Homologs in group_2205

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16880 FBDBKF_16880 90.5 Morganella morganii S1 pepQ Xaa-Pro dipeptidase
EHELCC_19550 EHELCC_19550 90.5 Morganella morganii S2 pepQ Xaa-Pro dipeptidase
NLDBIP_16920 NLDBIP_16920 90.5 Morganella morganii S4 pepQ Xaa-Pro dipeptidase
LHKJJB_16550 LHKJJB_16550 90.5 Morganella morganii S3 pepQ Xaa-Pro dipeptidase
HKOGLL_17515 HKOGLL_17515 90.5 Morganella morganii S5 pepQ Xaa-Pro dipeptidase
PMI_RS17645 PMI_RS17645 71.8 Proteus mirabilis HI4320 pepQ Xaa-Pro dipeptidase

Distribution of the homologs in the orthogroup group_2205

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2205

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EWE3 0.0 688 71 0 444 3 pepQ Xaa-Pro dipeptidase Proteus mirabilis (strain HI4320)
Q7MZ93 0.0 685 71 0 443 3 pepQ Xaa-Pro dipeptidase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8G8D3 0.0 681 71 1 444 3 pepQ Xaa-Pro dipeptidase Serratia proteamaculans (strain 568)
A1JIG5 0.0 679 72 3 450 3 pepQ Xaa-Pro dipeptidase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JP62 0.0 675 71 1 444 3 pepQ Xaa-Pro dipeptidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FR7 0.0 675 71 1 444 3 pepQ Xaa-Pro dipeptidase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K0Z7 0.0 675 71 1 444 3 pepQ Xaa-Pro dipeptidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FDF3 0.0 675 71 1 444 3 pepQ Xaa-Pro dipeptidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TR26 0.0 673 70 1 444 3 pepQ Xaa-Pro dipeptidase Yersinia pestis (strain Pestoides F)
Q1CN98 0.0 673 70 1 444 3 pepQ Xaa-Pro dipeptidase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R755 0.0 673 70 1 444 3 pepQ Xaa-Pro dipeptidase Yersinia pestis bv. Antiqua (strain Angola)
Q0WAP4 0.0 673 70 1 444 3 pepQ Xaa-Pro dipeptidase Yersinia pestis
Q1C2C5 0.0 673 70 1 444 3 pepQ Xaa-Pro dipeptidase Yersinia pestis bv. Antiqua (strain Antiqua)
B7NV19 0.0 663 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7NFE8 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P21165 0.0 662 70 1 444 1 pepQ Xaa-Pro dipeptidase Escherichia coli (strain K12)
B1IW60 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6V2 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O9:H4 (strain HS)
B1XAK9 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli (strain K12 / DH10B)
C5A021 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli (strain K12 / MC4100 / BW2952)
B7L9A5 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli (strain 55989 / EAEC)
A7ZU52 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1R465 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli (strain UTI89 / UPEC)
B1LM33 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli (strain SMS-3-5 / SECEC)
Q8FBI1 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAK9 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AI34 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O1:K1 / APEC
B7N2F3 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O81 (strain ED1a)
B7MHD2 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UNH5 0.0 662 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q3YVC0 0.0 661 69 1 444 3 pepQ Xaa-Pro dipeptidase Shigella sonnei (strain Ss046)
B7LTY8 0.0 660 69 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q6DAP4 0.0 660 69 1 444 3 pepQ Xaa-Pro dipeptidase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B6I4I7 0.0 660 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli (strain SE11)
