Homologs in group_2215

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16930 FBDBKF_16930 94.7 Morganella morganii S1 ubiB ubiquinone biosynthesis regulatory protein kinase UbiB
EHELCC_16660 EHELCC_16660 94.7 Morganella morganii S2 ubiB ubiquinone biosynthesis regulatory protein kinase UbiB
NLDBIP_16870 NLDBIP_16870 94.7 Morganella morganii S4 ubiB ubiquinone biosynthesis regulatory protein kinase UbiB
LHKJJB_16600 LHKJJB_16600 94.7 Morganella morganii S3 ubiB ubiquinone biosynthesis regulatory protein kinase UbiB
HKOGLL_17565 HKOGLL_17565 94.7 Morganella morganii S5 ubiB ubiquinone biosynthesis regulatory protein kinase UbiB
PMI_RS17585 PMI_RS17585 76.3 Proteus mirabilis HI4320 ubiB ubiquinone biosynthesis regulatory protein kinase UbiB

Distribution of the homologs in the orthogroup group_2215

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2215

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O07443 0.0 895 77 0 543 1 ubiB Probable protein kinase UbiB Providencia stuartii
Q7MZ83 0.0 882 77 1 545 3 ubiB Probable protein kinase UbiB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B7LTZ9 0.0 867 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A8ACY4 0.0 867 77 4 543 3 ubiB Probable protein kinase UbiB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P0A6A2 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Shigella flexneri
Q0SZ27 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Shigella flexneri serotype 5b (strain 8401)
Q32A13 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Shigella dysenteriae serotype 1 (strain Sd197)
Q31UF1 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Shigella boydii serotype 4 (strain Sb227)
B2TVI6 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I4H7 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli (strain SE11)
P0A6A0 0.0 865 77 4 543 1 ubiB Probable protein kinase UbiB Escherichia coli (strain K12)
B1IW70 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6U2 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O9:H4 (strain HS)
B1XAJ9 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli (strain K12 / DH10B)
C5A011 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli (strain K12 / MC4100 / BW2952)
B7M640 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O8 (strain IAI1)
B5YY84 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6A1 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O157:H7
B7L998 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli (strain 55989 / EAEC)
A7ZU42 0.0 865 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NFD8 0.0 864 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NV31 0.0 864 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UNG5 0.0 864 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A1JIF4 0.0 863 79 1 539 3 ubiB Probable protein kinase UbiB Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q3YVD0 0.0 863 77 4 543 3 ubiB Probable protein kinase UbiB Shigella sonnei (strain Ss046)
Q1R475 0.0 863 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli (strain UTI89 / UPEC)
