5.86e-25 114 24 28 712 3 yoaE Probable oxidoreductase YoaE Bacillus subtilis (strain 168)
P42434 6.36e-25 114 25 20 528 2 nasC Assimilatory nitrate reductase catalytic subunit Bacillus subtilis (strain 168)
P07658 7.25e-20 98 26 23 537 1 fdhF Formate dehydrogenase H Escherichia coli (strain K12)
Q71EW5 9.66e-20 98 22 30 750 1 None Acetylene hydratase Syntrophotalea acetylenica
P31075 3.25e-19 96 24 30 729 1 psrA Polysulfide reductase chain A Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P61159 2.01e-18 93 23 20 532 3 fdhA Formate dehydrogenase subunit alpha Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q67QZ1 7.54e-18 92 24 18 463 3 napA Nitrate reductase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8GPG4 4.27e-17 89 21 25 808 1 ddhA Dimethylsulfide dehydrogenase subunit alpha Rhodovulum sulfidophilum
Q795Y4 1.06e-15 85 25 17 499 3 yrhE Putative formate dehydrogenase YrhE Bacillus subtilis (strain 168)
A7N7J3 1.29e-15 85 21 27 745 3 napA Periplasmic nitrate reductase Vibrio campbellii (strain ATCC BAA-1116)
Q4L8G8 4.42e-15 83 22 20 545 3 SH0748 Putative formate dehydrogenase SH0748 Staphylococcus haemolyticus (strain JCSC1435)
P73448 6.19e-15 82 24 19 508 3 narB Nitrate reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7WTU0 7.17e-15 82 22 36 780 1 arrA Arsenate respiratory reductase molybdopterin-containing subunit ArrA Shewanella sp. (strain ANA-3)
Q7MD44 1.03e-14 82 21 28 728 3 napA Periplasmic nitrate reductase Vibrio vulnificus (strain YJ016)
Q8D623 1.27e-14 81 21 28 728 3 napA Periplasmic nitrate reductase Vibrio vulnificus (strain CMCP6)
B5FGW1 1.87e-14 81 21 25 722 3 napA Periplasmic nitrate reductase Aliivibrio fischeri (strain MJ11)
Q5E3J6 2.32e-14 80 21 26 722 3 napA Periplasmic nitrate reductase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q47CW6 2.55e-14 80 28 9 262 1 pcrA Perchlorate reductase subunit alpha Dechloromonas aromatica (strain RCB)
Q47CW6 6e-10 66 23 19 488 1 pcrA Perchlorate reductase subunit alpha Dechloromonas aromatica (strain RCB)
Q87GW6 2.73e-14 80 21 29 739 3 napA Periplasmic nitrate reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7A057 3.49e-14 80 22 16 493 3 MW2229 Putative formate dehydrogenase MW2229 Staphylococcus aureus (strain MW2)
Q6G711 3.49e-14 80 22 16 493 3 SAS2201 Putative formate dehydrogenase SAS2201 Staphylococcus aureus (strain MSSA476)
Q99RW4 3.49e-14 80 22 16 493 1 SA2102 Putative formate dehydrogenase SA2102 Staphylococcus aureus (strain N315)
Q931G2 3.64e-14 80 22 16 493 3 SAV2309 Putative formate dehydrogenase SAV2309 Staphylococcus aureus (strain Mu50 / ATCC 700699)
B7VRL0 5.43e-14 79 22 17 509 3 napA Periplasmic nitrate reductase Vibrio atlanticus (strain LGP32)
C3LVU3 7.53e-14 79 21 18 555 3 napA Periplasmic nitrate reductase Vibrio cholerae serotype O1 (strain M66-2)
Q9KLR4 7.53e-14 79 21 18 555 3 napA Periplasmic nitrate reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5EZX9 7.53e-14 79 21 18 555 3 napA Periplasmic nitrate reductase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C6DK59 7.65e-14 79 20 29 781 3 napA Periplasmic nitrate reductase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
P06131 1.08e-13 78 23 20 528 1 fdhA Formate dehydrogenase subunit alpha Methanobacterium formicicum
O34720 1.33e-13 78 23 14 504 3 yjgC Probable oxidoreductase YjgC Bacillus subtilis (strain 168)
Q5HDP9 1.87e-13 78 22 16 493 3 SACOL2301 Putative formate dehydrogenase SACOL2301 Staphylococcus aureus (strain COL)
