Homologs in group_2171

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16335 FBDBKF_16335 90.3 Morganella morganii S1 pspE Rhodanese-related sulfurtransferase
EHELCC_16370 EHELCC_16370 90.3 Morganella morganii S2 pspE Rhodanese-related sulfurtransferase
NLDBIP_16970 NLDBIP_16970 90.3 Morganella morganii S4 pspE Rhodanese-related sulfurtransferase
LHKJJB_16890 LHKJJB_16890 90.3 Morganella morganii S3 pspE Rhodanese-related sulfurtransferase
HKOGLL_16950 HKOGLL_16950 90.3 Morganella morganii S5 pspE Rhodanese-related sulfurtransferase
PMI_RS15735 PMI_RS15735 66.2 Proteus mirabilis HI4320 - rhodanese-like domain-containing protein

Distribution of the homologs in the orthogroup group_2171

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2171

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AG27 1.58e-62 191 60 0 143 1 yibN Uncharacterized protein YibN Escherichia coli (strain K12)
P0AG28 1.58e-62 191 60 0 143 3 yibN Uncharacterized protein YibN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AG29 1.58e-62 191 60 0 143 3 yibN Uncharacterized protein YibN Escherichia coli O157:H7
P44854 2.56e-42 140 47 0 138 4 HI_0744 Uncharacterized protein HI_0744 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P57160 1.59e-30 110 35 0 139 4 BU052 Uncharacterized protein BU052 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8KA58 3.66e-20 84 32 1 143 4 BUsg_049 Uncharacterized protein BUsg_049 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89B12 1.12e-16 74 26 3 142 4 bbp_050 Uncharacterized protein bbp_050 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q3IHW1 3.11e-08 51 28 1 95 3 glpE Thiosulfate sulfurtransferase GlpE Pseudoalteromonas translucida (strain TAC 125)
B0BRY5 6.44e-08 50 32 3 103 3 glpE Thiosulfate sulfurtransferase GlpE Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZR9 6.65e-08 50 32 3 103 3 glpE Thiosulfate sulfurtransferase GlpE Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q6T893 1.06e-07 50 32 3 103 3 glpE Thiosulfate sulfurtransferase GlpE Actinobacillus pleuropneumoniae
A3MYF1 1.06e-07 50 32 3 103 3 glpE Thiosulfate sulfurtransferase GlpE Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q83DV5 1.45e-07 50 26 3 109 3 glpE Thiosulfate sulfurtransferase GlpE Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NC75 1.45e-07 50 26 3 109 3 glpE Thiosulfate sulfurtransferase GlpE Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J185 1.45e-07 50 26 3 109 3 glpE Thiosulfate sulfurtransferase GlpE Coxiella burnetii (strain CbuG_Q212)
B6J836 1.45e-07 50 26 3 109 3 glpE Thiosulfate sulfurtransferase GlpE Coxiella burnetii (strain CbuK_Q154)
Q7MQ91 2.28e-07 49 29 2 107 3 glpE Thiosulfate sulfurtransferase GlpE Vibrio vulnificus (strain YJ016)
Q8DD53 2.28e-07 49 29 2 107 3 glpE Thiosulfate sulfurtransferase GlpE Vibrio vulnificus (strain CMCP6)
Q5E203 2.84e-07 49 30 2 88 3 glpE Thiosulfate sulfurtransferase GlpE Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FCB8 3.03e-07 49 30 2 88 3 glpE Thiosulfate sulfurtransferase GlpE Aliivibrio fischeri (strain MJ11)
B8F6J5 3.36e-07 49 29 3 105 3 glpE Thiosulfate sulfurtransferase GlpE Glaesserella parasuis serovar 5 (strain SH0165)
Q9CL12 8.12e-07 48 24 1 107 3 glpE Thiosulfate sulfurtransferase GlpE Pasteurella multocida (strain Pm70)
C3LPU2 9.91e-07 47 25 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Vibrio cholerae serotype O1 (strain M66-2)
Q9KVP1 9.91e-07 47 25 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4G9 9.91e-07 47 25 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A7MXX7 1.26e-06 47 27 2 107 3 glpE Thiosulfate sulfurtransferase GlpE Vibrio campbellii (strain ATCC BAA-1116)
B6ENU6 1.43e-06 47 31 2 88 3 glpE Thiosulfate sulfurtransferase GlpE Aliivibrio salmonicida (strain LFI1238)
Q8E8J2 2.35e-06 46 25 2 98 3 glpE Thiosulfate sulfurtransferase GlpE Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7N9W3 5.19e-06 46 25 2 102 3 glpE Thiosulfate sulfurtransferase GlpE Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q87KM5 8.72e-06 45 27 2 107 3 glpE Thiosulfate sulfurtransferase GlpE Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q15ZU3 1.03e-05 45 31 2 87 3 glpE Thiosulfate sulfurtransferase GlpE Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B0KJ90 4.07e-05 43 30 1 98 3 glpE Thiosulfate sulfurtransferase GlpE Pseudomonas putida (strain GB-1)
Q6LVT0 7.73e-05 42 28 3 107 3 glpE Thiosulfate sulfurtransferase GlpE Photobacterium profundum (strain SS9)
Q3YWA3 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Shigella sonnei (strain Ss046)
P0A6V7 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Shigella flexneri
Q0SZP1 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Shigella flexneri serotype 5b (strain 8401)
B7LSC7 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I2Y8 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli (strain SE11)
B7NE29 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A6V5 0.000136 42 23 2 101 1 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli (strain K12)
P0A6V6 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A5N3 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli O9:H4 (strain HS)
B1X770 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli (strain K12 / DH10B)
C4ZVX6 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli (strain K12 / MC4100 / BW2952)
B7L4V4 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli (strain 55989 / EAEC)
A7ZSV5 0.000136 42 23 2 101 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31VK8 0.000162 42 25 2 88 3 glpE Thiosulfate sulfurtransferase GlpE Shigella boydii serotype 4 (strain Sb227)
B2U3N3 0.000162 42 25 2 88 3 glpE Thiosulfate sulfurtransferase GlpE Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7M2I5 0.000162 42 25 2 88 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli O8 (strain IAI1)
B5YUH7 0.00023 41 24 2 99 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X6Z5 0.00023 41 24 2 99 3 glpE Thiosulfate sulfurtransferase GlpE Escherichia coli O157:H7
Q88QT9 0.000349 41 30 2 102 3 glpE Thiosulfate sulfurtransferase GlpE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VXJ2 0.000349 41 30 2 102 3 glpE Thiosulfate sulfurtransferase GlpE Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
D3RPB9 0.000433 40 27 2 92 1 rhd_2599 Sulfurtransferase Alvin_2599 Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
Q6F8I3 0.000588 42 27 1 85 3 trhO tRNA uridine(34) hydroxylase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6CZL2 0.000671 40 28 1 82 3 glpE Thiosulfate sulfurtransferase GlpE Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B0VSK0 0.000822 41 24 1 94 3 trhO tRNA uridine(34) hydroxylase Acinetobacter baumannii (strain SDF)
B0VEG5 0.00083 41 24 1 94 3 trhO tRNA uridine(34) hydroxylase Acinetobacter baumannii (strain AYE)
C6DH73 0.000836 40 28 1 82 3 glpE Thiosulfate sulfurtransferase GlpE Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q59WH7 0.001 41 24 2 112 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Candida albicans (strain SC5314 / ATCC MYA-2876)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS17245
Feature type CDS
Gene -
Product rhodanese-like domain-containing protein
Location 80187 - 80624 (strand: -1)
Length 438 (nucleotides) / 145 (amino acids)