Q8FBI8 0.0 863 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAL9 0.0 863 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AI24 0.0 863 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O1:K1 / APEC
B7N2E3 0.0 863 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O81 (strain ED1a)
B7MHC2 0.0 863 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LM23 0.0 862 77 4 543 3 ubiB Probable protein kinase UbiB Escherichia coli (strain SMS-3-5 / SECEC)
P0A197 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A198 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella typhi
B4TNY1 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella schwarzengrund (strain CVM19633)
B5BIY1 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella paratyphi A (strain AKU_12601)
C0Q3E3 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella paratyphi C (strain RKS4594)
A9MY99 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKP2 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZ75 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella newport (strain SL254)
B4TBR5 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella heidelberg (strain SL476)
B5FNW8 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella dublin (strain CT_02021853)
Q57HN6 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella choleraesuis (strain SC-B67)
B5EZV0 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella agona (strain SL483)
B5RFM6 0.0 861 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QW75 0.0 860 79 4 529 3 ubiB Probable protein kinase UbiB Salmonella enteritidis PT4 (strain P125109)
Q66FS8 0.0 859 78 1 539 3 ubiB Probable protein kinase UbiB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR37 0.0 859 78 1 539 3 ubiB Probable protein kinase UbiB Yersinia pestis (strain Pestoides F)
Q1CNB2 0.0 859 78 1 539 3 ubiB Probable protein kinase UbiB Yersinia pestis bv. Antiqua (strain Nepal516)
A9R429 0.0 859 78 1 539 3 ubiB Probable protein kinase UbiB Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAM1 0.0 859 78 1 539 3 ubiB Probable protein kinase UbiB Yersinia pestis
B2K0Y6 0.0 859 78 1 539 3 ubiB Probable protein kinase UbiB Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBF8 0.0 859 78 1 539 3 ubiB Probable protein kinase UbiB Yersinia pestis bv. Antiqua (strain Antiqua)
A7FDE2 0.0 859 78 1 539 3 ubiB Probable protein kinase UbiB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8G8C0 0.0 859 77 1 539 3 ubiB Probable protein kinase UbiB Serratia proteamaculans (strain 568)
C6DI75 0.0 855 76 3 542 3 ubiB Probable protein kinase UbiB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A4WFY3 0.0 853 76 3 542 3 ubiB Probable protein kinase UbiB Enterobacter sp. (strain 638)
Q6DAQ5 0.0 850 76 3 542 3 ubiB Probable protein kinase UbiB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NWT9 0.0 848 76 3 538 3 ubiB Probable protein kinase UbiB Sodalis glossinidius (strain morsitans)
C5BCA6 0.0 847 75 1 539 3 ubiB Probable protein kinase UbiB Edwardsiella ictaluri (strain 93-146)
B2VG47 0.0 846 74 3 545 3 ubiB Probable protein kinase UbiB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A6TGL5 0.0 843 75 3 542 3 ubiB Probable protein kinase UbiB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XYH9 0.0 840 75 3 542 3 ubiB Probable protein kinase UbiB Klebsiella pneumoniae (strain 342)