Q2FVV9 1.87e-13 78 22 16 493 3 SAOUHSC_02582 Putative formate dehydrogenase SAOUHSC_02582 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEI5 1.87e-13 78 22 16 493 3 SAUSA300_2258 Putative formate dehydrogenase SAUSA300_2258 Staphylococcus aureus (strain USA300)
Q2YYT1 2.14e-13 77 22 16 493 3 SAB2186c Putative formate dehydrogenase SAB2186c Staphylococcus aureus (strain bovine RF122 / ET3-1)
D3RNN8 2.44e-13 77 25 15 397 1 soeA Sulfite dehydrogenase subunit A Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
Q1CK03 1.34e-12 75 21 30 767 3 napA Periplasmic nitrate reductase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCF3 1.34e-12 75 21 30 767 3 napA Periplasmic nitrate reductase Yersinia pestis
Q1C5S8 1.34e-12 75 21 30 767 3 napA Periplasmic nitrate reductase Yersinia pestis bv. Antiqua (strain Antiqua)
Q53176 1.85e-12 74 21 16 543 1 napA Periplasmic nitrate reductase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B1JSJ0 5.01e-12 73 21 30 767 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668I0 5.01e-12 73 21 30 767 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMK8 5.01e-12 73 21 30 767 3 napA Periplasmic nitrate reductase Yersinia pestis (strain Pestoides F)
A9QZL3 5.01e-12 73 21 30 767 3 napA Periplasmic nitrate reductase Yersinia pestis bv. Antiqua (strain Angola)
B2K970 5.01e-12 73 21 30 767 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FG75 5.01e-12 73 21 30 767 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6LTV9 5.09e-12 73 20 31 751 3 napA1 Periplasmic nitrate reductase 1 Photobacterium profundum (strain SS9)
Q8U7P1 5.33e-12 73 23 22 522 3 napA Periplasmic nitrate reductase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6GEC4 5.93e-12 73 21 17 493 3 SAR2393 Putative formate dehydrogenase SAR2393 Staphylococcus aureus (strain MRSA252)
Q6D5Z2 8.36e-12 72 20 31 792 3 napA Periplasmic nitrate reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2SGV7 1.07e-11 72 20 30 777 3 napA Periplasmic nitrate reductase Hahella chejuensis (strain KCTC 2396)
Q92Z36 1.6e-11 71 23 22 519 3 napA Periplasmic nitrate reductase Rhizobium meliloti (strain 1021)
Q49ZN0 1.67e-11 71 21 17 496 3 SSP0601 Putative formate dehydrogenase SSP0601 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A8GHJ4 1.75e-11 71 20 30 757 3 napA Periplasmic nitrate reductase Serratia proteamaculans (strain 568)
Q3HS05 3.31e-11 70 21 31 740 3 napA Periplasmic nitrate reductase Stutzerimonas stutzeri
A4VJ11 3.31e-11 70 21 31 740 3 napA Periplasmic nitrate reductase Stutzerimonas stutzeri (strain A1501)
Q2W3T1 3.56e-11 70 21 36 785 3 napA Periplasmic nitrate reductase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q6LQJ3 5.81e-11 70 21 31 770 3 napA2 Periplasmic nitrate reductase 2 Photobacterium profundum (strain SS9)
A1JL26 6.84e-11 69 20 28 765 3 napA Periplasmic nitrate reductase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A0A391NTR7 7.39e-11 69 21 32 764 1 idrA Iodate reductase subunit IdrA Pseudomonas sp. (strain SCT)
A0KIM1 1.03e-10 68 21 30 755 3 napA Periplasmic nitrate reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P09152 1.38e-10 68 25 10 265 1 narG Respiratory nitrate reductase 1 alpha chain Escherichia coli (strain K12)
Q93HX3 1.39e-10 68 21 35 787 3 napA Periplasmic nitrate reductase Paramagnetospirillum magnetotacticum