B7M650 0.0 660 70 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O8 (strain IAI1)
Q0SZ37 0.0 659 69 1 444 3 pepQ Xaa-Pro dipeptidase Shigella flexneri serotype 5b (strain 8401)
Q32A22 0.0 659 69 1 444 3 pepQ Xaa-Pro dipeptidase Shigella dysenteriae serotype 1 (strain Sd197)
C6DI64 0.0 659 68 1 444 3 pepQ Xaa-Pro dipeptidase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q31UE2 0.0 658 69 1 444 3 pepQ Xaa-Pro dipeptidase Shigella boydii serotype 4 (strain Sb227)
B2TVJ6 0.0 658 69 1 444 3 pepQ Xaa-Pro dipeptidase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YY94 0.0 658 69 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X8I1 0.0 658 69 1 444 3 pepQ Xaa-Pro dipeptidase Escherichia coli O157:H7
Q83PG0 0.0 657 69 1 444 3 pepQ Xaa-Pro dipeptidase Shigella flexneri
Q7CPD4 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9L6L4 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella typhi
B4TNZ2 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella schwarzengrund (strain CVM19633)
B5BIZ1 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella paratyphi A (strain AKU_12601)
C0Q3F4 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella paratyphi C (strain RKS4594)
Q5PKQ1 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZ86 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella newport (strain SL254)
B4TBS6 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella heidelberg (strain SL476)
B5RFL5 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QW86 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella enteritidis PT4 (strain P125109)
B5FNX9 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella dublin (strain CT_02021853)
Q57HM5 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella choleraesuis (strain SC-B67)
B5EZW1 0.0 656 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella agona (strain SL483)
A9MIX1 0.0 655 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A9MYB1 0.0 653 68 1 444 3 pepQ Xaa-Pro dipeptidase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B2VFE3 0.0 649 67 1 444 3 pepQ Xaa-Pro dipeptidase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8ACZ6 0.0 649 68 1 444 3 pepQ Xaa-Pro dipeptidase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5XYG9 0.0 647 66 1 444 3 pepQ Xaa-Pro dipeptidase Klebsiella pneumoniae (strain 342)
A6TGM5 0.0 646 67 1 444 3 pepQ Xaa-Pro dipeptidase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MQN9 0.0 645 67 1 444 3 pepQ Xaa-Pro dipeptidase Cronobacter sakazakii (strain ATCC BAA-894)
A4WFX3 0.0 644 66 1 444 3 pepQ Xaa-Pro dipeptidase Enterobacter sp. (strain 638)
Q2NWT2 0.0 627 66 1 443 3 pepQ Xaa-Pro dipeptidase Sodalis glossinidius (strain morsitans)
C5BCB6 0.0 620 64 1 444 3 pepQ Xaa-Pro dipeptidase Edwardsiella ictaluri (strain 93-146)
A0KEL3 5.52e-170 487 52 5 445 3 pepQ Xaa-Pro dipeptidase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4STF0 1.59e-169 486 52 5 445 3 pepQ Xaa-Pro dipeptidase Aeromonas salmonicida (strain A449)
Q3IJ21 2.18e-164 473 52 3 443 3 pepQ Xaa-Pro dipeptidase Pseudoalteromonas translucida (strain TAC 125)
A1S1I9 2.43e-163 470 52 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
P77814 3.95e-160 462 51 3 443 1 pepQ Xaa-Pro dipeptidase Pseudoalteromonas haloplanktis
Q44238 4.91e-159 462 50 3 441 1 pepQ Xaa-Pro dipeptidase Alteromonas sp.
B1KCZ4 2.06e-157 455 49 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella woodyi (strain ATCC 51908 / MS32)