A7MQL5 0.0 835 75 3 542 3 ubiB Probable protein kinase UbiB Cronobacter sakazakii (strain ATCC BAA-894)
Q6LVW8 0.0 775 68 1 539 3 ubiB Probable protein kinase UbiB Photobacterium profundum (strain SS9)
B7VHC3 0.0 772 69 3 543 3 ubiB Probable protein kinase UbiB Vibrio atlanticus (strain LGP32)
A5F4G3 0.0 768 69 1 539 3 ubiB Probable protein kinase UbiB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8DDQ1 0.0 768 69 1 539 3 ubiB Probable protein kinase UbiB Vibrio vulnificus (strain CMCP6)
C3LPS7 0.0 768 69 1 539 3 ubiB Probable protein kinase UbiB Vibrio cholerae serotype O1 (strain M66-2)
Q9KVQ4 0.0 768 69 1 539 3 ubiB Probable protein kinase UbiB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MQ31 0.0 768 68 1 539 3 ubiB Probable protein kinase UbiB Vibrio vulnificus (strain YJ016)
A7MTX4 0.0 763 68 1 539 3 ubiB Probable protein kinase UbiB Vibrio campbellii (strain ATCC BAA-1116)
Q87TH2 0.0 763 68 1 539 3 ubiB Probable protein kinase UbiB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B6EHA6 0.0 747 66 1 539 3 ubiB Probable protein kinase UbiB Aliivibrio salmonicida (strain LFI1238)
B5FF80 0.0 747 66 1 539 3 ubiB Probable protein kinase UbiB Aliivibrio fischeri (strain MJ11)
Q5E8V3 0.0 746 66 1 539 3 ubiB Probable protein kinase UbiB Aliivibrio fischeri (strain ATCC 700601 / ES114)
A4STK9 0.0 737 67 3 544 3 ubiB Probable protein kinase UbiB Aeromonas salmonicida (strain A449)
A0KEF8 0.0 736 67 3 544 3 ubiB Probable protein kinase UbiB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q9CKD4 0.0 714 65 2 527 3 ubiB Probable protein kinase UbiB Pasteurella multocida (strain Pm70)
C4L962 0.0 700 65 1 539 3 ubiB Probable protein kinase UbiB Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q7VN62 0.0 694 65 3 509 3 ubiB Probable protein kinase UbiB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A3N3S2 0.0 690 65 3 514 3 ubiB Probable protein kinase UbiB Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BU10 0.0 687 64 3 514 3 ubiB Probable protein kinase UbiB Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZD0 0.0 686 66 3 503 3 ubiB Probable protein kinase UbiB Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A0L1M6 0.0 682 60 2 540 3 ubiB Probable protein kinase UbiB Shewanella sp. (strain ANA-3)
Q0I208 0.0 679 61 5 543 3 ubiB Probable protein kinase UbiB Histophilus somni (strain 129Pt)
Q0HE99 0.0 678 59 2 540 3 ubiB Probable protein kinase UbiB Shewanella sp. (strain MR-4)
Q0HZP9 0.0 677 59 2 540 3 ubiB Probable protein kinase UbiB Shewanella sp. (strain MR-7)
Q8E9R5 0.0 677 60 2 540 3 ubiB Probable protein kinase UbiB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B8CI04 0.0 672 60 2 540 3 ubiB Probable protein kinase UbiB Shewanella piezotolerans (strain WP3 / JCM 13877)
A1RP80 0.0 671 59 2 540 3 ubiB Probable protein kinase UbiB Shewanella sp. (strain W3-18-1)
A4Y2Q3 0.0 671 59 2 540 3 ubiB Probable protein kinase UbiB Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B1KR05 0.0 671 59 2 540 3 ubiB Probable protein kinase UbiB Shewanella woodyi (strain ATCC 51908 / MS32)