P39458 1.65e-10 68 25 13 326 1 narB Nitrate reductase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7WIQ1 2.14e-10 68 21 23 556 3 napA Periplasmic nitrate reductase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W733 2.39e-10 67 21 23 556 3 napA Periplasmic nitrate reductase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A8AE11 2.58e-10 67 20 30 773 3 napA Periplasmic nitrate reductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7M5P6 2.69e-10 67 21 31 775 3 napA Periplasmic nitrate reductase Escherichia coli O8 (strain IAI1)
B7LAM9 2.69e-10 67 21 31 775 3 napA Periplasmic nitrate reductase Escherichia coli (strain 55989 / EAEC)
A6V924 2.82e-10 67 21 31 766 3 napA Periplasmic nitrate reductase Pseudomonas aeruginosa (strain PA7)
P19319 2.97e-10 67 25 9 260 1 narZ Respiratory nitrate reductase 2 alpha chain Escherichia coli (strain K12)
B1LKV2 3.79e-10 67 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli (strain SMS-3-5 / SECEC)
Q0TFN6 3.79e-10 67 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B5FNQ2 3.85e-10 67 20 30 771 3 napA Periplasmic nitrate reductase Salmonella dublin (strain CT_02021853)
Q31Z29 6.22e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Shigella boydii serotype 4 (strain Sb227)
Q8Z570 6.33e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella typhi
B5BDZ4 6.33e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella paratyphi A (strain AKU_12601)
A9N5G2 6.33e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PI61 6.33e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TPE6 7.14e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella schwarzengrund (strain CVM19633)
P33937 7.39e-10 66 20 30 771 1 napA Periplasmic nitrate reductase Escherichia coli (strain K12)
B1X8A2 7.39e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli (strain K12 / DH10B)
C4ZU48 7.39e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli (strain K12 / MC4100 / BW2952)
B5RC85 8.05e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B2TV30 8.47e-10 66 20 29 771 3 napA Periplasmic nitrate reductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YWZ7 8.47e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XE47 8.47e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O157:H7
Q3Z001 8.69e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Shigella sonnei (strain Ss046)
B7LJU7 8.69e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I1A4 8.69e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli (strain SE11)
B7N5G7 8.69e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IY66 8.69e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8CVW4 8.69e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A268 8.69e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O9:H4 (strain HS)
Q32I06 9.07e-10 66 20 30 771 3 napA Periplasmic nitrate reductase Shigella dysenteriae serotype 1 (strain Sd197)
Q8ZNH6 9.07e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4SYT3 9.07e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella newport (strain SL254)
B4TAT3 9.07e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella heidelberg (strain SL476)
B5R233 9.07e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella enteritidis PT4 (strain P125109)
Q57M92 9.07e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella choleraesuis (strain SC-B67)
B5EYU5 9.07e-10 66 19 30 771 3 napA Periplasmic nitrate reductase Salmonella agona (strain SL483)