A3Q8U5 5.7e-157 454 49 4 443 3 pepQ Xaa-Pro dipeptidase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q12TB3 1.83e-156 452 49 4 443 3 pepQ Xaa-Pro dipeptidase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A6WHA1 7.46e-156 451 48 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella baltica (strain OS185)
B8E3R4 1.02e-155 451 48 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella baltica (strain OS223)
A8FP64 1.6e-155 450 48 4 443 3 pepQ Xaa-Pro dipeptidase Shewanella sediminis (strain HAW-EB3)
A9KU92 1.82e-155 450 48 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella baltica (strain OS195)
A8GYG1 1.84e-155 450 48 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1RDW7 4.13e-155 449 48 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella sp. (strain W3-18-1)
A4Y1B7 4.13e-155 449 48 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q0I0T2 7.12e-155 449 49 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella sp. (strain MR-7)
A3CYJ5 7.95e-155 449 48 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A0KR51 2.33e-154 447 48 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella sp. (strain ANA-3)
Q0HPB6 4.3e-154 447 48 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella sp. (strain MR-4)
B8CHA2 1.64e-153 445 49 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q8EKR8 9.39e-153 443 47 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0TLC0 1.14e-151 441 48 4 444 3 pepQ Xaa-Pro dipeptidase Shewanella halifaxensis (strain HAW-EB4)
Q08A38 1.59e-150 437 48 5 443 3 pepQ Xaa-Pro dipeptidase Shewanella frigidimarina (strain NCIMB 400)
Q15ZF7 2.6e-149 434 48 4 447 3 pepQ Xaa-Pro dipeptidase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q48AT5 7.96e-146 426 46 4 442 3 pepQ Xaa-Pro dipeptidase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8F8H3 4.54e-138 406 46 4 434 3 pepQ Xaa-Pro dipeptidase Glaesserella parasuis serovar 5 (strain SH0165)
A3MYG3 1.09e-136 402 45 4 435 3 pepQ Xaa-Pro dipeptidase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q8PH57 5.93e-136 400 46 5 441 3 pepQ Xaa-Pro dipeptidase Xanthomonas axonopodis pv. citri (strain 306)
B3GZT0 1.94e-135 399 45 4 435 3 pepQ Xaa-Pro dipeptidase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q3BPR2 1.33e-134 397 45 5 446 3 pepQ Xaa-Pro dipeptidase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5H3T0 3.36e-133 394 45 5 441 3 pepQ Xaa-Pro dipeptidase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P6N8 3.36e-133 394 45 5 441 3 pepQ Xaa-Pro dipeptidase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B0RP90 3.49e-131 388 45 5 441 3 pepQ Xaa-Pro dipeptidase Xanthomonas campestris pv. campestris (strain B100)
Q8P5S9 1.51e-130 387 45 5 441 3 pepQ Xaa-Pro dipeptidase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UY33 1.51e-130 387 45 5 441 3 pepQ Xaa-Pro dipeptidase Xanthomonas campestris pv. campestris (strain 8004)
B4SI11 1.82e-125 374 43 4 438 3 pepQ Xaa-Pro dipeptidase Stenotrophomonas maltophilia (strain R551-3)
B2FT23 1.84e-124 371 42 4 438 3 pepQ Xaa-Pro dipeptidase Stenotrophomonas maltophilia (strain K279a)
Q5QXH5 2.2e-117 353 41 4 437 3 pepQ1 Xaa-Pro dipeptidase 1 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5QVP2 6.95e-111 336 39 6 436 3 pepQ2 Xaa-Pro dipeptidase 2 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1TXT7 2.02e-98 304 40 4 430 3 pepQ Xaa-Pro dipeptidase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2S6U2 3.02e-84 268 36 6 436 3 pepQ Xaa-Pro dipeptidase Hahella chejuensis (strain KCTC 2396)