Q491V8 0.0 669 58 2 541 3 ubiB Probable protein kinase UbiB Blochmanniella pennsylvanica (strain BPEN)
B0TJ18 0.0 667 59 3 544 3 ubiB Probable protein kinase UbiB Shewanella halifaxensis (strain HAW-EB4)
A9KYL6 0.0 667 59 2 540 3 ubiB Probable protein kinase UbiB Shewanella baltica (strain OS195)
A6WIE7 0.0 667 59 2 540 3 ubiB Probable protein kinase UbiB Shewanella baltica (strain OS185)
A3D9F4 0.0 665 58 2 540 3 ubiB Probable protein kinase UbiB Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E6B4 0.0 665 58 2 540 3 ubiB Probable protein kinase UbiB Shewanella baltica (strain OS223)
A1SAK0 0.0 664 59 3 542 3 ubiB Probable protein kinase UbiB Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A3QIE3 0.0 664 59 2 540 3 ubiB Probable protein kinase UbiB Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B8F6K1 0.0 664 64 2 496 3 ubiB Probable protein kinase UbiB Glaesserella parasuis serovar 5 (strain SH0165)
Q12S25 0.0 660 60 2 540 3 ubiB Probable protein kinase UbiB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A8H968 0.0 659 59 2 540 3 ubiB Probable protein kinase UbiB Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q088I0 0.0 659 58 2 540 3 ubiB Probable protein kinase UbiB Shewanella frigidimarina (strain NCIMB 400)
A1U669 0.0 554 52 4 545 3 ubiB Probable protein kinase UbiB Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A4XPM5 0.0 549 62 5 447 3 ubiB Probable protein kinase UbiB Pseudomonas mendocina (strain ymp)
Q9HUB8 0.0 548 59 6 478 3 ubiB Probable protein kinase UbiB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V3F8 0.0 548 59 6 478 3 ubiB Probable protein kinase UbiB Pseudomonas aeruginosa (strain LESB58)
A6VDI8 0.0 548 54 9 545 3 ubiB Probable protein kinase UbiB Pseudomonas aeruginosa (strain PA7)
Q02EV2 0.0 547 59 6 478 3 ubiB Probable protein kinase UbiB Pseudomonas aeruginosa (strain UCBPP-PA14)
A5WA47 0.0 545 59 7 478 3 ubiB Probable protein kinase UbiB Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1I3S8 0.0 545 60 7 478 3 ubiB Probable protein kinase UbiB Pseudomonas entomophila (strain L48)
B3PH50 0.0 543 53 5 548 3 ubiB Probable protein kinase UbiB Cellvibrio japonicus (strain Ueda107)
Q2SN14 0.0 543 53 3 526 3 ubiB Probable protein kinase UbiB Hahella chejuensis (strain KCTC 2396)
B0KM38 0.0 542 60 7 478 3 ubiB Probable protein kinase UbiB Pseudomonas putida (strain GB-1)
B1J2S6 0.0 537 60 5 477 3 ubiB Probable protein kinase UbiB Pseudomonas putida (strain W619)
C3K8U2 0.0 535 58 6 479 3 ubiB Probable protein kinase UbiB Pseudomonas fluorescens (strain SBW25)
Q4ZZG5 0.0 533 54 6 514 3 ubiB Probable protein kinase UbiB Pseudomonas syringae pv. syringae (strain B728a)
C1DHS4 0.0 533 57 6 478 3 ubiB Probable protein kinase UbiB Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q87UZ0 0.0 532 54 6 514 3 ubiB Probable protein kinase UbiB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3KJC7 0.0 532 54 6 530 3 ubiB Probable protein kinase UbiB Pseudomonas fluorescens (strain Pf0-1)