A7ZP28 9.23e-10 65 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7UFL9 1.04e-09 65 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83QV0 1.06e-09 65 20 32 777 3 napA Periplasmic nitrate reductase Shigella flexneri
A9MJZ6 1.11e-09 65 20 30 771 3 napA Periplasmic nitrate reductase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A9I7M5 1.36e-09 65 20 31 779 3 napA Periplasmic nitrate reductase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q0T2R8 1.43e-09 65 20 32 774 3 napA Periplasmic nitrate reductase Shigella flexneri serotype 5b (strain 8401)
Q1R9L3 1.45e-09 65 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli (strain UTI89 / UPEC)
A1AD59 1.45e-09 65 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O1:K1 / APEC
B7MFB8 1.45e-09 65 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7NN18 1.74e-09 65 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MXN6 1.96e-09 65 20 30 771 3 napA Periplasmic nitrate reductase Escherichia coli O81 (strain ED1a)
Q21AR4 2.07e-09 65 21 33 783 3 napA Periplasmic nitrate reductase Rhodopseudomonas palustris (strain BisB18)
Q487G4 2.7e-09 64 21 33 759 3 napA Periplasmic nitrate reductase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A8LLY9 2.81e-09 64 22 18 520 3 napA Periplasmic nitrate reductase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q46RX3 2.96e-09 64 20 30 745 3 napA Periplasmic nitrate reductase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5Y818 3.25e-09 64 24 13 336 1 arrA Arsenate respiratory reductase molybdopterin-containing subunit ArrA Chrysiogenes arsenatis
A4XWM0 3.77e-09 63 21 27 728 3 napA Periplasmic nitrate reductase Pseudomonas mendocina (strain ymp)
Q21PN1 5.34e-09 63 21 37 779 3 napA Periplasmic nitrate reductase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q56350 5.53e-09 63 23 24 522 1 napA Periplasmic nitrate reductase Paracoccus pantotrophus
B3R8B4 1.2e-08 62 20 31 792 3 napA Periplasmic nitrate reductase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
C0Q0P2 1.27e-08 62 19 30 771 3 napA Periplasmic nitrate reductase Salmonella paratyphi C (strain RKS4594)
Q89EN5 1.42e-08 62 20 29 792 3 napA Periplasmic nitrate reductase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B1Y6A6 1.79e-08 62 21 35 770 3 napA Periplasmic nitrate reductase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q47A87 1.98e-08 61 22 23 573 3 napA Periplasmic nitrate reductase Dechloromonas aromatica (strain RCB)
A1SWQ0 2.03e-08 61 22 23 519 3 napA Periplasmic nitrate reductase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B0UCB6 2.38e-08 61 23 24 524 3 napA Periplasmic nitrate reductase Methylobacterium sp. (strain 4-46)
Q12P44 3.27e-08 60 21 19 516 3 napA Periplasmic nitrate reductase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
I3R634 8.16e-08 59 23 18 482 1 nasA Assimilatory nitrate reductase Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
A4Z0A1 1.14e-07 59 20 28 798 3 napA Periplasmic nitrate reductase Bradyrhizobium sp. (strain ORS 278)
C5B7B9 1.37e-07 58 20 21 534 3 napA Periplasmic nitrate reductase Edwardsiella ictaluri (strain 93-146)
O33732 1.86e-07 58 24 20 456 3 Sfri_1505 Nitrate reductase Shewanella frigidimarina (strain NCIMB 400)
A0A369NIV7 2.02e-07 58 25 21 504 1 dadH Dopamine dehydroxylase Eggerthella lenta
A0A369NIV7 2.65e-05 51 24 8 214 1 dadH Dopamine dehydroxylase Eggerthella lenta
P0DV66 2.05e-07 58 21 30 766 1 idrA Iodate reductase subunit IdrA Denitromonas iodatirespirans