A1D1S6 9.33e-46 168 29 13 447 3 NFIA_010500 Probable Xaa-Pro aminopeptidase NFIA_010500 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q4WRV9 1.41e-44 165 30 13 441 3 AFUA_1G14920 Probable Xaa-Pro aminopeptidase AFUA_1G14920 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0XN37 1.41e-44 165 30 13 441 3 AFUB_014460 Probable Xaa-Pro aminopeptidase AFUB_014460 Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
A1CNW6 2.91e-43 161 29 12 443 3 ACLA_020440 Probable Xaa-Pro aminopeptidase ACLA_020440 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q0U6G5 3.45e-43 160 29 14 409 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
E4ZHV7 4.24e-42 159 30 15 410 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
A2QAW7 3.87e-41 155 30 14 442 3 An01g13040 Probable Xaa-Pro aminopeptidase An01g13040 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
E3S6N7 1.2e-40 154 27 10 405 3 pepP Probable Xaa-Pro aminopeptidase pepP Pyrenophora teres f. teres (strain 0-1)
C5PAH2 8.88e-40 152 32 6 291 3 CPC735_009100 Probable Xaa-Pro aminopeptidase CPC735_009100 Coccidioides posadasii (strain C735)
E9CY14 1.61e-39 151 31 6 291 3 CPSG_02684 Probable Xaa-Pro aminopeptidase CPSG_02684 Coccidioides posadasii (strain RMSCC 757 / Silveira)
B2WMQ2 2.42e-39 150 27 10 405 3 pepP Probable Xaa-Pro aminopeptidase pepP Pyrenophora tritici-repentis (strain Pt-1C-BFP)
C7Z837 3.2e-39 150 28 12 432 3 NECHADRAFT_60613 Probable Xaa-Pro aminopeptidase NECHADRAFT_60613 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C5GKT2 1.44e-38 149 26 14 457 3 BDCG_04966 Probable Xaa-Pro aminopeptidase BDCG_04966 Ajellomyces dermatitidis (strain ER-3 / ATCC MYA-2586)
C5K0R2 3.24e-38 148 26 14 457 3 BDBG_08406 Probable Xaa-Pro aminopeptidase BDBG_08406 Blastomyces gilchristii (strain SLH14081)
C5JQ04 5.49e-38 147 31 7 290 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Blastomyces gilchristii (strain SLH14081)
C5G874 5.49e-38 147 31 7 290 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Ajellomyces dermatitidis (strain ER-3 / ATCC MYA-2586)
C4JF09 6.62e-38 147 32 7 288 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Uncinocarpus reesii (strain UAMH 1704)
C4JY72 8.67e-38 145 31 6 290 3 UREG_07123 Probable Xaa-Pro aminopeptidase UREG_07123 Uncinocarpus reesii (strain UAMH 1704)
A1CSI0 2.34e-37 145 26 16 467 3 pepP Probable Xaa-Pro aminopeptidase pepP Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A2QKF6 2.98e-37 144 33 7 290 3 pepP Probable Xaa-Pro aminopeptidase pepP Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
C7YVN8 4.8e-37 144 27 15 417 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
B6Q8T5 6.36e-37 144 32 8 290 3 pepP Probable Xaa-Pro aminopeptidase pepP Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
Q5BF48 1.77e-36 142 32 7 286 3 AN0832 Probable Xaa-Pro aminopeptidase AN0832 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5I0D7 2.38e-36 142 27 16 465 2 Pepd Xaa-Pro dipeptidase Rattus norvegicus
Q11136 2.75e-36 142 26 15 465 1 Pepd Xaa-Pro dipeptidase Mus musculus
B8M0Z4 5.74e-36 141 31 6 288 3 pepP Probable Xaa-Pro aminopeptidase pepP Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
B8MZI5 5.94e-36 141 33 5 290 3 AFLA_084750 Probable Xaa-Pro aminopeptidase AFLA_084750 Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
P12955 6.1e-36 141 27 16 466 1 PEPD Xaa-Pro dipeptidase Homo sapiens