Contig

Accession term accessions NZ_VXKB01000007 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2171
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00581 Rhodanese-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0607 Inorganic ion transport and metabolism (P) P Rhodanese-related sulfurtransferase

Protein Sequence

MLQEIMPFVSKHPIIALVWVALLVAVILLTFKGMFSKVKIIPRSTAIILINKEEAVVVDTRTRDDFRRGHIIDAVNLTPSEIKDNNLGEVEKHKSRPVILVSANGMDLGKPAESMIKAGFERVFVLKDGLSGWTGDNLPLSRSKK

Flanking regions ( +/- flanking 50bp)

ACTTCTGCCCTTTGATATTTGTTATTAACTAACGGGAGTTATTGTCCCCCATGCTGCAAGAAATTATGCCATTTGTTAGTAAGCACCCGATTATCGCCCTCGTGTGGGTTGCGTTACTGGTTGCTGTTATTTTACTGACCTTCAAAGGAATGTTTTCCAAAGTGAAAATCATTCCCCGCTCCACAGCTATCATACTGATTAATAAAGAAGAAGCGGTTGTTGTGGATACCCGTACCCGGGACGATTTCCGCCGTGGTCACATCATTGATGCGGTGAATCTGACTCCGTCAGAAATTAAAGACAATAATCTCGGCGAAGTGGAAAAACACAAAAGCCGTCCGGTTATTCTGGTTTCTGCCAATGGTATGGACCTGGGTAAACCGGCAGAAAGCATGATTAAAGCCGGGTTTGAACGTGTGTTTGTGCTGAAAGACGGCCTCTCCGGCTGGACCGGTGATAACTTACCGCTTTCCCGCAGTAAAAAGTAACCCGGCAAAGGACGTTTGAATTAACACCCTTTGTAACTCAAACTATTTAT