Homologs in group_2416

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19165 FBDBKF_19165 94.9 Morganella morganii S1 rplR 50S ribosomal protein L18
EHELCC_18910 EHELCC_18910 94.9 Morganella morganii S2 rplR 50S ribosomal protein L18
NLDBIP_18925 NLDBIP_18925 94.9 Morganella morganii S4 rplR 50S ribosomal protein L18
LHKJJB_18780 LHKJJB_18780 94.9 Morganella morganii S3 rplR 50S ribosomal protein L18
HKOGLL_18515 HKOGLL_18515 94.9 Morganella morganii S5 rplR 50S ribosomal protein L18
PMI_RS16230 PMI_RS16230 91.5 Proteus mirabilis HI4320 rplR 50S ribosomal protein L18

Distribution of the homologs in the orthogroup group_2416

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2416

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6CZY6 3.2e-64 193 92 0 117 3 rplR Large ribosomal subunit protein uL18 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DG58 1.03e-63 192 92 0 117 3 rplR Large ribosomal subunit protein uL18 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B1JIX7 3.1e-63 191 91 0 117 3 rplR Large ribosomal subunit protein uL18 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664T7 3.1e-63 191 91 0 117 3 rplR Large ribosomal subunit protein uL18 Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TH08 3.1e-63 191 91 0 117 3 rplR Large ribosomal subunit protein uL18 Yersinia pestis (strain Pestoides F)
Q1CCW0 3.1e-63 191 91 0 117 3 rplR Large ribosomal subunit protein uL18 Yersinia pestis bv. Antiqua (strain Nepal516)
A9R911 3.1e-63 191 91 0 117 3 rplR Large ribosomal subunit protein uL18 Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJ96 3.1e-63 191 91 0 117 3 rplR Large ribosomal subunit protein uL18 Yersinia pestis
B2K521 3.1e-63 191 91 0 117 3 rplR Large ribosomal subunit protein uL18 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C2W3 3.1e-63 191 91 0 117 3 rplR Large ribosomal subunit protein uL18 Yersinia pestis bv. Antiqua (strain Antiqua)
A7FNL8 3.1e-63 191 91 0 117 3 rplR Large ribosomal subunit protein uL18 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B4F1K0 5.13e-63 190 91 0 117 3 rplR Large ribosomal subunit protein uL18 Proteus mirabilis (strain HI4320)
Q2NQN8 3.43e-62 188 91 0 117 3 rplR Large ribosomal subunit protein uL18 Sodalis glossinidius (strain morsitans)
B5XNA9 9.22e-58 177 91 0 117 3 rplR Large ribosomal subunit protein uL18 Klebsiella pneumoniae (strain 342)
P0C021 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Shigella flexneri
Q0SZZ8 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Shigella flexneri serotype 5b (strain 8401)
Q32B47 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Shigella dysenteriae serotype 1 (strain Sd197)
Q31VX2 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Shigella boydii serotype 4 (strain Sb227)
B2U2S2 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A6TEV6 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7LRS0 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R626 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli (strain UTI89 / UPEC)
B1LHB8 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli (strain SMS-3-5 / SECEC)
B6I218 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli (strain SE11)
B7NDS5 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0C018 3.59e-57 175 90 0 117 1 rplR Large ribosomal subunit protein uL18 Escherichia coli (strain K12)
B1IPZ5 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0C019 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCF7 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGJ3 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O1:K1 / APEC
A8A5A9 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O9:H4 (strain HS)
B1X6F6 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli (strain K12 / DH10B)
C4ZUF9 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli (strain K12 / MC4100 / BW2952)
B7M1L8 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O8 (strain IAI1)
B7N0U4 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O81 (strain ED1a)
B7NLM3 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YTM5 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0C020 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O157:H7
B7LI05 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli (strain 55989 / EAEC)
B7MCR9 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UK28 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZSJ3 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Escherichia coli O139:H28 (strain E24377A / ETEC)
A8AQJ9 3.59e-57 175 90 0 117 3 rplR Large ribosomal subunit protein uL18 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A8GKI1 5.69e-57 175 88 0 117 3 rplR Large ribosomal subunit protein uL18 Serratia proteamaculans (strain 568)
Q65QX1 9.02e-57 174 80 0 117 3 rplR Large ribosomal subunit protein uL18 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7MYG7 9.74e-57 174 92 0 117 3 rplR Large ribosomal subunit protein uL18 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JS13 1.09e-56 174 90 0 117 3 rplR Large ribosomal subunit protein uL18 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q3YWV5 1.41e-56 174 90 0 117 3 rplR Large ribosomal subunit protein uL18 Shigella sonnei (strain Ss046)
Q7CPL6 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGP4 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella typhi
B4TXC6 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella schwarzengrund (strain CVM19633)
B5BGX0 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella paratyphi A (strain AKU_12601)
C0PZW7 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella paratyphi C (strain RKS4594)
A9MSY2 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIU9 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SUS4 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella newport (strain SL254)
B4TJZ3 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella heidelberg (strain SL476)
B5RH31 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1G1 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella enteritidis PT4 (strain P125109)
B5FJJ8 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella dublin (strain CT_02021853)
Q57J48 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella choleraesuis (strain SC-B67)
A9MN64 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F7S9 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Salmonella agona (strain SL483)
A7MPG6 1.53e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Cronobacter sakazakii (strain ATCC BAA-894)
B2VK80 1.56e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B8F6Q5 1.74e-56 174 81 0 117 3 rplR Large ribosomal subunit protein uL18 Glaesserella parasuis serovar 5 (strain SH0165)
A4WFB2 1.8e-56 174 89 0 117 3 rplR Large ribosomal subunit protein uL18 Enterobacter sp. (strain 638)
C5BGK9 4.38e-56 172 89 0 117 3 rplR Large ribosomal subunit protein uL18 Edwardsiella ictaluri (strain 93-146)
B0UX30 1.23e-55 171 79 0 117 3 rplR Large ribosomal subunit protein uL18 Histophilus somni (strain 2336)
Q0I146 1.23e-55 171 79 0 117 3 rplR Large ribosomal subunit protein uL18 Histophilus somni (strain 129Pt)