Q48PJ6 0.0 531 54 6 514 3 ubiB Probable protein kinase UbiB Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4KJL4 0.0 530 59 4 475 3 ubiB Probable protein kinase UbiB Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7NZD1 3.41e-175 507 53 7 496 3 ubiB Probable protein kinase UbiB Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8Y275 5.62e-173 502 52 6 512 3 ubiB Probable protein kinase UbiB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B1XWR5 1.06e-171 498 51 6 520 3 ubiB Probable protein kinase UbiB Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B2SX38 2.2e-171 498 50 5 512 3 ubiB Probable protein kinase UbiB Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q145N7 4.08e-171 497 50 5 512 3 ubiB Probable protein kinase UbiB Paraburkholderia xenovorans (strain LB400)
B2JCV1 1.07e-169 494 51 6 514 3 ubiB Probable protein kinase UbiB Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A1TTA2 1.78e-169 493 51 6 524 3 ubiB Probable protein kinase UbiB Paracidovorax citrulli (strain AAC00-1)
B9ME24 6.2e-169 491 52 5 500 3 ubiB Probable protein kinase UbiB Acidovorax ebreus (strain TPSY)
C5CWY2 1.14e-168 491 51 7 517 3 ubiB Probable protein kinase UbiB Variovorax paradoxus (strain S110)
A1W4D7 2.05e-168 490 54 4 475 3 ubiB Probable protein kinase UbiB Acidovorax sp. (strain JS42)
Q9K0N0 3.74e-168 489 53 7 491 3 ubiB Probable protein kinase UbiB Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q63X97 3.19e-167 487 49 5 522 3 ubiB Probable protein kinase UbiB Burkholderia pseudomallei (strain K96243)
A3N5V1 3.19e-167 487 49 5 522 3 ubiB Probable protein kinase UbiB Burkholderia pseudomallei (strain 668)
Q3JVZ2 3.19e-167 487 49 5 522 3 ubiB Probable protein kinase UbiB Burkholderia pseudomallei (strain 1710b)
A3NRJ7 3.19e-167 487 49 5 522 3 ubiB Probable protein kinase UbiB Burkholderia pseudomallei (strain 1106a)
A1V750 3.19e-167 487 49 5 522 3 ubiB Probable protein kinase UbiB Burkholderia mallei (strain SAVP1)
Q62MP2 3.19e-167 487 49 5 522 3 ubiB Probable protein kinase UbiB Burkholderia mallei (strain ATCC 23344)
A2S8L4 3.19e-167 487 49 5 522 3 ubiB Probable protein kinase UbiB Burkholderia mallei (strain NCTC 10229)
A3MNU1 3.19e-167 487 49 5 522 3 ubiB Probable protein kinase UbiB Burkholderia mallei (strain NCTC 10247)
A9BP42 2.25e-166 485 51 5 510 3 ubiB Probable protein kinase UbiB Delftia acidovorans (strain DSM 14801 / SPH-1)
Q9JVQ5 3.28e-165 481 52 7 492 3 ubiB Probable protein kinase UbiB Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q87CN1 2.32e-152 450 44 8 547 3 ubiB Probable protein kinase UbiB Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I583 2.32e-152 450 44 8 547 3 ubiB Probable protein kinase UbiB Xylella fastidiosa (strain M23)
Q9PCE8 3.18e-152 450 44 8 547 3 ubiB Probable protein kinase UbiB Xylella fastidiosa (strain 9a5c)
B0RLZ0 4.38e-151 447 44 6 549 3 ubiB Probable protein kinase UbiB Xanthomonas campestris pv. campestris (strain B100)
Q8PDW1 5.27e-151 447 44 6 549 3 ubiB Probable protein kinase UbiB Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4V052 5.27e-151 447 44 6 549 3 ubiB Probable protein kinase UbiB Xanthomonas campestris pv. campestris (strain 8004)
B0U2R2 2.65e-150 445 44 8 547 3 ubiB Probable protein kinase UbiB Xylella fastidiosa (strain M12)