Q2UQH9 6.65e-36 141 33 5 290 3 AO090005001240 Probable Xaa-Pro aminopeptidase AO090005001240 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
C1H9Q9 8.83e-36 140 27 16 458 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Paracoccidioides lutzii (strain ATCC MYA-826 / Pb01)
A1DG66 1.46e-35 140 27 16 463 3 pepP Probable Xaa-Pro aminopeptidase pepP Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
C6H7R7 1.57e-35 140 32 9 290 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Ajellomyces capsulatus (strain H143)
C0NIF0 2.05e-35 139 32 9 290 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Ajellomyces capsulatus (strain G186AR / H82 / ATCC MYA-2454 / RMSCC 2432)
Q96WX8 2.86e-35 139 31 9 310 3 pepP Probable Xaa-Pro aminopeptidase pepP Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4X267 4.92e-35 138 27 14 461 3 pepP Probable Xaa-Pro aminopeptidase pepP Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0XW47 4.92e-35 138 27 14 461 3 pepP Probable Xaa-Pro aminopeptidase pepP Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
B6QAW7 7.4e-35 136 31 6 298 3 PMAA_074180 Probable Xaa-Pro aminopeptidase PMAA_074180 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
A6SDE9 9.11e-35 137 27 15 414 3 pepP Probable Xaa-Pro aminopeptidase pepP Botryotinia fuckeliana (strain B05.10)
B8M2W9 1.67e-34 137 28 17 461 3 TSTA_094700 Probable Xaa-Pro aminopeptidase TSTA_094700 Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A4RAE9 2.52e-34 136 25 16 447 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
C1GD57 2.62e-34 136 31 8 290 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Paracoccidioides brasiliensis (strain Pb18)
D5GHP2 3.63e-34 136 31 8 289 3 GSTUM_00008071001 Probable Xaa-Pro aminopeptidase GSTUM_00008071001 Tuber melanosporum (strain Mel28)
Q55E60 4.48e-34 136 25 17 472 1 pepd Xaa-Pro dipeptidase Dictyostelium discoideum
Q5RFB3 5.69e-34 136 26 15 463 2 PEPD Xaa-Pro dipeptidase Pongo abelii
B8NC10 7.14e-34 135 31 8 288 3 pepP Probable Xaa-Pro aminopeptidase pepP Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q0CZM6 9.02e-34 135 31 6 287 3 ATEG_00858 Probable Xaa-Pro aminopeptidase ATEG_00858 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
C0SHQ0 9.09e-34 135 31 8 290 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Paracoccidioides brasiliensis (strain Pb03)
C5PHM7 1.09e-33 135 30 6 287 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Coccidioides posadasii (strain C735)
A7EUB3 1.17e-33 135 26 14 426 3 pepP Probable Xaa-Pro aminopeptidase pepP Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
E9DDK8 1.4e-33 134 30 6 287 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Coccidioides posadasii (strain RMSCC 757 / Silveira)
C1H3X3 2.69e-33 134 31 8 292 3 PAAG_05466 Probable Xaa-Pro aminopeptidase PAAG_05466 Paracoccidioides lutzii (strain ATCC MYA-826 / Pb01)
C0SDW6 2.74e-33 134 30 7 292 3 PABG_05921 Probable Xaa-Pro aminopeptidase PABG_05921 Paracoccidioides brasiliensis (strain Pb03)
C1GHS9 2.74e-33 134 30 7 292 3 PADG_06815 Probable Xaa-Pro aminopeptidase PADG_06815 Paracoccidioides brasiliensis (strain Pb18)
B6HAN0 3.14e-33 134 33 9 296 3 Pc16g13390 Probable Xaa-Pro aminopeptidase Pc16g13390 Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A6QYF6 8.01e-33 133 31 8 294 3 HCAG_02413 Probable Xaa-Pro aminopeptidase HCAG_02413 Ajellomyces capsulatus (strain NAm1 / WU24)
C0NF18 1.05e-32 132 31 8 306 3 HCBG_01484 Probable Xaa-Pro aminopeptidase HCBG_01484 Ajellomyces capsulatus (strain G186AR / H82 / ATCC MYA-2454 / RMSCC 2432)