B0BSU7 1.43e-55 171 81 0 117 3 rplR Large ribosomal subunit protein uL18 Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZ27 1.43e-55 171 81 0 117 3 rplR Large ribosomal subunit protein uL18 Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N373 1.43e-55 171 81 0 117 3 rplR Large ribosomal subunit protein uL18 Actinobacillus pleuropneumoniae serotype 5b (strain L20)
P46182 3.92e-55 170 87 0 117 3 rplR Large ribosomal subunit protein uL18 Buchnera aphidicola subsp. Acyrthosiphon kondoi
A6VLK4 5.22e-55 170 78 0 117 3 rplR Large ribosomal subunit protein uL18 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7VKE9 9.96e-55 169 79 0 117 3 rplR Large ribosomal subunit protein uL18 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q1LTC2 4.11e-54 167 70 1 117 3 rplR Large ribosomal subunit protein uL18 Baumannia cicadellinicola subsp. Homalodisca coagulata
B6EPU1 1.11e-53 166 80 0 117 3 rplR Large ribosomal subunit protein uL18 Aliivibrio salmonicida (strain LFI1238)
P52863 3.29e-53 165 81 0 117 3 rplR Large ribosomal subunit protein uL18 Vibrio proteolyticus
Q605C8 2.08e-52 163 68 0 117 3 rplR Large ribosomal subunit protein uL18 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
C4K7A2 3.29e-52 163 74 0 117 3 rplR Large ribosomal subunit protein uL18 Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q5E898 6.21e-52 162 79 0 117 3 rplR Large ribosomal subunit protein uL18 Aliivibrio fischeri (strain ATCC 700601 / ES114)
A0KRP0 1.25e-51 161 75 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella sp. (strain ANA-3)
Q8EK53 1.33e-51 161 74 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1RED0 1.53e-51 161 74 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella sp. (strain W3-18-1)
Q0I089 1.53e-51 161 74 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella sp. (strain MR-7)
Q0HNS1 1.53e-51 161 74 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella sp. (strain MR-4)
A4YBW7 1.53e-51 161 74 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B5FG25 2.31e-51 160 78 0 117 3 rplR Large ribosomal subunit protein uL18 Aliivibrio fischeri (strain MJ11)
A8G1D2 3.4e-51 160 74 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella sediminis (strain HAW-EB3)
Q3J8T0 3.71e-51 160 63 0 117 3 rplR Large ribosomal subunit protein uL18 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A9KWB8 3.97e-51 160 74 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella baltica (strain OS195)
A6WHU4 3.97e-51 160 74 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella baltica (strain OS185)
A3DA56 3.97e-51 160 74 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EBI9 3.97e-51 160 74 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella baltica (strain OS223)
A1S234 1.76e-50 158 75 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q493J2 2.58e-50 158 65 0 117 3 rplR Large ribosomal subunit protein uL18 Blochmanniella pennsylvanica (strain BPEN)
Q15X57 7.72e-50 157 73 0 117 3 rplR Large ribosomal subunit protein uL18 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q9CL46 7.89e-50 157 78 0 117 3 rplR Large ribosomal subunit protein uL18 Pasteurella multocida (strain Pm70)
A3Q998 1.65e-49 156 74 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B8CNE9 2.47e-49 155 73 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella piezotolerans (strain WP3 / JCM 13877)
A0KF37 2.58e-49 155 79 0 117 3 rplR Large ribosomal subunit protein uL18 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A0Q4J9 2.61e-49 155 64 0 117 3 rplR Large ribosomal subunit protein uL18 Francisella tularensis subsp. novicida (strain U112)
P44356 2.91e-49 155 79 0 117 3 rplR Large ribosomal subunit protein uL18 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UHU7 2.91e-49 155 79 0 117 3 rplR Large ribosomal subunit protein uL18 Haemophilus influenzae (strain PittGG)
A5UDT1 2.91e-49 155 79 0 117 3 rplR Large ribosomal subunit protein uL18 Haemophilus influenzae (strain PittEE)
Q4QMA5 2.91e-49 155 79 0 117 3 rplR Large ribosomal subunit protein uL18 Haemophilus influenzae (strain 86-028NP)
A4IZR8 6.33e-49 154 63 0 117 3 rplR Large ribosomal subunit protein uL18 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NHV2 6.33e-49 154 63 0 117 3 rplR Large ribosomal subunit protein uL18 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0BNR1 6.33e-49 154 63 0 117 3 rplR Large ribosomal subunit protein uL18 Francisella tularensis subsp. holarctica (strain OSU18)
B2SDW9 6.33e-49 154 63 0 117 3 rplR Large ribosomal subunit protein uL18 Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A5F4 6.33e-49 154 63 0 117 3 rplR Large ribosomal subunit protein uL18 Francisella tularensis subsp. holarctica (strain LVS)
A7N9U1 6.33e-49 154 63 0 117 3 rplR Large ribosomal subunit protein uL18 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q14JA4 6.33e-49 154 63 0 117 3 rplR Large ribosomal subunit protein uL18 Francisella tularensis subsp. tularensis (strain FSC 198)
A4SSZ0 8.8e-49 154 79 0 117 3 rplR Large ribosomal subunit protein uL18 Aeromonas salmonicida (strain A449)
B1KMW7 1.01e-48 154 70 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella woodyi (strain ATCC 51908 / MS32)
B0U0X3 1.36e-48 154 62 0 117 3 rplR Large ribosomal subunit protein uL18 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B8GV42 3.35e-48 152 67 0 117 3 rplR Large ribosomal subunit protein uL18 Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
C4L7U6 3.78e-48 152 80 0 117 3 rplR Large ribosomal subunit protein uL18 Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q488Z7 4.17e-48 152 69 0 117 3 rplR Large ribosomal subunit protein uL18 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8D833 5.55e-48 152 62 0 116 3 rplR Large ribosomal subunit protein uL18 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57575 5.55e-48 152 62 0 116 3 rplR Large ribosomal subunit protein uL18 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9T1 5.55e-48 152 62 0 116 3 rplR Large ribosomal subunit protein uL18 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
C3LRP2 6.32e-48 152 82 0 117 3 rplR Large ribosomal subunit protein uL18 Vibrio cholerae serotype O1 (strain M66-2)
Q9KP00 6.32e-48 152 82 0 117 3 rplR Large ribosomal subunit protein uL18 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F564 6.32e-48 152 82 0 117 3 rplR Large ribosomal subunit protein uL18 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A1T0C6 8.7e-48 151 68 1 117 3 rplR Large ribosomal subunit protein uL18 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q87SZ7 1.95e-47 150 81 0 117 3 rplR Large ribosomal subunit protein uL18 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MWH4 1.95e-47 150 81 0 117 3 rplR Large ribosomal subunit protein uL18 Vibrio campbellii (strain ATCC BAA-1116)
Q0VSI7 2.28e-47 150 65 1 116 3 rplR Large ribosomal subunit protein uL18 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q7MPH2 6.82e-47 149 80 0 117 3 rplR Large ribosomal subunit protein uL18 Vibrio vulnificus (strain YJ016)
Q8DE56 6.82e-47 149 80 0 117 3 rplR Large ribosomal subunit protein uL18 Vibrio vulnificus (strain CMCP6)