Q3BZ34 1.05e-149 444 44 6 549 3 ubiB Probable protein kinase UbiB Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PQT0 1.28e-149 443 45 7 551 3 ubiB Probable protein kinase UbiB Xanthomonas axonopodis pv. citri (strain 306)
Q5H616 3.46e-149 442 45 9 554 3 ubiB Probable protein kinase UbiB Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2ST34 3.46e-149 442 45 9 554 3 ubiB Probable protein kinase UbiB Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P8Q0 3.46e-149 442 45 9 554 3 ubiB Probable protein kinase UbiB Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q55884 2.61e-55 198 32 4 380 3 sll0095 Uncharacterized protein sll0095 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q46189 3.94e-52 189 30 4 383 3 None Uncharacterized protein in hydrogenase 1 5'region (Fragment) Clostridium pasteurianum
Q55680 2.22e-49 184 30 5 389 3 sll0005 Uncharacterized protein sll0005 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q94BU1 2.37e-49 184 30 5 390 1 At1g71810 Uncharacterized aarF domain-containing protein kinase At1g71810, chloroplastic Arabidopsis thaliana
P73627 8.9e-49 181 28 6 460 3 sll1770 Uncharacterized protein sll1770 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P73577 4.79e-48 175 32 5 372 3 slr0889 Uncharacterized protein slr0889 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B9DGY1 1.81e-47 179 29 5 383 1 ABC1K7 Protein ACTIVITY OF BC1 COMPLEX KINASE 7, chloroplastic Arabidopsis thaliana
Q93Y08 7.68e-47 178 27 12 516 2 ABC1K8 Protein ACTIVITY OF BC1 COMPLEX KINASE 8, chloroplastic Arabidopsis thaliana
Q8RWG1 2.17e-46 176 31 3 385 1 ABC1K1 Protein ACTIVITY OF BC1 COMPLEX KINASE 1, chloroplastic Arabidopsis thaliana
Q9MA15 5.84e-43 166 28 1 379 1 ABC1K3 Protein ACTIVITY OF BC1 COMPLEX KINASE 3, chloroplastic Arabidopsis thaliana
P73121 1.01e-41 161 28 4 380 3 slr1919 Uncharacterized protein slr1919 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q43924 5.86e-41 149 60 1 125 3 ubiB Probable protein kinase UbiB (Fragment) Azotobacter chroococcum mcd 1
P9WQI1 3.99e-39 152 28 6 366 1 Rv0647c Uncharacterized protein Rv0647c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI0 3.99e-39 152 28 6 366 3 MT0675 Uncharacterized protein MT0675 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9P7M0 3.31e-36 146 26 7 444 3 SPBC21C3.03 ABC1 family protein C21C3.03, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q02981 1.8e-35 144 24 9 446 1 YPL109C ABC1 family protein YPL109C, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9ASX5 3.59e-34 139 25 5 396 1 At5g05200 Uncharacterized aarF domain-containing protein kinase At5g05200, chloroplastic Arabidopsis thaliana
Q55G83 2.34e-31 132 32 6 251 3 abkC Probable serine/threonine-protein kinase abkC Dictyostelium discoideum
Q55G83 1.04e-09 65 29 3 147 3 abkC Probable serine/threonine-protein kinase abkC Dictyostelium discoideum
Q54P00 6.09e-26 115 28 4 257 2 abkD Probable serine/threonine-protein kinase abkD Dictyostelium discoideum
Q3MIX3 6.69e-26 115 28 2 270 1 ADCK5 Uncharacterized aarF domain-containing protein kinase 5 Homo sapiens