C6HNY5 1.75e-32 132 31 8 308 3 HCDG_07916 Probable Xaa-Pro aminopeptidase HCDG_07916 Ajellomyces capsulatus (strain H143)
B6H2M0 1.9e-32 131 27 17 447 3 pepP Probable Xaa-Pro aminopeptidase pepP Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B2AFW1 2.33e-32 131 30 8 285 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q0CFZ0 2.4e-32 131 32 8 290 3 pepP Probable Xaa-Pro aminopeptidase pepP Aspergillus terreus (strain NIH 2624 / FGSC A1156)
D1ZQL9 1.05e-31 129 30 8 300 3 SMAC_04549 Probable Xaa-Pro aminopeptidase SMAC_04549 Sordaria macrospora (strain ATCC MYA-333 / DSM 997 / K(L3346) / K-hell)
E9EK74 2.01e-31 128 25 13 440 3 pepP Probable Xaa-Pro aminopeptidase pepP Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A7UWH7 2.46e-31 128 29 8 303 3 NCU11288 Probable Xaa-Pro aminopeptidase NCU11288 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
E9DV56 5.77e-31 127 25 13 440 3 pepP Probable Xaa-Pro aminopeptidase pepP Metarhizium acridum (strain CQMa 102)
P43590 1.37e-30 127 31 8 290 1 YFR006W Uncharacterized peptidase YFR006W Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
E3QYP0 1.92e-30 125 30 7 285 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Colletotrichum graminicola (strain M1.001 / M2 / FGSC 10212)
Q0V147 2.72e-30 127 31 7 287 3 SNOG_02267 Probable Xaa-Pro aminopeptidase SNOG_02267 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
E9E2J4 6.05e-30 125 30 10 311 3 MAC_04092 Probable Xaa-Pro aminopeptidase MAC_04092 Metarhizium acridum (strain CQMa 102)
A6SL16 9.26e-30 125 29 8 303 3 BC1G_13431 Probable Xaa-Pro aminopeptidase BC1G_13431 Botryotinia fuckeliana (strain B05.10)
A7ENP9 1.52e-29 124 28 7 305 3 SS1G_06948 Probable Xaa-Pro aminopeptidase SS1G_06948 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
E3RNJ5 2.17e-29 125 27 21 461 3 PTT_10145 Probable Xaa-Pro aminopeptidase PTT_10145 Pyrenophora teres f. teres (strain 0-1)
B2WKR4 3.38e-29 124 27 19 447 3 PTRG_10574 Probable Xaa-Pro aminopeptidase PTRG_10574 Pyrenophora tritici-repentis (strain Pt-1C-BFP)
C9SDK8 7.12e-28 118 30 9 284 3 VDBG_02538 Probable Xaa-Pro aminopeptidase VDBG_02538 Verticillium alfalfae (strain VaMs.102 / ATCC MYA-4576 / FGSC 10136)
E3Q897 3.41e-27 117 27 12 345 3 GLRG_02280 Probable Xaa-Pro aminopeptidase GLRG_02280 Colletotrichum graminicola (strain M1.001 / M2 / FGSC 10212)
E9F9J8 6.74e-27 116 26 17 473 3 MAA_08947 Probable Xaa-Pro aminopeptidase MAA_08947 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
C9SEV5 3.15e-26 114 29 8 306 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Verticillium alfalfae (strain VaMs.102 / ATCC MYA-4576 / FGSC 10136)
E4V1Q7 1.69e-24 108 29 14 313 3 MGYG_06974 Probable Xaa-Pro aminopeptidase MGYG_06974 Arthroderma gypseum (strain ATCC MYA-4604 / CBS 118893)
P15034 1.73e-24 108 30 10 304 1 pepP Xaa-Pro aminopeptidase Escherichia coli (strain K12)
D4B0B2 2.38e-24 108 28 11 311 3 ARB_01886 Probable Xaa-Pro aminopeptidase ARB_01886 Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
D4D6B8 2.47e-24 108 28 11 311 3 TRV_02643 Probable Xaa-Pro aminopeptidase TRV_02643 Trichophyton verrucosum (strain HKI 0517)
A4RQ11 3.21e-24 108 27 11 312 3 MGG_05684 Probable Xaa-Pro aminopeptidase MGG_05684 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
B2AW39 1.55e-21 100 26 9 333 3 Pa_7_5850 Probable Xaa-Pro aminopeptidase PODANS_7_5850 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q2HA12 2.87e-21 100 35 7 201 3 CHGG_02942 Probable Xaa-Pro aminopeptidase CHGG_02942 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