B7VLE1 9.26e-47 149 79 0 117 3 rplR Large ribosomal subunit protein uL18 Vibrio atlanticus (strain LGP32)
A1WVA6 1.22e-46 149 62 0 117 3 rplR Large ribosomal subunit protein uL18 Halorhodospira halophila (strain DSM 244 / SL1)
A5WCK6 1.3e-46 149 63 1 117 3 rplR Large ribosomal subunit protein uL18 Psychrobacter sp. (strain PRwf-1)
Q5QXW1 1.97e-46 148 77 0 117 3 rplR Large ribosomal subunit protein uL18 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
C5BQ77 2.28e-46 148 63 1 115 3 rplR Large ribosomal subunit protein uL18 Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q3IJK1 2.02e-45 145 70 1 117 3 rplR Large ribosomal subunit protein uL18 Pseudoalteromonas translucida (strain TAC 125)
Q1QDH0 6.03e-45 144 60 1 117 3 rplR Large ribosomal subunit protein uL18 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FUE0 6.03e-45 144 60 1 117 3 rplR Large ribosomal subunit protein uL18 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q8D1Z6 2.73e-44 143 57 0 117 3 rplR Large ribosomal subunit protein uL18 Wigglesworthia glossinidia brevipalpis
Q0ABF9 1.72e-43 140 66 0 117 3 rplR Large ribosomal subunit protein uL18 Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q2S928 3.01e-43 140 60 1 116 3 rplR Large ribosomal subunit protein uL18 Hahella chejuensis (strain KCTC 2396)
A1TYL3 3.05e-43 140 60 1 117 3 rplR Large ribosomal subunit protein uL18 Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q31IW6 9.17e-43 139 58 0 117 3 rplR Large ribosomal subunit protein uL18 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q8K965 2.13e-42 138 61 1 112 3 rplR Large ribosomal subunit protein uL18 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A1KB11 3.06e-42 137 62 0 117 3 rplR Large ribosomal subunit protein uL18 Azoarcus sp. (strain BH72)
Q12SU3 5.3e-42 137 72 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q089N8 6.53e-42 137 72 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella frigidimarina (strain NCIMB 400)
Q1R0F9 1.85e-41 135 64 1 101 3 rplR Large ribosomal subunit protein uL18 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q6F7S8 3.45e-41 135 57 1 116 3 rplR Large ribosomal subunit protein uL18 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q47J87 4.04e-41 135 56 0 117 3 rplR Large ribosomal subunit protein uL18 Dechloromonas aromatica (strain RCB)
B0V6W1 5.11e-41 134 57 1 116 3 rplR Large ribosomal subunit protein uL18 Acinetobacter baumannii (strain AYE)
A3M968 5.11e-41 134 57 1 116 3 rplR Large ribosomal subunit protein uL18 Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B7IA23 5.11e-41 134 57 1 116 1 rplR Large ribosomal subunit protein uL18 Acinetobacter baumannii (strain AB0057)
B7GW18 5.11e-41 134 57 1 116 3 rplR Large ribosomal subunit protein uL18 Acinetobacter baumannii (strain AB307-0294)
Q6LVA0 5.21e-41 134 79 0 117 3 rplR Large ribosomal subunit protein uL18 Photobacterium profundum (strain SS9)
Q7VQD2 1.04e-40 134 58 0 117 3 rplR Large ribosomal subunit protein uL18 Blochmanniella floridana
B0VQT4 2.19e-40 133 56 1 116 3 rplR Large ribosomal subunit protein uL18 Acinetobacter baumannii (strain SDF)
Q21M42 2.59e-40 132 63 1 101 3 rplR Large ribosomal subunit protein uL18 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A8GYZ2 6.07e-40 132 70 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TLZ6 6.07e-40 132 70 1 117 3 rplR Large ribosomal subunit protein uL18 Shewanella halifaxensis (strain HAW-EB4)
Q5P316 6.61e-40 132 58 0 117 3 rplR Large ribosomal subunit protein uL18 Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q89A81 7.14e-40 132 63 0 101 3 rplR Large ribosomal subunit protein uL18 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B3PK53 8.16e-40 131 62 1 101 3 rplR Large ribosomal subunit protein uL18 Cellvibrio japonicus (strain Ueda107)
A6W376 1.06e-39 131 66 1 98 3 rplR Large ribosomal subunit protein uL18 Marinomonas sp. (strain MWYL1)
Q83ER0 1.83e-39 130 59 0 117 3 rplR Large ribosomal subunit protein uL18 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAY6 1.83e-39 130 59 0 117 3 rplR Large ribosomal subunit protein uL18 Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KD15 1.83e-39 130 59 0 117 3 rplR Large ribosomal subunit protein uL18 Coxiella burnetii (strain Dugway 5J108-111)
B6J247 1.83e-39 130 59 0 117 3 rplR Large ribosomal subunit protein uL18 Coxiella burnetii (strain CbuG_Q212)
B6J5E8 1.83e-39 130 59 0 117 3 rplR Large ribosomal subunit protein uL18 Coxiella burnetii (strain CbuK_Q154)
Q5GWV0 1.96e-39 130 53 0 117 3 rplR Large ribosomal subunit protein uL18 Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P001 1.96e-39 130 53 0 117 3 rplR Large ribosomal subunit protein uL18 Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PC36 3.01e-39 130 53 0 117 3 rplR Large ribosomal subunit protein uL18 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RU66 3.01e-39 130 53 0 117 3 rplR Large ribosomal subunit protein uL18 Xanthomonas campestris pv. campestris (strain B100)
Q4URF5 3.01e-39 130 53 0 117 3 rplR Large ribosomal subunit protein uL18 Xanthomonas campestris pv. campestris (strain 8004)
B2SQS6 5.74e-39 129 52 0 117 3 rplR Large ribosomal subunit protein uL18 Xanthomonas oryzae pv. oryzae (strain PXO99A)
B2T735 7.93e-39 129 56 1 121 3 rplR Large ribosomal subunit protein uL18 Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q3BWW7 1.64e-38 128 53 0 117 3 rplR Large ribosomal subunit protein uL18 Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PNR1 1.64e-38 128 53 0 117 3 rplR Large ribosomal subunit protein uL18 Xanthomonas axonopodis pv. citri (strain 306)
C1DKM9 1.67e-38 128 56 1 115 3 rplR Large ribosomal subunit protein uL18 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q13TI6 4.42e-38 127 56 1 121 3 rplR Large ribosomal subunit protein uL18 Paraburkholderia xenovorans (strain LB400)
B2JI49 1.06e-37 126 56 1 121 3 rplR Large ribosomal subunit protein uL18 Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q1H4M1 1.41e-37 125 55 0 117 3 rplR Large ribosomal subunit protein uL18 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4XZ74 1.92e-37 125 60 1 116 3 rplR Large ribosomal subunit protein uL18 Pseudomonas mendocina (strain ymp)
A9IHT2 2.6e-37 125 55 1 121 3 rplR Large ribosomal subunit protein uL18 Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A4JAQ6 4.07e-37 125 54 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q1BRW4 4.07e-37 125 54 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia orbicola (strain AU 1054)
B1JU38 4.07e-37 125 54 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia orbicola (strain MC0-3)
Q39KF1 4.07e-37 125 54 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BJ30 4.07e-37 125 54 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B4E5D6 4.07e-37 125 54 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K3P1 4.07e-37 125 54 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia cenocepacia (strain HI2424)
B1YRP5 4.07e-37 125 54 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia ambifaria (strain MC40-6)
Q2SU43 5.96e-37 124 55 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63Q27 5.96e-37 124 55 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia pseudomallei (strain K96243)
