Homologs in group_576

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_02110 EHELCC_02110 100.0 Morganella morganii S2 mutT CoA pyrophosphatase
NLDBIP_01350 NLDBIP_01350 100.0 Morganella morganii S4 mutT CoA pyrophosphatase
LHKJJB_00685 LHKJJB_00685 100.0 Morganella morganii S3 mutT CoA pyrophosphatase
HKOGLL_00725 HKOGLL_00725 100.0 Morganella morganii S5 mutT CoA pyrophosphatase
F4V73_RS03980 F4V73_RS03980 83.5 Morganella psychrotolerans - CoA pyrophosphatase
PMI_RS07840 PMI_RS07840 53.2 Proteus mirabilis HI4320 - CoA pyrophosphatase

Distribution of the homologs in the orthogroup group_576

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_576

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N3M0 6.36e-68 208 54 0 186 3 nudL Uncharacterized Nudix hydrolase NudL Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B5BHD1 8.17e-62 192 54 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella paratyphi A (strain AKU_12601)
Q5PNL9 8.17e-62 192 54 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TKF7 8.17e-62 192 54 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella heidelberg (strain SL476)
B5F3R6 8.17e-62 192 54 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella agona (strain SL483)
B5FTK8 1.24e-61 192 53 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella dublin (strain CT_02021853)
P0A2K9 1.7e-61 192 53 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2L0 1.7e-61 192 53 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella typhi
B4TXZ6 1.7e-61 192 53 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella schwarzengrund (strain CVM19633)
C0Q309 1.7e-61 192 53 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella paratyphi C (strain RKS4594)
A9MVU1 1.7e-61 192 53 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5R2U5 1.7e-61 192 53 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella enteritidis PT4 (strain P125109)
Q57NI6 1.7e-61 192 53 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella choleraesuis (strain SC-B67)
B4SUL8 2.46e-61 191 53 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Salmonella newport (strain SL254)
A1JMC0 4.05e-61 191 51 1 183 3 nudL Uncharacterized Nudix hydrolase NudL Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8AFP5 1.06e-60 190 52 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WBH1 6.36e-60 188 51 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Enterobacter sp. (strain 638)
A7MKE8 8e-60 187 52 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Cronobacter sakazakii (strain ATCC BAA-894)
B1JP41 8.11e-60 188 49 1 189 3 nudL Uncharacterized Nudix hydrolase NudL Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66BW8 8.11e-60 188 49 1 189 3 nudL Uncharacterized Nudix hydrolase NudL Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TKD0 8.11e-60 188 49 1 189 3 nudL Uncharacterized Nudix hydrolase NudL Yersinia pestis (strain Pestoides F)
Q1CH51 8.11e-60 188 49 1 189 3 nudL Uncharacterized Nudix hydrolase NudL Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5X2 8.11e-60 188 49 1 189 3 nudL Uncharacterized Nudix hydrolase NudL Yersinia pestis bv. Antiqua (strain Angola)
Q7CHW2 8.11e-60 188 49 1 189 3 nudL Uncharacterized Nudix hydrolase NudL Yersinia pestis
B2K0H0 8.11e-60 188 49 1 189 3 nudL Uncharacterized Nudix hydrolase NudL Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C8W1 8.11e-60 188 49 1 189 3 nudL Uncharacterized Nudix hydrolase NudL Yersinia pestis bv. Antiqua (strain Antiqua)
A7FJ95 8.11e-60 188 49 1 189 3 nudL Uncharacterized Nudix hydrolase NudL Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5XQ60 7.57e-58 182 52 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Klebsiella pneumoniae (strain 342)
A6TAY4 1.24e-57 182 52 1 182 3 nudL Uncharacterized Nudix hydrolase NudL Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q6D4L1 2.29e-54 174 48 1 184 3 nudL Uncharacterized Nudix hydrolase NudL Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7NSW2 7.13e-52 167 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LPN4 2.31e-51 166 52 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8FGU5 2.91e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3Z2F4 3.5e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Shigella sonnei (strain Ss046)
Q32FR6 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Shigella dysenteriae serotype 1 (strain Sd197)
B2U449 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RAX9 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli (strain UTI89 / UPEC)
B6IBP0 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli (strain SE11)
B7NBF9 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0TH20 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ABY1 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O1:K1 / APEC
A8A110 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O9:H4 (strain HS)
B7M287 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O8 (strain IAI1)
B7MVU2 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O81 (strain ED1a)
B5YQV4 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCQ2 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O157:H7
B7L6U1 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli (strain 55989 / EAEC)
B7MBL9 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O45:K1 (strain S88 / ExPEC)
B7USI8 3.61e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZMT6 4.07e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0T506 4.16e-51 166 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Shigella flexneri serotype 5b (strain 8401)
Q83L76 4.74e-51 165 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Shigella flexneri
Q321V9 5.59e-51 165 52 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Shigella boydii serotype 4 (strain Sb227)
B1LD60 1.52e-50 164 52 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli (strain SMS-3-5 / SECEC)
P43337 1.83e-50 164 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli (strain K12)
B1J0S5 1.83e-50 164 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XH80 1.83e-50 164 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli (strain K12 / DH10B)
C4ZZG9 1.83e-50 164 53 2 184 3 nudL Uncharacterized Nudix hydrolase NudL Escherichia coli (strain K12 / MC4100 / BW2952)
P43338 1.11e-35 124 57 1 114 3 nudL Uncharacterized Nudix hydrolase NudL (Fragment) Klebsiella aerogenes
Q8LET2 1.27e-27 106 38 6 173 1 NUDT11 Nudix hydrolase 11 Arabidopsis thaliana
Q9RV46 4.15e-25 99 41 4 165 1 DR_1184 Nudix hydrolase DR_1184 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q23236 1.7e-22 93 32 6 177 3 ndx-3 Nudix hydrolase 3 Caenorhabditis elegans
Q8GYB1 7.27e-21 90 35 6 173 1 NUDT15 Nudix hydrolase 15, mitochondrial Arabidopsis thaliana
P0C024 1.59e-19 85 41 1 112 1 NUDT7 Peroxisomal coenzyme A diphosphatase NUDT7 Homo sapiens
O22951 9.99e-19 84 34 4 170 2 NUDT22 Nudix hydrolase 22, chloroplastic Arabidopsis thaliana
Q99P30 3.94e-18 82 31 3 160 1 Nudt7 Peroxisomal coenzyme A diphosphatase NUDT7 Mus musculus
Q92350 3.86e-17 80 36 5 156 3 SPAC6G9.05 Probable nudix hydrolase C6G9.05 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8WV74 2.54e-16 77 35 4 158 1 NUDT8 Mitochondrial coenzyme A diphosphatase NUDT8 Homo sapiens
Q9CR24 2.59e-13 68 32 4 154 1 Nudt8 Mitochondrial coenzyme A diphosphatase NUDT8 Mus musculus
Q9NA25 9.8e-10 59 32 4 128 1 ndx-8 Peroxisomal coenzyme A diphosphatase ndx-8 Caenorhabditis elegans
Q12524 3.72e-07 52 27 6 194 1 PCD1 Peroxisomal coenzyme A diphosphatase 1, peroxisomal Saccharomyces cerevisiae (strain ATCC 204508 / S288c)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_01640
Feature type CDS
Gene mutT
Product CoA pyrophosphatase
Location 22068 - 22634 (strand: -1)
Length 567 (nucleotides) / 188 (amino acids)