P44881 8.44e-21 97 26 19 438 3 pepP Xaa-Pro aminopeptidase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A3Z2 1.16e-20 97 27 10 292 1 pepPI Xaa-Pro aminopeptidase 1 Streptomyces lividans
P0A3Z1 1.16e-20 97 27 10 292 3 pepPI Xaa-Pro aminopeptidase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
D1ZBF6 1.52e-20 97 25 22 485 3 PEPP Probable Xaa-Pro aminopeptidase PEPP Sordaria macrospora (strain ATCC MYA-333 / DSM 997 / K(L3346) / K-hell)
C5FUV0 4.08e-20 95 29 10 274 3 MCYG_06503 Probable Xaa-Pro aminopeptidase MCYG_06503 Arthroderma otae (strain ATCC MYA-4605 / CBS 113480)
P0A3Z4 1.52e-19 94 26 19 445 3 pepP2 Xaa-Pro aminopeptidase 2 Streptomyces lividans
P0A3Z3 1.52e-19 94 26 19 445 3 pepP2 Xaa-Pro aminopeptidase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q10439 1.48e-14 79 26 11 282 3 icp55 Intermediate cleaving peptidase 55 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P40051 2.15e-13 75 27 9 291 1 ICP55 Intermediate cleaving peptidase 55 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
F4HZG9 9.38e-13 73 26 9 291 1 ICP55 Intermediate cleaving peptidase 55, mitochondrial Arabidopsis thaliana
B5DEQ3 2.33e-12 72 25 11 271 1 Xpnpep3 Xaa-Pro aminopeptidase 3 Rattus norvegicus
B7ZMP1 4.23e-12 71 26 11 271 1 Xpnpep3 Xaa-Pro aminopeptidase 3 Mus musculus
Q54T46 1.17e-11 70 29 8 222 2 xpnpep3 Xaa-Pro aminopeptidase 3 Dictyostelium discoideum
P54518 2.78e-11 68 24 8 282 3 yqhT Uncharacterized peptidase YqhT Bacillus subtilis (strain 168)
Q9NQH7 5.09e-11 68 25 11 271 1 XPNPEP3 Xaa-Pro aminopeptidase 3 Homo sapiens
Q5R9W8 6.4e-11 67 23 10 313 2 XPNPEP3 Xaa-Pro aminopeptidase 3 Pongo abelii
P46545 4.28e-10 64 25 7 244 3 pepQ Xaa-Pro dipeptidase Lactobacillus delbrueckii subsp. lactis
Q9S6S1 5.27e-10 64 25 7 244 1 pepQ Xaa-Pro dipeptidase Lactobacillus delbrueckii subsp. bulgaricus
Q4L749 3.39e-09 62 24 8 286 3 SH1217 Uncharacterized peptidase SH1217 Staphylococcus haemolyticus (strain JCSC1435)
O58885 2.58e-08 59 23 8 293 1 pepQ Xaa-Pro dipeptidase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P81535 6.58e-08 57 22 7 292 1 pepQ Xaa-Pro dipeptidase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q2FXL9 7.36e-08 57 24 9 286 3 SAOUHSC_01816 Uncharacterized peptidase SAOUHSC_01816 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5HF67 7.36e-08 57 24 9 286 3 SACOL1756 Uncharacterized peptidase SACOL1756 Staphylococcus aureus (strain COL)
Q2FG30 7.36e-08 57 24 9 286 3 SAUSA300_1654 Uncharacterized peptidase SAUSA300_1654 Staphylococcus aureus (strain USA300)
Q8NW55 8.49e-08 57 24 9 286 3 MW1651 Uncharacterized peptidase MW1651 Staphylococcus aureus (strain MW2)
Q99TF5 1.11e-07 57 24 10 286 3 SAV1708 Uncharacterized peptidase SAV1708 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6G8L9 1.11e-07 57 24 10 286 3 SAS1635 Uncharacterized peptidase SAS1635 Staphylococcus aureus (strain MSSA476)
Q7A552 1.11e-07 57 24 10 286 1 SA1530 Uncharacterized peptidase SA1530 Staphylococcus aureus (strain N315)
Q6GFZ9 2.04e-07 56 24 9 286 3 SAR1786 Uncharacterized peptidase SAR1786 Staphylococcus aureus (strain MRSA252)
O25681 3.12e-07 55 24 9 238 1 HP_1037 Aminopeptidase HP_1037 Helicobacter pylori (strain ATCC 700392 / 26695)