A3NEG3 5.96e-37 124 55 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia pseudomallei (strain 668)
Q3JMS9 5.96e-37 124 55 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia pseudomallei (strain 1710b)
A3P097 5.96e-37 124 55 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia pseudomallei (strain 1106a)
A1V887 5.96e-37 124 55 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia mallei (strain SAVP1)
Q62GM1 5.96e-37 124 55 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia mallei (strain ATCC 23344)
A2S7J2 5.96e-37 124 55 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia mallei (strain NCTC 10229)
A3MRX0 5.96e-37 124 55 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia mallei (strain NCTC 10247)
Q4ZMR0 1.19e-36 123 59 1 100 3 rplR Large ribosomal subunit protein uL18 Pseudomonas syringae pv. syringae (strain B728a)
Q889V5 1.19e-36 123 59 1 100 3 rplR Large ribosomal subunit protein uL18 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48D52 1.19e-36 123 59 1 100 3 rplR Large ribosomal subunit protein uL18 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8XV28 1.41e-36 123 55 1 118 3 rplR Large ribosomal subunit protein uL18 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2UEK3 1.48e-36 123 55 1 118 3 rplR Large ribosomal subunit protein uL18 Ralstonia pickettii (strain 12J)
Q1IFV0 1.71e-36 123 59 1 116 3 rplR Large ribosomal subunit protein uL18 Pseudomonas entomophila (strain L48)
A9ADK9 1.86e-36 123 54 1 121 3 rplR Large ribosomal subunit protein uL18 Burkholderia multivorans (strain ATCC 17616 / 249)
A1AVL6 2.33e-36 122 53 1 117 3 rplR Large ribosomal subunit protein uL18 Ruthia magnifica subsp. Calyptogena magnifica
A1KRI9 4.09e-36 122 53 0 117 3 rplR Large ribosomal subunit protein uL18 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q7DDT0 4.09e-36 122 53 0 117 3 rplR Large ribosomal subunit protein uL18 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JQQ6 4.09e-36 122 53 0 117 3 rplR Large ribosomal subunit protein uL18 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M3V0 4.09e-36 122 53 0 117 3 rplR Large ribosomal subunit protein uL18 Neisseria meningitidis serogroup C (strain 053442)
Q5F5U3 4.09e-36 122 53 0 117 3 rplR Large ribosomal subunit protein uL18 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q7VTB5 4.19e-36 122 55 1 120 3 rplR Large ribosomal subunit protein uL18 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W2D9 4.19e-36 122 55 1 120 3 rplR Large ribosomal subunit protein uL18 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WRA7 4.19e-36 122 55 1 120 3 rplR Large ribosomal subunit protein uL18 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
C1DAT3 7.07e-36 121 56 0 117 3 rplR Large ribosomal subunit protein uL18 Laribacter hongkongensis (strain HLHK9)
B1JAJ6 8.09e-36 121 58 1 116 3 rplR Large ribosomal subunit protein uL18 Pseudomonas putida (strain W619)
Q88QL9 1.32e-35 120 58 1 116 3 rplR Large ribosomal subunit protein uL18 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KK83 1.32e-35 120 58 1 116 3 rplR Large ribosomal subunit protein uL18 Pseudomonas putida (strain GB-1)
A5VXR3 1.32e-35 120 58 1 116 3 rplR Large ribosomal subunit protein uL18 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9HWF1 1.88e-35 120 59 1 100 1 rplR Large ribosomal subunit protein uL18 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02T64 1.88e-35 120 59 1 100 3 rplR Large ribosomal subunit protein uL18 Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V660 1.88e-35 120 59 1 100 3 rplR Large ribosomal subunit protein uL18 Pseudomonas aeruginosa (strain LESB58)
A6UZK4 1.88e-35 120 59 1 100 3 rplR Large ribosomal subunit protein uL18 Pseudomonas aeruginosa (strain PA7)
A6T3I8 3.9e-35 120 52 2 121 3 rplR Large ribosomal subunit protein uL18 Janthinobacterium sp. (strain Marseille)
A7HM36 3.96e-35 120 55 2 119 3 rplR Large ribosomal subunit protein uL18 Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q87E66 4.71e-35 119 50 0 117 3 rplR Large ribosomal subunit protein uL18 Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I8I5 4.71e-35 119 50 0 117 3 rplR Large ribosomal subunit protein uL18 Xylella fastidiosa (strain M23)
C3K2W0 6.46e-35 119 56 1 116 3 rplR Large ribosomal subunit protein uL18 Pseudomonas fluorescens (strain SBW25)
Q1LI53 9.38e-35 119 52 1 118 3 rplR Large ribosomal subunit protein uL18 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A4SUX7 9.44e-35 119 50 0 117 3 rplR Large ribosomal subunit protein uL18 Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B0U5L5 1.06e-34 119 49 0 117 3 rplR Large ribosomal subunit protein uL18 Xylella fastidiosa (strain M12)
Q9PE60 1.06e-34 119 49 0 117 3 rplR Large ribosomal subunit protein uL18 Xylella fastidiosa (strain 9a5c)
Q2L268 1.54e-34 118 52 1 121 3 rplR Large ribosomal subunit protein uL18 Bordetella avium (strain 197N)
A6TWG6 1.97e-34 118 61 0 93 3 rplR Large ribosomal subunit protein uL18 Alkaliphilus metalliredigens (strain QYMF)
Q3K604 2.06e-34 118 56 1 116 3 rplR Large ribosomal subunit protein uL18 Pseudomonas fluorescens (strain Pf0-1)
Q4K549 2.06e-34 118 56 1 116 3 rplR Large ribosomal subunit protein uL18 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A5CXM0 5.23e-34 117 52 1 115 3 rplR Large ribosomal subunit protein uL18 Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q2YAY1 5.59e-34 117 53 0 112 3 rplR Large ribosomal subunit protein uL18 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
C5CGI6 8.27e-34 116 50 1 117 3 rplR Large ribosomal subunit protein uL18 Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
Q18CH4 1.09e-33 116 52 1 117 3 rplR Large ribosomal subunit protein uL18 Clostridioides difficile (strain 630)
A6LLM9 1.16e-33 116 58 0 93 3 rplR Large ribosomal subunit protein uL18 Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B7IHW2 1.19e-33 116 58 0 93 3 rplR Large ribosomal subunit protein uL18 Thermosipho africanus (strain TCF52B)
A8IAP8 1.47e-33 115 52 1 117 3 rplR Large ribosomal subunit protein uL18 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A9BG02 1.63e-33 115 49 1 118 3 rplR Large ribosomal subunit protein uL18 Petrotoga mobilis (strain DSM 10674 / SJ95)
A4IJK4 1.85e-33 115 54 3 120 3 rplR Large ribosomal subunit protein uL18 Geobacillus thermodenitrificans (strain NG80-2)
B8E1E9 2.12e-33 115 61 0 93 3 rplR Large ribosomal subunit protein uL18 Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q110C2 2.38e-33 115 54 2 118 3 rplR Large ribosomal subunit protein uL18 Trichodesmium erythraeum (strain IMS101)
A8F4S7 2.75e-33 115 50 2 119 3 rplR Large ribosomal subunit protein uL18 Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q7NQG8 2.8e-33 115 53 0 117 3 rplR Large ribosomal subunit protein uL18 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P09415 3.48e-33 115 53 3 120 1 rplR Large ribosomal subunit protein uL18 Geobacillus stearothermophilus
