Homologs in group_4112
0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product |
|---|
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|
| Source | Morganella psychrotolerans |
|---|---|
| Locus tag | F4V73_RS19465 |
| Feature type | CDS |
| Gene | - |
| Product | DUF3761 domain-containing protein |
| Location | 24123 - 24212 (strand: 1) |
| Length | 90 (nucleotides) / 29 (amino acids) |
| Accession | term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object |
|---|---|
| Length | 573139 nucleotides |
| Topology | linear |
| Plasmid | False |
| Orthogroup | group_4112 | |
|---|---|---|
| Orthogroup size | 1 | |
| N. genomes | 1 |
| PF12587 | Protein of unknown function (DUF3761) |
|---|
MKAVCRDGSYSTSTGRGTCSHHGGVDHYL
TTTCATTTAATTCGCTTGCGTATATTACAAACGACCCGGATGACCCTAATATAAAGGCAGTATGCAGAGACGGCTCTTATTCAACATCGACAGGGCGCGGTACCTGCTCTCATCATGGTGGTGTGGATCATTATTTATAAGAGAGAGAAGCCGGTAATCACCGGCTTTCTTTGTTAAATTACAACCCACC
