Homologs in group_114

Help

10 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07910 FBDBKF_07910 41.5 Morganella morganii S1 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
EHELCC_07130 EHELCC_07130 100.0 Morganella morganii S2 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
EHELCC_13740 EHELCC_13740 41.5 Morganella morganii S2 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
NLDBIP_07455 NLDBIP_07455 100.0 Morganella morganii S4 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
NLDBIP_14185 NLDBIP_14185 41.5 Morganella morganii S4 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
LHKJJB_06990 LHKJJB_06990 100.0 Morganella morganii S3 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
LHKJJB_08665 LHKJJB_08665 41.5 Morganella morganii S3 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
HKOGLL_03940 HKOGLL_03940 100.0 Morganella morganii S5 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
HKOGLL_08215 HKOGLL_08215 41.5 Morganella morganii S5 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
F4V73_RS13075 F4V73_RS13075 41.7 Morganella psychrotolerans - amidohydrolase family protein

Distribution of the homologs in the orthogroup group_114

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_114

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A5UMN6 3.93e-39 150 30 14 440 3 dadD 5'-deoxyadenosine deaminase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q67NQ5 8.27e-34 135 29 11 454 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8PUQ3 5.85e-30 124 27 16 461 3 dadD 5'-deoxyadenosine deaminase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
O27549 1.18e-28 120 29 17 440 3 dadD 5'-deoxyadenosine deaminase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A4J675 8.4e-28 118 24 10 449 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q8TRA4 2.49e-27 117 26 14 454 3 dadD 5'-deoxyadenosine deaminase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q12WS1 6.72e-27 115 25 14 456 3 dadD 5'-deoxyadenosine deaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q0AYV2 6.97e-26 113 26 11 450 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A0LMI3 8.69e-26 112 25 10 445 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q2NHL6 1.08e-25 112 26 15 427 3 dadD 5'-deoxyadenosine deaminase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q466Q9 2.13e-25 111 25 13 455 3 dadD 5'-deoxyadenosine deaminase Methanosarcina barkeri (strain Fusaro / DSM 804)
A6VH76 2.68e-25 111 25 14 446 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
B1I2P4 6.84e-25 110 26 13 442 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforudis audaxviator (strain MP104C)
Q3AC64 1.52e-24 109 25 11 431 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q2LTB7 1.68e-24 109 26 14 464 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Syntrophus aciditrophicus (strain SB)
Q8U0P7 4.63e-24 107 25 16 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q2LUH4 5.32e-24 107 25 12 446 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Syntrophus aciditrophicus (strain SB)
A3DEQ2 7.03e-24 107 26 14 444 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q5JER0 2.01e-23 105 26 15 445 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B5YLB7 2.25e-23 105 25 14 441 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A4FW32 2.93e-23 105 24 15 450 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
B6YUF8 4.28e-23 104 25 15 463 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus onnurineus (strain NA1)
Q58936 4.69e-23 104 26 14 424 1 dadD 5'-deoxyadenosine deaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
C6A048 5.31e-23 104 25 17 470 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q9V0Y5 6.3e-23 104 24 15 460 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus abyssi (strain GE5 / Orsay)
B0K2W0 8.68e-23 103 25 11 440 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter sp. (strain X514)
B0K8R8 8.68e-23 103 25 11 440 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B8FRL9 9.8e-23 103 26 16 460 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q24UA2 1.03e-22 103 26 16 460 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain Y51)
P72156 1.4e-22 103 27 15 452 1 atzA Atrazine chlorohydrolase Pseudomonas sp. (strain ADP)
Q9EYU0 2.24e-22 103 27 15 452 1 triA Melamine deaminase Paracidovorax citrulli