B1XJJ2 4.1e-33 114 63 0 93 3 rplR Large ribosomal subunit protein uL18 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B5YDV9 4.3e-33 114 54 2 111 3 rplR Large ribosomal subunit protein uL18 Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A0PXW2 5.7e-33 114 53 2 117 3 rplR Large ribosomal subunit protein uL18 Clostridium novyi (strain NT)
B3QBW4 6.02e-33 114 54 1 111 3 rplR Large ribosomal subunit protein uL18 Rhodopseudomonas palustris (strain TIE-1)
Q6N4U9 6.02e-33 114 54 1 111 1 rplR Large ribosomal subunit protein uL18 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q39XZ0 6.99e-33 114 53 3 118 3 rplR Large ribosomal subunit protein uL18 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
C5D3T3 7.49e-33 114 52 3 120 3 rplR Large ribosomal subunit protein uL18 Geobacillus sp. (strain WCH70)
Q749A3 8.29e-33 114 52 2 118 3 rplR Large ribosomal subunit protein uL18 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q5L3S3 9.21e-33 114 52 3 120 3 rplR Large ribosomal subunit protein uL18 Geobacillus kaustophilus (strain HTA426)
Q211G4 9.42e-33 114 54 1 111 3 rplR Large ribosomal subunit protein uL18 Rhodopseudomonas palustris (strain BisB18)
B6IRS2 1.01e-32 114 54 1 111 3 rplR Large ribosomal subunit protein uL18 Rhodospirillum centenum (strain ATCC 51521 / SW)
A7IPQ4 1.03e-32 114 51 1 117 3 rplR Large ribosomal subunit protein uL18 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q11HR8 1.08e-32 114 52 1 119 3 rplR Large ribosomal subunit protein uL18 Chelativorans sp. (strain BNC1)
Q12G87 1.19e-32 113 50 1 120 3 rplR Large ribosomal subunit protein uL18 Polaromonas sp. (strain JS666 / ATCC BAA-500)
B1XSR7 1.29e-32 113 48 0 117 3 rplR Large ribosomal subunit protein uL18 Polynucleobacter necessarius subsp. necessarius (strain STIR1)
B2ITP0 1.41e-32 113 52 2 120 3 rplR Large ribosomal subunit protein uL18 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B1Y8C1 1.47e-32 113 54 3 122 3 rplR Large ribosomal subunit protein uL18 Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
P46899 1.79e-32 113 54 2 116 1 rplR Large ribosomal subunit protein uL18 Bacillus subtilis (strain 168)
A5EXA2 2.51e-32 112 53 0 115 3 rplR Large ribosomal subunit protein uL18 Dichelobacter nodosus (strain VCS1703A)
C0Q9V7 2.53e-32 112 52 1 113 3 rplR Large ribosomal subunit protein uL18 Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q2IXP4 3.57e-32 112 54 1 111 3 rplR Large ribosomal subunit protein uL18 Rhodopseudomonas palustris (strain HaA2)
B6JEY1 4.74e-32 112 58 0 96 3 rplR Large ribosomal subunit protein uL18 Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A1VJ31 5.33e-32 112 50 1 120 3 rplR Large ribosomal subunit protein uL18 Polaromonas naphthalenivorans (strain CJ2)
C6E4P1 6.39e-32 112 53 1 116 3 rplR Large ribosomal subunit protein uL18 Geobacter sp. (strain M21)
Q7NEG8 6.73e-32 111 55 1 118 3 rplR Large ribosomal subunit protein uL18 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q3A6N1 7.61e-32 111 50 1 118 3 rplR Large ribosomal subunit protein uL18 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q37M27 7.75e-32 111 54 1 111 3 rplR Large ribosomal subunit protein uL18 Rhodopseudomonas palustris (strain BisB5)
A1TJT3 9.2e-32 111 50 1 120 3 rplR Large ribosomal subunit protein uL18 Paracidovorax citrulli (strain AAC00-1)
Q820Q8 1.01e-31 111 45 0 117 3 rplR Large ribosomal subunit protein uL18 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A4XLR4 1.38e-31 111 50 2 120 3 rplR Large ribosomal subunit protein uL18 Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A7GK36 1.45e-31 110 53 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A8MLF6 1.84e-31 110 50 1 118 3 rplR Large ribosomal subunit protein uL18 Alkaliphilus oremlandii (strain OhILAs)
A4G9S2 1.9e-31 110 53 2 121 3 rplR Large ribosomal subunit protein uL18 Herminiimonas arsenicoxydans
B5ZYV1 1.94e-31 110 52 1 117 3 rplR Large ribosomal subunit protein uL18 Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q89JA0 1.94e-31 110 52 0 112 3 rplR Large ribosomal subunit protein uL18 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q3SSV0 2.39e-31 110 53 1 111 3 rplR Large ribosomal subunit protein uL18 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A9BRW7 2.41e-31 110 49 1 120 3 rplR Large ribosomal subunit protein uL18 Delftia acidovorans (strain DSM 14801 / SPH-1)
B1LBM4 2.59e-31 110 56 0 93 3 rplR Large ribosomal subunit protein uL18 Thermotoga sp. (strain RQ2)
A5IM99 2.59e-31 110 56 0 93 3 rplR Large ribosomal subunit protein uL18 Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9ZAE3 2.59e-31 110 56 0 93 3 rplR Large ribosomal subunit protein uL18 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1MIC5 6.04e-31 109 51 1 117 3 rplR Large ribosomal subunit protein uL18 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q21QN9 7.01e-31 109 50 1 120 3 rplR Large ribosomal subunit protein uL18 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A7Z0Q4 7.04e-31 109 53 2 116 3 rplR Large ribosomal subunit protein uL18 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B9K8A2 8.6e-31 108 55 0 93 3 rplR Large ribosomal subunit protein uL18 Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q0SQG0 8.7e-31 108 53 4 119 3 rplR Large ribosomal subunit protein uL18 Clostridium perfringens (strain SM101 / Type A)
Q8XHT9 8.7e-31 108 53 4 119 3 rplR Large ribosomal subunit protein uL18 Clostridium perfringens (strain 13 / Type A)
Q0TMR2 8.7e-31 108 53 4 119 3 rplR Large ribosomal subunit protein uL18 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q3A9T2 1.5e-30 108 51 1 117 3 rplR Large ribosomal subunit protein uL18 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B0T2D8 1.56e-30 108 54 2 112 3 rplR Large ribosomal subunit protein uL18 Caulobacter sp. (strain K31)
B7IT35 1.63e-30 108 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus cereus (strain G9842)
B8G6Q9 1.71e-30 108 55 2 112 3 rplR Large ribosomal subunit protein uL18 Chloroflexus aggregans (strain MD-66 / DSM 9485)
C4KZN0 1.94e-30 108 52 2 117 3 rplR Large ribosomal subunit protein uL18 Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A2SLE1 2.14e-30 108 51 3 122 3 rplR Large ribosomal subunit protein uL18 Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A9KJH8 2.25e-30 107 48 1 118 3 rplR Large ribosomal subunit protein uL18 Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q2W2K7 2.82e-30 107 54 1 111 3 rplR Large ribosomal subunit protein uL18 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A1W324 2.84e-30 107 50 1 120 3 rplR Large ribosomal subunit protein uL18 Acidovorax sp. (strain JS42)
B9MBV3 2.84e-30 107 50 1 120 3 rplR Large ribosomal subunit protein uL18 Acidovorax ebreus (strain TPSY)
B2IK78 2.98e-30 107 50 1 116 3 rplR Large ribosomal subunit protein uL18 Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A5GIT0 2.98e-30 107 58 1 94 3 rplR Large ribosomal subunit protein uL18 Synechococcus sp. (strain WH7803)
Q65P91 3.47e-30 107 54 2 116 3 rplR Large ribosomal subunit protein uL18 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B1Z777 3.54e-30 107 50 1 118 3 rplR Large ribosomal subunit protein uL18 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A3DJI8 3.55e-30 107 52 2 115 3 rplR Large ribosomal subunit protein uL18 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q6HPP2 3.66e-30 107 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63H74 3.66e-30 107 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus cereus (strain ZK / E33L)