Contig

Accession contig_2
Length 292399 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_576
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00293 NUDIX domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0494 Defense mechanisms (V) V 8-oxo-dGTP pyrophosphatase MutT and related house-cleaning NTP pyrophosphohydrolases, NUDIX family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K17879 peroxisomal coenzyme A diphosphatase NUDT7 [EC:3.6.1.-] Peroxisome -

Protein Sequence

MSPLERFIPRFQLTRPSEAEIAGERDRRAAVLLPITNKARPGILLTQRAVSLRSHPGQIALPGGAADPGEISPIATALREAREEVGIPPQAVQVLGQMAPVDSVTGFRVTPVVGIIPPYLPLAGNPQEVSDIFELPLDAALDLSRYRYIDMTRNTVERRLYFYLYEGRMIWGLTAGILYRLATQVKND

Flanking regions ( +/- flanking 50bp)

ACGTTCGATAAACTGGGCCGCATACTGACGGTACTGCCGGAGAAAATATTATGAGTCCGCTTGAGCGCTTTATTCCCCGGTTTCAGTTAACCCGCCCTTCCGAAGCAGAAATTGCCGGTGAGCGGGATCGCCGGGCCGCCGTTTTGCTGCCTATCACCAATAAAGCCCGGCCAGGGATCCTGCTGACACAACGGGCGGTATCGCTGCGCTCTCATCCGGGACAGATTGCCCTGCCCGGCGGCGCGGCAGATCCGGGCGAAATTTCCCCCATCGCCACCGCACTGCGCGAAGCGCGTGAGGAAGTCGGCATTCCGCCACAGGCCGTGCAGGTACTGGGACAAATGGCACCGGTGGACAGTGTGACCGGCTTCCGGGTCACCCCGGTGGTCGGGATTATTCCGCCATATCTGCCGCTGGCCGGTAACCCGCAGGAAGTGTCAGATATTTTTGAGCTGCCGCTGGATGCCGCCCTCGATCTGAGCCGCTACCGCTACATTGATATGACCCGCAATACTGTGGAGCGCCGCCTCTATTTTTACTTATATGAGGGACGGATGATTTGGGGGTTAACAGCGGGTATTTTATATCGCCTCGCAACGCAAGTGAAAAATGATTGATTTGTAACCGAATTCACACTTCTGCCCTATTTCCCCCTGCTTTTTTTCAT