A6UQD4 2.93e-22 102 24 15 449 3 dadD 5'-deoxyadenosine deaminase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A4XJI3 3.88e-22 102 24 13 443 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A9A9H3 4.43e-22 101 24 14 439 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A6UUG9 1.1e-21 100 24 11 410 3 dadD 5'-deoxyadenosine deaminase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
B5YDN9 1.75e-21 100 27 17 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A7I6C5 1.86e-21 100 27 19 435 3 dadD 5'-deoxyadenosine deaminase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q8R9L4 2.3e-21 99 25 15 443 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A1VD37 1.07e-20 97 26 14 451 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DP4)
B8DKS6 2.61e-20 96 24 14 449 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q6LX61 3.07e-20 96 22 13 432 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q72B14 4.64e-20 95 26 14 451 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A0B7V2 5.91e-20 95 23 14 437 3 dadD 5'-deoxyadenosine deaminase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
A5D1G6 6.45e-20 95 26 17 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B8E183 1.51e-19 94 25 12 423 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q81F14 1.98e-19 94 25 11 389 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q92342 2.9e-19 94 26 13 460 3 SPAC1F8.04c Uncharacterized protein C1F8.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59184 3.36e-19 93 23 15 458 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8TYD4 1.07e-18 91 25 13 451 3 dadD 5'-deoxyadenosine deaminase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
B7HIQ2 1.23e-18 91 25 14 389 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain B4264)
C1EPN0 1.26e-18 91 25 14 392 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain 03BB102)
B7JJI0 1.99e-18 90 25 14 392 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH820)
Q81S14 1.99e-18 90 25 14 392 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis
C3L6N3 1.99e-18 90 25 14 392 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P768 1.99e-18 90 25 14 392 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain A0248)
A0RCM7 2.72e-18 90 25 14 392 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis (strain Al Hakam)
Q6HK87 3.21e-18 90 25 14 392 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63CU1 3.21e-18 90 25 14 392 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ZK / E33L)
C5BSJ0 4.1e-18 90 25 12 445 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Teredinibacter turnerae (strain ATCC 39867 / T7901)
A7GNR9 5.16e-18 89 24 12 389 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
O31352 5.3e-18 89 25 14 389 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7HMN9 8.14e-18 89 25 14 392 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH187)
B7IS56 8.29e-18 89 25 14 389 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain G9842)
Q5WGA8 1.03e-17 89 23 14 462 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Shouchella clausii (strain KSM-K16)
Q9I6Z0 1.99e-17 88 24 12 442 1 PA0142 8-oxoguanine deaminase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B8CX03 2.84e-17 87 25 14 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q2FRU6 4.66e-17 87 25 15 407 3 dadD 5'-deoxyadenosine deaminase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q1MR44 9.06e-16 82 24 17 441 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Lawsonia intracellularis (strain PHE/MN1-00)
Q2RJW1 1.08e-15 82 24 9 395 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q5UYR3 2.11e-15 81 25 12 412 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
O29701 2.25e-15 81 23 15 431 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q18EV7 1.36e-14 79 22 13 472 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q9KC82 2.01e-14 79 24 12 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q891Y7 3.16e-14 78 21 9 438 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Clostridium tetani (strain Massachusetts / E88)
Q9HN51 1.01e-13 76 24 10 406 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q3ITF7 1.49e-13 75 25 12 359 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q5RAV9 2.54e-13 75 25 17 386 2 GDA Guanine deaminase Pongo abelii
P0CI72 2.75e-13 75 23 17 486 1 None Isoxanthopterin deaminase Unknown prokaryotic organism
Q9Y2T3 3.09e-13 75 24 16 385 1 GDA Guanine deaminase Homo sapiens
B8J2Q8 9.18e-13 73 22 14 467 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