Q81J26 3.66e-30 107 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B9IZL0 3.66e-30 107 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus cereus (strain Q1)
B7HQW0 3.66e-30 107 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus cereus (strain AH187)
B7HJ64 3.66e-30 107 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus cereus (strain B4264)
C1ET55 3.66e-30 107 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus cereus (strain 03BB102)
Q73F80 3.66e-30 107 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81VR4 3.66e-30 107 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus anthracis
C3LJ98 3.66e-30 107 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9S1 3.66e-30 107 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus anthracis (strain A0248)
Q3SLN3 3.83e-30 107 49 0 117 3 rplR Large ribosomal subunit protein uL18 Thiobacillus denitrificans (strain ATCC 25259)
A9H3L5 4.22e-30 107 54 0 96 3 rplR Large ribosomal subunit protein uL18 Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A9VP93 4.71e-30 107 52 2 116 3 rplR Large ribosomal subunit protein uL18 Bacillus mycoides (strain KBAB4)
Q2JIL2 4.77e-30 107 60 1 95 3 rplR Large ribosomal subunit protein uL18 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q2RQX6 5.03e-30 107 52 1 111 3 rplR Large ribosomal subunit protein uL18 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q1QN14 5.48e-30 107 50 1 116 3 rplR Large ribosomal subunit protein uL18 Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q92QF4 6.46e-30 106 47 1 117 3 rplR Large ribosomal subunit protein uL18 Rhizobium meliloti (strain 1021)
A5ELL1 8.39e-30 106 51 3 120 3 rplR Large ribosomal subunit protein uL18 Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A2CC43 8.6e-30 106 58 1 94 3 rplR Large ribosomal subunit protein uL18 Prochlorococcus marinus (strain MIT 9303)
Q7V530 9.49e-30 106 58 1 94 3 rplR Large ribosomal subunit protein uL18 Prochlorococcus marinus (strain MIT 9313)
B2UYC6 1.03e-29 106 50 3 120 3 rplR Large ribosomal subunit protein uL18 Clostridium botulinum (strain Alaska E43 / Type E3)
B7K233 1.07e-29 106 50 1 118 3 rplR Large ribosomal subunit protein uL18 Rippkaea orientalis (strain PCC 8801 / RF-1)
B8I7Z5 1.07e-29 106 48 1 112 3 rplR Large ribosomal subunit protein uL18 Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A7GJ58 1.29e-29 105 50 4 120 3 rplR Large ribosomal subunit protein uL18 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q2RFR3 1.59e-29 105 53 3 119 3 rplR Large ribosomal subunit protein uL18 Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B9JDU4 1.69e-29 105 48 1 117 3 rplR Large ribosomal subunit protein uL18 Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B2TIJ1 1.8e-29 105 49 3 120 3 rplR Large ribosomal subunit protein uL18 Clostridium botulinum (strain Eklund 17B / Type B)
B9LJE8 1.86e-29 105 55 3 114 3 rplR Large ribosomal subunit protein uL18 Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WH82 1.86e-29 105 55 3 114 3 rplR Large ribosomal subunit protein uL18 Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q07KN4 1.95e-29 105 51 1 111 3 rplR Large ribosomal subunit protein uL18 Rhodopseudomonas palustris (strain BisA53)
Q0BUN4 2.09e-29 105 56 0 96 3 rplR Large ribosomal subunit protein uL18 Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q8SAY0 2.11e-29 107 49 3 119 2 RPL18 Large ribosomal subunit protein uL18c Oryza sativa subsp. japonica
A5GAV8 2.51e-29 105 50 1 116 3 rplR Large ribosomal subunit protein uL18 Geotalea uraniireducens (strain Rf4)
B7JKD5 2.58e-29 105 52 2 117 3 rplR Large ribosomal subunit protein uL18 Bacillus cereus (strain AH820)
A9BCN2 2.62e-29 105 49 2 119 3 rplR Large ribosomal subunit protein uL18 Prochlorococcus marinus (strain MIT 9211)
A6U875 3.04e-29 105 46 1 117 3 rplR Large ribosomal subunit protein uL18 Sinorhizobium medicae (strain WSM419)
C4ZBT4 3.29e-29 105 49 1 112 3 rplR Large ribosomal subunit protein uL18 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
B7KI02 3.7e-29 104 53 1 110 3 rplR Large ribosomal subunit protein uL18 Gloeothece citriformis (strain PCC 7424)
Q3MFA6 4e-29 104 49 2 120 3 rplR Large ribosomal subunit protein uL18 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
C1F626 4.31e-29 104 48 3 120 3 rplR Large ribosomal subunit protein uL18 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
A4YSK8 4.36e-29 104 50 1 116 3 rplR Large ribosomal subunit protein uL18 Bradyrhizobium sp. (strain ORS 278)
Q5WZJ6 4.48e-29 104 43 1 119 3 rplR Large ribosomal subunit protein uL18 Legionella pneumophila (strain Lens)
Q5ZYM7 4.48e-29 104 43 1 119 3 rplR Large ribosomal subunit protein uL18 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IHP8 4.48e-29 104 43 1 119 3 rplR Large ribosomal subunit protein uL18 Legionella pneumophila (strain Corby)
Q5X843 4.48e-29 104 43 1 119 3 rplR Large ribosomal subunit protein uL18 Legionella pneumophila (strain Paris)
A8F9A1 4.51e-29 104 50 2 116 3 rplR Large ribosomal subunit protein uL18 Bacillus pumilus (strain SAFR-032)
C1FMT5 4.78e-29 104 50 4 119 3 rplR Large ribosomal subunit protein uL18 Clostridium botulinum (strain Kyoto / Type A2)
A5I7J0 4.78e-29 104 50 4 119 3 rplR Large ribosomal subunit protein uL18 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZ53 4.78e-29 104 50 4 119 3 rplR Large ribosomal subunit protein uL18 Clostridium botulinum (strain ATCC 19397 / Type A)
B9KZX2 5.33e-29 104 52 3 117 3 rplR Large ribosomal subunit protein uL18 Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
B0UHV3 5.37e-29 104 54 0 96 3 rplR Large ribosomal subunit protein uL18 Methylobacterium sp. (strain 4-46)
Q0ID20 5.94e-29 104 55 1 94 3 rplR Large ribosomal subunit protein uL18 Synechococcus sp. (strain CC9311)
C0ZIJ6 6.19e-29 104 51 3 119 3 rplR Large ribosomal subunit protein uL18 Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q97EJ4 6.2e-29 104 50 2 118 3 rplR Large ribosomal subunit protein uL18 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A6LPS7 6.28e-29 104 50 3 120 3 rplR Large ribosomal subunit protein uL18 Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B1KSK9 6.42e-29 104 51 4 119 3 rplR Large ribosomal subunit protein uL18 Clostridium botulinum (strain Loch Maree / Type A3)
A5GVX5 6.75e-29 104 55 0 93 3 rplR Large ribosomal subunit protein uL18 Synechococcus sp. (strain RCC307)
O24704 7.13e-29 103 58 0 93 3 rplR Large ribosomal subunit protein uL18 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31L22 7.13e-29 103 58 0 93 3 rplR Large ribosomal subunit protein uL18 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B4R8N3 8.38e-29 103 53 2 111 3 rplR Large ribosomal subunit protein uL18 Phenylobacterium zucineum (strain HLK1)
Q8YPJ4 8.68e-29 103 49 2 120 3 rplR Large ribosomal subunit protein uL18 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B3R7F2 1e-28 103 50 1 118 3 rplR Large ribosomal subunit protein uL18 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B3PWT7 1.15e-28 103 49 1 117 3 rplR Large ribosomal subunit protein uL18 Rhizobium etli (strain CIAT 652)