P46448 2.35e-07 58 28 11 242 3 fdxG Formate dehydrogenase major subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P42175 2.41e-07 58 23 7 244 3 narG Nitrate reductase alpha chain Bacillus subtilis (strain 168)
C8WLC6 2.75e-07 58 25 21 504 2 Elen_0471 Uncharacterized oxidoreductase Elen_0471 Eggerthella lenta (strain ATCC 25559 / DSM 2243 / CCUG 17323 / JCM 9979 / KCTC 3265 / NCTC 11813 / VPI 0255 / 1899 B)
C8WLC6 2.56e-05 51 24 8 214 2 Elen_0471 Uncharacterized oxidoreductase Elen_0471 Eggerthella lenta (strain ATCC 25559 / DSM 2243 / CCUG 17323 / JCM 9979 / KCTC 3265 / NCTC 11813 / VPI 0255 / 1899 B)
Q934F5 3.93e-07 57 31 7 185 1 fdhA Formate dehydrogenase subunit alpha Megalodesulfovibrio gigas
A5ED21 7.24e-07 56 20 29 792 3 napA Periplasmic nitrate reductase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q8XAX1 7.55e-07 56 23 11 308 3 ydeP Protein YdeP Escherichia coli O157:H7
P77561 8.36e-07 56 23 11 308 2 ydeP Protein YdeP Escherichia coli (strain K12)
Q83RF3 9.43e-07 56 23 11 308 3 ydeP Protein YdeP Shigella flexneri
A7I3Y7 1.17e-06 56 21 21 557 3 napA Periplasmic nitrate reductase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
C1D9G3 1.27e-06 55 20 21 556 3 napA Periplasmic nitrate reductase Laribacter hongkongensis (strain HLHK9)
P32176 1.3e-06 55 29 11 227 1 fdoG Formate dehydrogenase-O major subunit Escherichia coli (strain K12)
B0BR28 1.44e-06 55 20 19 520 3 napA Periplasmic nitrate reductase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2D1 1.44e-06 55 20 19 520 3 napA Periplasmic nitrate reductase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N277 1.44e-06 55 20 19 520 3 napA Periplasmic nitrate reductase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q8FHF8 3.15e-06 54 26 7 219 3 ydeP Protein YdeP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7VJT5 4.79e-06 53 22 38 863 3 napA Periplasmic nitrate reductase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
P39185 8.4e-06 53 23 13 334 1 napA Periplasmic nitrate reductase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
I3R9M9 1.01e-05 53 25 7 214 1 narG Respiratory nitrate reductase subunit alpha Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
P60068 1.34e-05 52 27 8 212 1 clrA Chlorate reductase subunit alpha Ideonella dechloratans
P24183 1.79e-05 52 24 8 242 1 fdnG Formate dehydrogenase, nitrate-inducible, major subunit Escherichia coli (strain K12)
Q72E84 3.66e-05 51 24 11 235 1 qrcB Menaquinone reductase, molybdopterin-binding-like subunit Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A7GZP5 0.000114 49 22 10 253 3 napA Periplasmic nitrate reductase Campylobacter curvus (strain 525.92)
Q7M962 0.000263 48 25 10 236 3 napA Periplasmic nitrate reductase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A7ZCK4 0.000718 47 22 10 252 3 napA Periplasmic nitrate reductase Campylobacter concisus (strain 13826)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_08120
Feature type CDS
Gene bisC
Product Anaerobic selenocysteine-containing dehydrogenase
Location 162169 - 164484 (strand: 1)
Length 2316 (nucleotides) / 771 (amino acids)

Contig

Accession contig_8
Length 164760 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2780
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00384 Molybdopterin oxidoreductase