Q6NSR3 8.83e-23 105 25 2 311 2 Adck2 Uncharacterized aarF domain-containing protein kinase 2 Mus musculus
Q6NSR3 0.001 45 34 3 86 2 Adck2 Uncharacterized aarF domain-containing protein kinase 2 Mus musculus
Q80V03 3.91e-22 103 27 4 271 2 Adck5 Uncharacterized aarF domain-containing protein kinase 5 Mus musculus
Q6INL7 1.38e-21 101 28 7 259 2 adck1 AarF domain-containing protein kinase 1 Xenopus laevis
Q9W133 1.66e-21 101 29 5 253 1 Adck1 AarF domain-containing kinase 1 Drosophila melanogaster
Q5ZMT7 2.13e-21 101 28 7 291 2 ADCK1 AarF domain-containing protein kinase 1 Gallus gallus
O42653 4.53e-21 100 26 5 303 3 SPAC10F6.14c ABC1 family protein C10F6.14c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7Z695 6e-21 100 25 3 312 1 ADCK2 Uncharacterized aarF domain-containing protein kinase 2 Homo sapiens
Q7Z695 0.000283 47 33 0 81 1 ADCK2 Uncharacterized aarF domain-containing protein kinase 2 Homo sapiens
Q86TW2 3.74e-20 97 28 7 280 1 ADCK1 AarF domain-containing protein kinase 1 Homo sapiens
Q5M7P6 1.09e-19 95 29 7 259 2 adck1 AarF domain-containing protein kinase 1 Xenopus tropicalis
Q9D0L4 2.03e-19 95 29 5 255 1 Adck1 AarF domain-containing protein kinase 1 Mus musculus
O60111 2.06e-19 95 28 9 258 3 SPBC15C4.02 ABC1 family protein MCP2 homolog Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q29RI0 7.34e-19 94 31 6 217 2 COQ8A Atypical kinase COQ8A, mitochondrial Bos taurus
Q54TR5 1.19e-18 93 27 4 262 3 abkB Probable serine/threonine-protein kinase abkB Dictyostelium discoideum
Q5BJQ0 1.2e-18 93 31 6 217 2 Coq8a Atypical kinase COQ8A, mitochondrial Rattus norvegicus
Q60936 2.04e-18 92 31 6 217 1 Coq8a Atypical kinase COQ8A, mitochondrial Mus musculus
Q8NI60 8.87e-18 90 30 6 218 1 COQ8A Atypical kinase COQ8A, mitochondrial Homo sapiens
Q9SBB2 4.34e-16 85 27 4 244 2 ABC1 Protein ABC transporter 1, mitochondrial Arabidopsis thaliana
Q5RGU1 4.7e-16 85 30 6 217 2 coq8a Atypical kinase COQ8A, mitochondrial Danio rerio
Q98496 4.79e-15 81 27 8 266 2 A445L Putative ABC transporter A445L Paramecium bursaria Chlorella virus 1
Q06567 7.2e-15 81 26 7 249 1 MCP2 ABC1 family protein MCP2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q18486 7.92e-15 81 25 6 306 3 coq-8 Atypical kinase coq-8, mitochondrial Caenorhabditis elegans
A3QJU3 1.28e-14 80 26 5 252 3 coq8b Atypical kinase COQ8B, mitochondrial Danio rerio
Q566J8 4.69e-14 78 28 4 211 1 Coq8b Atypical kinase COQ8B, mitochondrial Mus musculus
Q96D53 4.99e-14 78 28 4 210 1 COQ8B Atypical kinase COQ8B, mitochondrial Homo sapiens
A0A179HKZ8 9.15e-14 77 23 10 365 2 lcsO ABC1 family protein lscO Purpureocillium lilacinum
Q6AY19 1.47e-13 76 29 4 210 1 Coq8b Atypical kinase COQ8B, mitochondrial Rattus norvegicus
A0A172M468 4.14e-13 72 32 3 161 2 RxLR27 Secreted RxLR effector protein 27 Plasmopara viticola
P27697 6.19e-13 74 25 3 208 1 COQ8 Atypical kinase COQ8, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q54IH6 3.94e-11 69 21 7 338 3 abkA Probable serine/threonine-protein kinase abkA Dictyostelium discoideum
Q92338 5e-11 68 28 3 193 2 abc1 Protein ABC1 homolog, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O04212 1.9e-10 67 25 10 304 2 At2g40090 Putative ABC1 protein At2g40090 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS18400