Q01WA8 1.18e-28 103 59 1 93 3 rplR Large ribosomal subunit protein uL18 Solibacter usitatus (strain Ellin6076)
C3KVN5 1.26e-28 103 50 4 119 3 rplR Large ribosomal subunit protein uL18 Clostridium botulinum (strain 657 / Type Ba4)
Q2K9K0 1.29e-28 103 49 1 117 3 rplR Large ribosomal subunit protein uL18 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B0JHY8 1.36e-28 103 55 0 93 3 rplR Large ribosomal subunit protein uL18 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B9JVQ3 1.42e-28 103 48 1 117 3 rplR Large ribosomal subunit protein uL18 Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
B0RZS5 1.43e-28 103 47 2 118 3 rplR Large ribosomal subunit protein uL18 Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q46WG0 1.45e-28 103 50 1 118 3 rplR Large ribosomal subunit protein uL18 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0K635 1.49e-28 103 50 1 118 3 rplR Large ribosomal subunit protein uL18 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B1WQS6 1.62e-28 103 55 0 95 3 rplR Large ribosomal subunit protein uL18 Crocosphaera subtropica (strain ATCC 51142 / BH68)
P82195 1.66e-28 104 49 2 114 1 RPL18 Large ribosomal subunit protein uL18c Spinacia oleracea
A5V5Y6 1.74e-28 103 56 1 93 3 rplR Large ribosomal subunit protein uL18 Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q7U4I5 1.79e-28 103 54 1 94 3 rplR Large ribosomal subunit protein uL18 Parasynechococcus marenigrum (strain WH8102)
Q0BYD0 1.92e-28 103 52 1 111 3 rplR Large ribosomal subunit protein uL18 Hyphomonas neptunium (strain ATCC 15444)
Q7UN04 1.99e-28 103 52 0 93 3 rplR Large ribosomal subunit protein uL18 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q5NQ49 2.1e-28 102 55 2 111 3 rplR Large ribosomal subunit protein uL18 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q3AMP5 2.13e-28 102 55 1 94 3 rplR Large ribosomal subunit protein uL18 Synechococcus sp. (strain CC9605)
Q9SX68 2.88e-28 103 50 3 116 2 RPL18 Large ribosomal subunit protein uL18c Arabidopsis thaliana
A9W4S4 3.28e-28 102 54 0 96 3 rplR Large ribosomal subunit protein uL18 Methylorubrum extorquens (strain PA1)
B7L0T4 3.28e-28 102 54 0 96 3 rplR Large ribosomal subunit protein uL18 Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q2JV92 3.36e-28 102 57 1 95 3 rplR Large ribosomal subunit protein uL18 Synechococcus sp. (strain JA-3-3Ab)
B8ISA1 3.51e-28 102 54 0 96 3 rplR Large ribosomal subunit protein uL18 Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A1WKA0 3.81e-28 102 49 1 120 3 rplR Large ribosomal subunit protein uL18 Verminephrobacter eiseniae (strain EF01-2)
B1IGD8 4.19e-28 102 49 4 119 3 rplR Large ribosomal subunit protein uL18 Clostridium botulinum (strain Okra / Type B1)
Q3AW78 5.26e-28 102 54 1 94 3 rplR Large ribosomal subunit protein uL18 Synechococcus sp. (strain CC9902)
A1USR0 5.37e-28 102 50 1 110 3 rplR Large ribosomal subunit protein uL18 Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B5ELZ5 5.38e-28 101 46 0 117 3 rplR Large ribosomal subunit protein uL18 Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J483 5.38e-28 101 46 0 117 3 rplR Large ribosomal subunit protein uL18 Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q890Q1 6.56e-28 101 54 1 93 3 rplR Large ribosomal subunit protein uL18 Clostridium tetani (strain Massachusetts / E88)
B0C1E8 6.66e-28 101 59 1 93 3 rplR Large ribosomal subunit protein uL18 Acaryochloris marina (strain MBIC 11017)
Q839E8 6.88e-28 101 50 2 117 1 rplR Large ribosomal subunit protein uL18 Enterococcus faecalis (strain ATCC 700802 / V583)
A9IW06 7.69e-28 101 55 0 93 3 rplR Large ribosomal subunit protein uL18 Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q4L898 7.95e-28 101 47 2 118 3 rplR Large ribosomal subunit protein uL18 Staphylococcus haemolyticus (strain JCSC1435)
Q8DML7 8.96e-28 101 52 1 116 3 rplR Large ribosomal subunit protein uL18 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q6FZD8 1.01e-27 101 54 0 93 3 rplR Large ribosomal subunit protein uL18 Bartonella quintana (strain Toulouse)
Q1ISA6 1.11e-27 101 50 2 118 3 rplR Large ribosomal subunit protein uL18 Koribacter versatilis (strain Ellin345)
P73305 1.69e-27 100 54 0 93 3 rplR Large ribosomal subunit protein uL18 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
C3MAZ6 1.84e-27 100 50 1 112 3 rplR Large ribosomal subunit protein uL18 Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q03PX3 1.88e-27 100 50 2 117 3 rplR Large ribosomal subunit protein uL18 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q0ANR6 2.26e-27 100 48 1 112 3 rplR Large ribosomal subunit protein uL18 Maricaulis maris (strain MCS10)
Q1WSA6 2.81e-27 100 48 2 117 3 rplR Large ribosomal subunit protein uL18 Ligilactobacillus salivarius (strain UCC118)
A1ALV7 3.56e-27 99 51 3 114 3 rplR Large ribosomal subunit protein uL18 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B9DM31 3.74e-27 99 47 3 119 3 rplR Large ribosomal subunit protein uL18 Staphylococcus carnosus (strain TM300)
Q46IS4 3.87e-27 99 49 2 111 3 rplR Large ribosomal subunit protein uL18 Prochlorococcus marinus (strain NATL2A)
A2C4Y4 3.87e-27 99 49 2 111 3 rplR Large ribosomal subunit protein uL18 Prochlorococcus marinus (strain NATL1A)
A8AZK9 4.03e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q6G2Y1 4.45e-27 99 52 0 93 3 rplR Large ribosomal subunit protein uL18 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A4J127 5.73e-27 99 54 0 93 3 rplR Large ribosomal subunit protein uL18 Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
C1CPA4 5.9e-27 99 51 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pneumoniae (strain Taiwan19F-14)
C1CIB3 5.9e-27 99 51 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pneumoniae (strain P1031)
C1CC22 5.9e-27 99 51 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pneumoniae (strain JJA)
Q8CWV2 5.9e-27 99 51 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97SU6 5.9e-27 99 51 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZKP6 5.9e-27 99 51 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1I8L4 5.9e-27 99 51 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pneumoniae (strain Hungary19A-6)
C1CAM8 5.9e-27 99 51 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pneumoniae (strain 70585)
B5E6H1 5.9e-27 99 51 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pneumoniae serotype 19F (strain G54)
Q04MM0 5.9e-27 99 51 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B4U516 6.08e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
A3CK80 6.1e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus sanguinis (strain SK36)
C0ME21 6.16e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus equi subsp. zooepidemicus (strain H70)
C0MB66 6.16e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus equi subsp. equi (strain 4047)
B5XJ52 6.58e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M49 (strain NZ131)
P0DE13 6.58e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M3 (strain SSI-1)
