Homologs in group_3876
1 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product | |
|---|---|---|---|---|---|
| PMI_RS19340 | PMI_RS19340 | 68.8 | Proteus mirabilis HI4320 | ilvL | ilv operon leader peptide |
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|
| Source | Morganella psychrotolerans |
|---|---|
| Locus tag | F4V73_RS18685 |
| Feature type | CDS |
| Gene | ilvL |
| Product | ilv operon leader peptide |
| Location | 4106 - 4204 (strand: 1) |
| Length | 99 (nucleotides) / 32 (amino acids) |
| In genomic island | - |
| Accession | NZ_VXKB01000010 |
|---|---|
| Length | 36620 nucleotides |
| Topology | linear |
| Plasmid | False |
| Orthogroup | group_3876 | |
|---|---|---|
| Orthogroup size | 2 | |
| N. genomes | 2 |
| PF08046 | IlvGEDA operon leader peptide |
|---|
MNKIVRVVSLIIVSVVVIIIPPCGAARGRENG
GATAACTCTAAAATACAGAAACCAGATTGATACGGCAGAAGAATTTCAATATGAATAAGATTGTCCGCGTTGTCAGCCTAATTATCGTGAGCGTGGTGGTGATTATTATCCCACCGTGCGGGGCTGCACGTGGACGAGAGAATGGCTGACAACCACTCAGATCTTACGAGAACCCCGCACCGAAAGGCGCGGGGTTTTT