Feature type CDS
Gene ubiB
Product ubiquinone biosynthesis regulatory protein kinase UbiB
Location 13496 - 15133 (strand: -1)
Length 1638 (nucleotides) / 545 (amino acids)

Contig

Accession term accessions NZ_VXKB01000009 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 74461 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2215
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03109 ABC1 atypical kinase-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0661 Coenzyme transport and metabolism (H)
Signal transduction mechanisms (T)		 HT Predicted protein kinase regulating ubiquinone biosynthesis, AarF/ABC1/UbiB family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03688 ubiquinone biosynthesis protein - -

Protein Sequence

MRPSEIKRLYFIIRTLLAYGLDELVPKNRLSWAIRLWRRSLFWMPNKHKDKALGERLRLALQELGPVWIKFGQMLSTRRDLFPPAIADQLAQLQDRVSPFDGALAKKTIEDAMEGPVETWFDDFDITPLASASIAQVHTAVLKENGQAVVLKVIRPDILPVIQADIHLMYRLAGMIPLLPDGRRLRPKEVVREYEKTLLDELNLQREAANAIQLRRNFENSPMLYIPEVYPDLCRENVLVMERIYGIPVSDIAALNAQGTNMKLLAERGVQVFFTQVFRDSFFHADMHPGNIFVSREHPDDPQYIGIDCGIVGSLNKEDKRYLAENFIAFFNRDYRKVAELHVDSGWVPPDTNVEDFEFAIRTVCEPIFEKPLAEISFGHVLLNLFNTARRFNMEVQPQLVLLQKTLLYVEGLGRQLYPQLDLWKTAKPFLESWLKSQIGIKAVIRGIKEKAPFWAEKLPELPELVYDSLRQQRRLLSGVERLTEQMKQQQATQRKVNFALGVGATLFICASLFYLAGAPRAPWVLMSFGAVSWVTGWWQSGKMK

Flanking regions ( +/- flanking 50bp)

AGAACTTGATGCGCGGCTTTCCCGTCTGAAAAAGAGAGCAGGAACAGGGCATGAGACCGAGTGAGATTAAACGCCTTTATTTTATTATCCGTACTCTCCTTGCTTACGGTCTGGATGAACTCGTCCCGAAAAACCGGCTGAGTTGGGCTATCCGCCTCTGGCGCCGCTCACTTTTCTGGATGCCGAATAAGCATAAAGACAAGGCATTAGGTGAACGCCTGCGCCTTGCATTACAGGAACTGGGGCCGGTCTGGATCAAATTCGGGCAGATGCTTTCTACCCGCCGGGATCTGTTTCCGCCTGCCATTGCTGACCAACTGGCTCAGTTGCAGGATCGTGTGTCGCCTTTTGATGGTGCGCTGGCAAAGAAAACAATTGAAGATGCGATGGAAGGGCCGGTTGAAACCTGGTTTGATGATTTCGATATCACTCCTCTGGCATCAGCCTCGATAGCCCAGGTGCATACTGCCGTTCTGAAAGAAAACGGGCAGGCAGTCGTCCTTAAAGTGATCCGCCCTGATATTCTGCCGGTTATACAGGCCGATATTCATCTGATGTACCGGCTGGCAGGGATGATCCCGCTGTTACCGGACGGACGGCGCCTGCGCCCGAAAGAAGTAGTGCGTGAATATGAAAAAACGCTGCTGGATGAACTGAATCTGCAACGTGAAGCGGCAAATGCGATTCAGCTGCGGCGCAACTTTGAAAACAGCCCGATGCTGTATATTCCGGAAGTGTATCCGGATCTCTGCCGTGAAAATGTGCTGGTGATGGAACGGATCTACGGGATCCCTGTCTCTGATATTGCCGCACTGAATGCGCAGGGGACTAATATGAAGCTGTTAGCCGAACGTGGCGTACAGGTCTTTTTTACCCAGGTATTTCGTGACAGTTTTTTCCATGCGGATATGCATCCGGGCAATATTTTTGTCAGTCGGGAGCATCCGGACGATCCGCAGTATATCGGTATCGACTGTGGCATTGTCGGCTCACTGAATAAAGAAGATAAGCGCTATCTGGCTGAAAATTTTATCGCCTTTTTTAACCGCGATTACCGGAAAGTGGCTGAATTACATGTCGATTCCGGCTGGGTTCCGCCGGATACGAATGTTGAAGATTTTGAATTTGCCATCCGTACTGTCTGTGAACCGATTTTTGAAAAACCGCTGGCGGAAATTTCATTCGGACATGTTCTGCTGAACCTGTTTAATACCGCCCGCCGGTTTAATATGGAAGTACAGCCACAGTTGGTTTTATTGCAGAAAACACTGCTGTATGTCGAAGGTCTGGGACGTCAGCTTTATCCGCAGCTGGATTTGTGGAAAACAGCAAAACCGTTCCTGGAGTCATGGCTGAAAAGTCAGATTGGCATTAAAGCCGTGATCCGAGGGATAAAAGAGAAAGCACCTTTCTGGGCTGAAAAACTTCCTGAGTTACCTGAATTGGTGTATGACAGTCTCAGGCAGCAGCGCCGTTTGTTGTCAGGCGTTGAACGGCTGACTGAGCAGATGAAACAACAGCAGGCGACACAACGGAAAGTCAATTTTGCTCTCGGTGTCGGCGCAACCTTATTTATCTGTGCAAGCCTGTTTTATCTTGCCGGCGCTCCGCGTGCACCCTGGGTTCTGATGTCCTTTGGTGCTGTGAGTTGGGTAACAGGATGGTGGCAATCAGGTAAAATGAAGTAAAGATTGAGTTAAAACAAAGTTTCAACAGGTGTTGCGTATTTCCGTATATA