PF01568 Molydopterin dinucleotide binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0243 Energy production and conversion (C) C Anaerobic selenocysteine-containing dehydrogenase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07306 anaerobic dimethyl sulfoxide reductase subunit A [EC:1.8.5.3] Sulfur metabolism
Metabolic pathways		 -

Protein Sequence

MMWWRIPQQRGCLRGRSQRKQVFGADRLKYPMKRKNWAPGGGDKTLRGRDQWVRISWDEALDIVASETKRITGQYGNESLWVTGGNGTDFQSVFSAAGGFTGDWGTTSWGAWFETPAHLGLLEGFYTFGTNDRFDMRNSQLIVMWGANPAWSSPGSPTYNYYQAKKAGARFISIDPSYTATAELMDADWYPINPGTDHALALGIMHALLEMDSPENPLIDWEFLRRCTVGFDESNMPAGADPKKNFKDYLLGTYTGKPTTPEWAADICGISASEIRSLARQIGGIQRVALLTGWAPARIHNGEGWVQAFSTLGFMTGHMGRPGRMTGACCHYAAGNNGTRLVMAGANGLPAVKNPVTLKINHNELNRALLEKKFRQRGVGDVDANIQMIFHPFNATLQTRANIMQGIEAYRSGVEFIATAAYVPHTCAKYSDVILPVTTEWEREGTILNPSNREVIIAAVNVTQPLYEAKSDQWIAKELGKRLGVNVDEIFPISEKQQFFNKLNGATIIAEDGVTKAPLFTITQADIDEWQVTGTPQEGRITLNEFLTKGKYQVERTPDDNYGYIAYEDFIRDPAANPRPTPSGKFEIYCETLVEKAKECGWTELPPIAEYIPSASGYEASFKDFSKKEKGDYPFQVYNPHYLRRSHSTLDNVPWLREQWPSPIYINTSDAKRLDIKQGETVLVTSPQGKILRPALVTQTMKPGVVALPHGSWTNVDETTGIDMAGADNTLTIQVPTGLGTSGWNTMLCNIEKWHGEQLTDDARLPQRIIG

Flanking regions ( +/- flanking 50bp)

TGTTAACAAAGCACTGGTGGCCGATGGTGTGGTGGTCAGACAAAAAACTGATGATGTGGTGGCGGATTCCGCAGCAGCGCGGGTGTCTGCGCGGGCGTTCCCAGCGTAAACAGGTGTTCGGGGCCGACCGCCTGAAATACCCGATGAAACGCAAAAACTGGGCGCCGGGCGGCGGGGACAAAACCCTGCGCGGACGTGACCAGTGGGTGCGTATCAGCTGGGATGAGGCACTGGATATTGTGGCCTCCGAAACCAAACGCATCACCGGACAATACGGCAATGAATCCCTCTGGGTTACCGGCGGTAACGGTACGGATTTCCAGAGTGTGTTCTCCGCCGCCGGGGGCTTTACCGGTGACTGGGGCACCACCTCCTGGGGCGCATGGTTTGAAACCCCGGCCCATCTGGGCCTGCTGGAAGGGTTCTACACCTTCGGCACCAATGACCGTTTTGATATGCGCAACTCACAACTGATTGTGATGTGGGGCGCAAACCCGGCGTGGTCCAGCCCGGGCAGCCCGACTTATAACTATTATCAGGCGAAAAAAGCCGGGGCGCGTTTTATCAGTATTGACCCGAGTTATACCGCCACCGCAGAGCTGATGGATGCGGACTGGTATCCGATCAACCCGGGTACAGACCACGCGCTGGCGCTGGGGATTATGCATGCACTGCTGGAGATGGACAGCCCGGAGAATCCGCTGATCGACTGGGAATTCCTGCGACGCTGCACTGTCGGTTTTGATGAGAGCAATATGCCGGCAGGGGCGGATCCGAAGAAAAACTTTAAGGATTATCTGCTCGGCACCTACACCGGCAAGCCAACCACGCCGGAATGGGCGGCGGACATCTGCGGTATTTCTGCATCGGAGATCCGCTCGCTGGCGCGTCAGATCGGCGGCATACAGCGTGTGGCGCTGTTAACCGGCTGGGCACCGGCACGTATTCATAACGGAGAGGGATGGGTTCAGGCATTCTCAACACTCGGGTTTATGACCGGGCATATGGGCCGTCCGGGCCGCATGACTGGTGCGTGTTGTCACTATGCCGCCGGGAACAACGGTACCCGTCTGGTGATGGCCGGTGCGAACGGCTTACCGGCAGTGAAAAACCCGGTCACTCTGAAAATCAACCACAACGAACTGAACCGCGCCCTGCTGGAGAAAAAATTCCGTCAGCGCGGCGTGGGGGATGTGGATGCCAATATTCAGATGATTTTCCACCCGTTTAACGCCACTTTACAGACCCGTGCCAACATTATGCAGGGAATCGAGGCGTATCGCAGCGGTGTGGAATTTATCGCGACCGCAGCGTATGTCCCGCATACCTGTGCGAAATATTCCGATGTGATCCTGCCGGTGACAACCGAGTGGGAGCGCGAGGGAACCATTCTTAACCCGAGTAACCGCGAAGTCATCATTGCTGCGGTGAATGTGACTCAGCCGCTGTATGAAGCGAAAAGCGATCAGTGGATCGCCAAAGAGCTGGGTAAACGCCTGGGTGTCAATGTGGATGAGATCTTCCCGATCTCCGAAAAACAGCAGTTCTTCAATAAACTCAACGGTGCAACCATTATTGCCGAAGACGGTGTCACCAAAGCGCCGCTGTTTACCATCACACAGGCGGATATTGATGAGTGGCAGGTGACCGGTACGCCGCAGGAAGGGCGCATCACGCTGAATGAATTCCTGACCAAAGGGAAGTATCAGGTGGAGCGCACGCCGGATGATAATTACGGCTATATCGCGTATGAGGACTTTATCCGCGATCCGGCGGCGAATCCGCGTCCGACGCCAAGCGGTAAGTTTGAAATCTACTGCGAAACCCTGGTGGAGAAAGCGAAAGAGTGCGGCTGGACAGAATTACCGCCGATCGCCGAATACATCCCGTCAGCGAGCGGCTATGAAGCCAGCTTTAAAGATTTCAGCAAAAAAGAGAAAGGGGATTATCCGTTCCAGGTTTATAACCCGCACTATCTGCGCCGTTCACACAGTACCCTGGATAACGTGCCGTGGCTGCGCGAACAGTGGCCGAGCCCGATCTACATTAATACCTCTGATGCGAAACGTCTGGATATTAAACAGGGCGAAACCGTTCTGGTGACCAGCCCGCAGGGTAAAATTCTGCGTCCGGCGCTGGTGACCCAGACGATGAAACCGGGTGTGGTTGCACTGCCGCACGGCAGCTGGACAAATGTGGATGAAACCACCGGGATTGATATGGCCGGGGCGGATAACACCCTGACCATTCAGGTACCGACCGGACTGGGCACCTCCGGGTGGAACACGATGCTGTGTAATATCGAAAAATGGCACGGTGAGCAATTAACTGACGATGCGCGTCTGCCGCAGCGGATTATCGGATAAGGGGCACAGACATGGATAACCAAGTTGGATTTTATATAAATGTCGCCGCC