O29265 1e-12 73 22 17 452 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q21IS0 4.08e-12 71 32 5 184 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
P95442 3.5e-11 68 22 17 466 1 atzB Hydroxydechloroatrazine ethylaminohydrolase Pseudomonas sp. (strain ADP)
P76641 9.18e-10 64 21 9 355 1 guaD Guanine deaminase Escherichia coli (strain K12)
O66851 1.13e-09 63 23 13 424 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Aquifex aeolicus (strain VF5)
Q9R111 1.76e-09 63 22 14 411 1 Gda Guanine deaminase Mus musculus
Q52725 4.62e-09 62 24 9 268 1 trzA S-triazine hydrolase Gordonia rubripertincta
Q07729 1.7e-08 60 22 13 427 1 GUD1 Probable guanine deaminase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9HLJ0 2.48e-08 59 21 11 398 3 hutI Imidazolonepropionase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q9WTT6 3.36e-08 59 22 17 411 1 Gda Guanine deaminase Rattus norvegicus
Q9X034 8.92e-08 57 20 11 451 1 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9RYX4 5.14e-07 55 28 2 144 3 guaD Probable guanine deaminase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A8MF65 6.18e-07 55 24 19 430 3 hutI Imidazolonepropionase Alkaliphilus oremlandii (strain OhILAs)
Q6MJP9 1.16e-06 54 24 13 381 3 hutI Imidazolonepropionase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q86AW9 7.41e-06 52 25 18 370 1 guaD Guanine deaminase Dictyostelium discoideum
O14057 1.46e-05 51 22 14 402 3 SPCC1672.03c Probable guanine deaminase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A6TSW9 2.13e-05 50 23 16 404 3 hutI Imidazolonepropionase Alkaliphilus metalliredigens (strain QYMF)
Q043B0 2.38e-05 50 27 5 154 3 pyrC Dihydroorotase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
O69809 6.52e-05 48 27 5 173 3 hyuA D-hydantoinase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q2IHZ6 7.37e-05 48 34 2 70 3 hutI Imidazolonepropionase Anaeromyxobacter dehalogenans (strain 2CP-C)
B8JBF9 0.000102 48 34 2 70 3 hutI Imidazolonepropionase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B4UEL6 0.000141 47 34 2 70 3 hutI Imidazolonepropionase Anaeromyxobacter sp. (strain K)
Q9VMY9 0.000242 47 26 2 149 1 DhpD Guanine deaminase Drosophila melanogaster
A5FB49 0.000327 46 25 3 163 3 hutI Imidazolonepropionase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A1AZX8 0.000362 46 40 1 62 3 hutI Imidazolonepropionase Paracoccus denitrificans (strain Pd 1222)
Q74J32 0.000371 46 35 2 65 3 pyrC Dihydroorotase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
B8E3L5 0.000385 46 33 3 89 3 hutI Imidazolonepropionase Shewanella baltica (strain OS223)
A6WHH8 0.000398 46 33 3 89 3 hutI Imidazolonepropionase Shewanella baltica (strain OS185)
Q5HPZ0 0.000454 46 37 2 66 3 pyrC Dihydroorotase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CPJ6 0.000458 46 37 2 66 3 pyrC Dihydroorotase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A3DAF6 0.000574 45 32 3 95 3 hutI Imidazolonepropionase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A1RQ59 0.0006 45 33 3 89 3 hutI Imidazolonepropionase Shewanella sp. (strain W3-18-1)
Q9K9V7 0.000635 45 37 2 67 3 pyrC Dihydroorotase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A4Y1I0 0.00074 45 33 3 89 3 hutI Imidazolonepropionase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q8EKJ7 0.000753 45 32 3 89 3 hutI Imidazolonepropionase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q1G867 0.000822 45 36 2 65 3 pyrC Dihydroorotase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
O27075 0.000838 45 25 4 159 3 MTH_994 Putative aminohydrolase MTH_994 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A0KRC4 0.000851 45 33 3 89 3 hutI Imidazolonepropionase Shewanella sp. (strain ANA-3)
A8YVZ5 0.000851 45 36 2 65 3 pyrC Dihydroorotase Lactobacillus helveticus (strain DPC 4571)
Q0I0K7 0.000897 45 33 3 89 3 hutI Imidazolonepropionase Shewanella sp. (strain MR-7)
Q0HP39 0.000897 45 33 3 89 3 hutI Imidazolonepropionase Shewanella sp. (strain MR-4)
Q047M6 0.001 45 36 2 65 3 pyrC Dihydroorotase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q8RCH7 0.001 45 23 15 401 3 hutI Imidazolonepropionase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5L083 0.001 45 45 2 55 3 hutI Imidazolonepropionase Geobacillus kaustophilus (strain HTA426)
A9KV78 0.001 45 32 3 89 3 hutI Imidazolonepropionase Shewanella baltica (strain OS195)
Q45515 0.001 45 29 8 157 1 None D-hydantoinase Geobacillus stearothermophilus