A2RC30 6.58e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q7CNP3 6.58e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XEB9 6.58e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DE12 6.58e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9A1V8 6.58e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M1
Q48VT3 6.78e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1J8Z7 6.78e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JJ46 6.78e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JP01 6.78e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JE43 6.78e-27 99 50 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus pyogenes serotype M12 (strain MGAS2096)
P23407 8.62e-27 99 55 1 94 3 rpl18 Large ribosomal subunit protein uL18c Cyanophora paradoxa
Q8DS29 9.33e-27 98 49 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B9E9K7 9.55e-27 98 48 3 120 3 rplR Large ribosomal subunit protein uL18 Macrococcus caseolyticus (strain JCSC5402)
Q03IG7 1.17e-26 98 49 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
B1LWR0 1.24e-26 98 51 0 93 3 rplR Large ribosomal subunit protein uL18 Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q49ZF2 1.63e-26 98 46 3 119 3 rplR Large ribosomal subunit protein uL18 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A2BYS1 1.7e-26 98 52 1 94 3 rplR Large ribosomal subunit protein uL18 Prochlorococcus marinus (strain MIT 9515)
Q9Z9J8 1.76e-26 98 48 2 116 3 rplR Large ribosomal subunit protein uL18 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5M2C9 1.95e-26 97 49 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXS7 1.95e-26 97 49 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus thermophilus (strain CNRZ 1066)
A5N4R3 2.06e-26 97 50 4 112 3 rplR Large ribosomal subunit protein uL18 Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
A5USH3 2.11e-26 97 56 0 93 3 rplR Large ribosomal subunit protein uL18 Roseiflexus sp. (strain RS-1)
Q8E2B8 2.23e-26 97 48 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7S5 2.23e-26 97 48 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus agalactiae serotype III (strain NEM316)
Q3K3V3 2.23e-26 97 48 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B8HMR9 2.31e-26 97 55 0 93 3 rplR Large ribosomal subunit protein uL18 Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q0AUJ6 2.71e-26 97 51 2 117 3 rplR Large ribosomal subunit protein uL18 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B0SSG2 2.78e-26 97 44 1 116 3 rplR Large ribosomal subunit protein uL18 Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SA31 2.78e-26 97 44 1 116 3 rplR Large ribosomal subunit protein uL18 Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A2BTC2 3.28e-26 97 52 1 94 3 rplR Large ribosomal subunit protein uL18 Prochlorococcus marinus (strain AS9601)
B5EFR6 4.03e-26 97 53 1 116 3 rplR Large ribosomal subunit protein uL18 Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q3ZZQ8 4.14e-26 97 44 1 118 3 rplR Large ribosomal subunit protein uL18 Dehalococcoides mccartyi (strain CBDB1)
A5FRX7 4.14e-26 97 44 1 118 3 rplR Large ribosomal subunit protein uL18 Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q3Z965 4.14e-26 97 44 1 118 3 rplR Large ribosomal subunit protein uL18 Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B8ELE7 4.79e-26 97 51 0 96 3 rplR Large ribosomal subunit protein uL18 Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q1IX88 5.38e-26 96 50 2 112 3 rplR Large ribosomal subunit protein uL18 Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q8R7X0 5.5e-26 96 49 3 114 3 rplR Large ribosomal subunit protein uL18 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A4VSG9 6.83e-26 96 47 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus suis (strain 05ZYH33)
A4VYQ8 6.83e-26 96 47 2 117 3 rplR Large ribosomal subunit protein uL18 Streptococcus suis (strain 98HAH33)
Q927M3 6.98e-26 96 47 2 118 3 rplR Large ribosomal subunit protein uL18 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A5D5H0 7.03e-26 96 52 0 93 3 rplR Large ribosomal subunit protein uL18 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
O67564 7.35e-26 96 45 4 121 3 rplR Large ribosomal subunit protein uL18 Aquifex aeolicus (strain VF5)
Q8KAI7 8.77e-26 96 49 4 121 3 rplR Large ribosomal subunit protein uL18 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q318J9 9.13e-26 96 52 1 94 3 rplR Large ribosomal subunit protein uL18 Prochlorococcus marinus (strain MIT 9312)
B8FER9 9.74e-26 96 46 2 112 3 rplR Large ribosomal subunit protein uL18 Desulfatibacillum aliphaticivorans
Q4JT85 1.08e-25 96 56 2 96 3 rplR Large ribosomal subunit protein uL18 Corynebacterium jeikeium (strain K411)
A0ALV2 1.18e-25 95 46 2 118 3 rplR Large ribosomal subunit protein uL18 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y445 1.18e-25 95 46 2 118 1 rplR Large ribosomal subunit protein uL18 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DB24 1.18e-25 95 46 2 118 3 rplR Large ribosomal subunit protein uL18 Listeria monocytogenes serotype 4a (strain HCC23)
Q71WG2 1.18e-25 95 46 2 118 3 rplR Large ribosomal subunit protein uL18 Listeria monocytogenes serotype 4b (strain F2365)
C1KZG4 1.18e-25 95 46 2 118 3 rplR Large ribosomal subunit protein uL18 Listeria monocytogenes serotype 4b (strain CLIP80459)
Q03ED2 1.22e-25 95 49 2 117 3 rplR Large ribosomal subunit protein uL18 Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q8CRH6 1.39e-25 95 46 2 118 3 rplR Large ribosomal subunit protein uL18 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HM15 1.39e-25 95 46 2 118 3 rplR Large ribosomal subunit protein uL18 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A3PF32 1.54e-25 95 53 2 96 3 rplR Large ribosomal subunit protein uL18 Prochlorococcus marinus (strain MIT 9301)
Q9ZI37 1.94e-25 95 45 4 121 3 rplR Large ribosomal subunit protein uL18 Aquifex pyrophilus

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS19000
Feature type CDS
Gene rplR
Product 50S ribosomal protein L18
Location 14601 - 14954 (strand: 1)
Length 354 (nucleotides) / 117 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000011
Length 30728 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2416
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00861 Ribosomal L18 of archaea, bacteria, mitoch. and chloroplast

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0256 Translation, ribosomal structure and biogenesis (J) J Ribosomal protein L18

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02881 large subunit ribosomal protein L18 Ribosome -

Protein Sequence

MDKKAARIRRATRARRKLQELGATRLVVHRTPRHIYAQVIAPNGSETLVAASTLEKAISEQVKSTGNKDAAIAVGKIIAERALEKGITRVSFDRSGFQYHGRVQALADAAREAGLQF

Flanking regions ( +/- flanking 50bp)

CCGACGAAGTCGTGCGTATTAAAGAGGCTAAGAAGAAGTAAGGTAACACTATGGATAAGAAAGCAGCTCGTATCCGTCGTGCGACCCGCGCACGCCGCAAGCTCCAGGAACTTGGTGCGACGCGCCTGGTGGTACATCGTACCCCACGCCATATTTATGCGCAGGTTATTGCACCAAACGGTTCTGAAACGTTGGTTGCCGCTTCTACTTTAGAAAAAGCTATCAGCGAGCAAGTAAAAAGCACAGGAAACAAAGATGCCGCAATCGCAGTAGGTAAAATTATTGCTGAGCGCGCACTGGAAAAAGGGATCACTCGTGTTTCCTTTGACCGTTCTGGTTTCCAATATCATGGTCGAGTCCAGGCACTGGCAGATGCTGCCCGTGAAGCTGGCCTACAGTTCTAAGGTAGAGGTGTAAGATGGCACACATCGAAAAACAGGCTGGCGAACTGCAG