Q2YTD2 3.49e-07 55 24 10 286 3 SAB1567 Uncharacterized peptidase SAB1567 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8CNW9 3.58e-07 55 26 9 233 3 SE_1383 Uncharacterized peptidase SE_1383 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNJ7 3.58e-07 55 26 9 233 3 SERP1271 Uncharacterized peptidase SERP1271 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O31689 4.97e-07 55 23 10 285 3 ykvY Putative dipeptidase YkvY Bacillus subtilis (strain 168)
Q49YD7 6.37e-07 54 23 9 282 3 SSP1059 Uncharacterized peptidase SSP1059 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P76524 8.2e-06 51 23 10 300 1 ypdF Aminopeptidase YpdF Escherichia coli (strain K12)
P9WHS7 6.8e-05 48 24 13 304 1 pepE Probable dipeptidase PepE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHS6 6.8e-05 48 24 13 304 3 pepE Probable dipeptidase PepE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65811 6.8e-05 48 24 13 304 3 pepE Probable dipeptidase PepE Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P47566 0.000108 47 25 9 216 3 pepP Putative Xaa-Pro aminopeptidase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS18350
Feature type CDS
Gene pepQ
Product Xaa-Pro dipeptidase
Location 2932 - 4266 (strand: -1)
Length 1335 (nucleotides) / 444 (amino acids)

Contig

Accession term accessions NZ_VXKB01000009 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 74461 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2205
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00557 Metallopeptidase family M24
PF21216 Xaa-Pro dipeptidase, N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0006 Amino acid transport and metabolism (E) E Xaa-Pro aminopeptidase

Protein Sequence

MEKPASLYREHIATLLQRTRDILAREKLDSLLIHSGEPLRIFLDDRDYPFKSNVHFKAWVPVTDVPHCWLWTDGVNKPKVWFYSPVDYWHSVEALPSSFWTNDVEIIHLKNAGDIAEHLVSLNKTHTAYIGPNIERAASLGINDNNINPKAVLDYFAFHRSYKTDYELACMREAQKMAVNGHQAAHEAFLSDLSEFDINMAYLMATGHRDTDVPYDNIVAINENAAVLHYTKLNKSPPRERRSFLIDAGAEYHGYAADLTRTYAAKADSDFAQLVHDLNNEQQGLIGNIKAGVRYTDYHVQMHHRIAKLLKKHKIINGMSEEAMVSEGVTTPFLPHGLGHPLGLQVHDAAGFMQNDQGEHLAAPQMYPFLRCTRILEPRMVLTIEPGLYFIESLLAPWRESAFSQHFDWKRIEMFKPYGGIRIEDNIIIHNNSVENMTRDLNLS

Flanking regions ( +/- flanking 50bp)

AGATCATGCTAAGCTTTTATCACTATCATAATGAAAAAAGGTCATTTCCCATGGAAAAACCAGCATCTCTTTACCGTGAGCACATCGCAACTCTGTTACAACGTACGCGGGATATTCTTGCGCGTGAGAAACTGGATTCGTTACTGATTCATTCCGGTGAACCACTGAGAATATTTCTTGATGACCGTGATTATCCTTTTAAAAGTAATGTACATTTTAAAGCATGGGTGCCGGTAACGGATGTCCCTCATTGCTGGCTGTGGACGGATGGCGTGAACAAACCAAAAGTATGGTTTTATTCACCTGTTGACTATTGGCATAGTGTTGAAGCATTACCATCATCATTCTGGACAAACGATGTAGAGATCATTCATCTGAAGAATGCCGGAGATATCGCAGAACACCTGGTATCACTGAATAAAACCCATACGGCGTATATCGGACCAAATATTGAGCGTGCGGCATCCCTGGGTATCAATGACAACAATATTAACCCGAAAGCGGTACTGGATTATTTCGCGTTTCACCGTTCATATAAGACAGATTATGAACTGGCTTGTATGCGTGAAGCACAAAAAATGGCAGTGAATGGTCATCAGGCCGCGCACGAGGCGTTCTTATCCGACCTGAGTGAATTTGATATTAATATGGCGTATCTGATGGCAACCGGACATCGTGATACTGATGTTCCTTACGATAATATTGTTGCCATCAATGAAAATGCCGCTGTTTTACATTACACCAAACTGAATAAAAGCCCCCCGCGTGAGCGCCGCAGTTTTTTAATTGATGCCGGTGCGGAATATCATGGTTATGCAGCGGATTTGACCCGTACTTATGCGGCTAAGGCGGATAGTGATTTTGCGCAGTTGGTTCATGACCTTAATAATGAGCAGCAGGGGCTTATCGGTAATATTAAAGCAGGGGTTCGCTATACGGACTACCATGTTCAGATGCATCACCGAATCGCAAAATTACTGAAAAAACACAAGATTATTAACGGAATGTCTGAAGAGGCTATGGTTAGTGAAGGTGTGACAACGCCATTTTTACCTCACGGTTTAGGTCATCCTCTCGGTTTACAGGTACATGATGCCGCCGGATTTATGCAAAATGATCAGGGTGAGCACCTGGCAGCCCCACAGATGTATCCTTTCCTGCGCTGCACCCGTATCCTGGAACCCCGCATGGTATTGACTATTGAACCGGGGCTCTATTTTATTGAATCGTTACTGGCACCGTGGCGGGAAAGTGCATTCAGCCAGCATTTTGACTGGAAGCGTATTGAAATGTTTAAGCCATACGGCGGGATCCGCATTGAAGATAATATTATTATCCATAACAATAGTGTGGAAAATATGACGCGGGATCTGAATCTGTCGTAATGAAATCGTATCTTATCCCGGCTGAGCCGGTCATGTTTACTGAAGAAATA