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_03405
Feature type CDS
Gene ssnA
Product Cytosine/adenosine deaminase or related metal-dependent hydrolase
Location 83377 - 84849 (strand: -1)
Length 1473 (nucleotides) / 490 (amino acids)

Contig

Accession contig_3
Length 210665 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_114
Orthogroup size 11
N. genomes 6

Actions

Genomic region

Domains

PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0402 Nucleotide transport and metabolism (F)
General function prediction only (R)		 FR Cytosine/adenosine deaminase or related metal-dependent hydrolase

Protein Sequence

MEKNKKIIRGGTIITMDDATGDIINGAILIEGNRISAISADIQAFDHHTDAQVIDAQGAIVTPGMIDAHRHNWMALFRGVSAEESLPAFLINTFHAFGAMMTADNMYAAVLNGNISALNAGTTTVYEVNDCVNSPEHAANAVAAMKDSGIRGVYGYGMQVYDFKPAGFASMDARRDCAREISETLFRDQDRLTAGMLISDPGTVPFAESAKQIRLADGLGLKHASHTGAAKTSVLLRGLRELDDHGLLLPGHIHAHSNGLTGEDWKLIAKSGGHVASTPSSELQMGMGFLPYQPCAEYGIPFALGTDFTGVTTDDLFTQMNMALQIERALANEKVHQRDTMPFEITPTVREALHWATLGAAQVLGMENEIGSLVAGKKADIIIIRHRDGFVAPVHAAGSVVQMTHTGDIDTVLADGVIRKQNGVLTGFDLPEVTRLSRNALAELETRIRDRKILNTQEVEAFFRLAERMASFHFAQAYSDEFFAQAMNKA

Flanking regions ( +/- flanking 50bp)

ATTATAATGTACTGTATAGTACATTTTTGATATTAACCAGAGAGGCCTGCATGGAAAAGAATAAAAAAATCATTCGCGGCGGCACAATCATCACAATGGATGATGCCACCGGCGATATTATCAACGGCGCGATACTGATCGAGGGCAACCGGATCAGCGCAATCAGTGCGGATATACAGGCATTTGATCACCACACCGATGCGCAGGTGATTGATGCACAAGGGGCGATTGTCACTCCGGGCATGATCGATGCGCACCGCCATAACTGGATGGCACTGTTCCGTGGTGTTTCGGCGGAAGAGTCGTTACCGGCATTTCTTATCAATACCTTCCATGCATTCGGCGCAATGATGACGGCAGACAATATGTATGCGGCGGTTCTGAACGGTAATATCAGCGCTCTGAATGCCGGTACGACAACGGTTTATGAGGTGAATGACTGTGTTAACTCACCGGAACATGCCGCTAATGCTGTTGCTGCTATGAAGGACAGCGGCATCCGTGGTGTCTACGGTTATGGTATGCAGGTGTATGATTTTAAACCCGCCGGTTTTGCTTCCATGGATGCACGGCGTGATTGTGCCCGTGAGATCTCTGAAACCCTGTTCCGCGACCAGGATCGGCTGACAGCCGGGATGCTGATTTCCGATCCCGGTACGGTGCCGTTTGCTGAATCGGCAAAACAGATCCGTCTGGCGGATGGTCTCGGCCTGAAACACGCCTCACACACCGGGGCGGCCAAAACCTCGGTTCTGCTGCGTGGTTTGCGTGAACTGGACGACCACGGTTTACTGCTGCCGGGACATATCCACGCCCACAGTAACGGGCTGACCGGCGAAGACTGGAAACTGATCGCCAAAAGCGGCGGCCATGTGGCGAGCACGCCGTCCAGCGAGTTACAGATGGGGATGGGGTTCCTGCCTTATCAGCCTTGTGCGGAGTATGGGATCCCGTTTGCACTCGGAACGGATTTCACCGGTGTGACAACAGATGATCTGTTCACTCAGATGAATATGGCACTGCAGATTGAACGTGCACTGGCGAATGAAAAAGTACATCAGCGCGATACTATGCCGTTTGAAATTACCCCGACTGTCCGCGAGGCTCTGCACTGGGCGACCCTCGGCGCAGCACAGGTGCTGGGCATGGAAAACGAGATCGGCTCGCTGGTGGCCGGGAAAAAAGCGGACATCATTATTATCCGCCACAGAGATGGTTTTGTGGCACCGGTGCACGCCGCAGGCAGTGTGGTGCAGATGACACATACCGGTGATATCGATACTGTGCTGGCCGACGGTGTGATCCGCAAACAAAACGGCGTGCTGACCGGTTTTGATCTCCCGGAAGTGACCCGGTTATCCCGTAACGCTCTGGCTGAGCTGGAAACACGCATCCGTGACCGGAAAATCCTCAATACGCAGGAAGTGGAAGCGTTCTTCCGTCTGGCGGAGCGGATGGCCTCCTTCCATTTCGCACAGGCTTACAGTGATGAATTTTTTGCTCAGGCGATGAATAAGGCCTGATGTGCAGTGCGCTGCGGCGGGCAGCGGTCTCTCTTTGTGATCCCGCCTTT