Homologs in group_1816

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12965 FBDBKF_12965 87.6 Morganella morganii S1 tesA multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1
EHELCC_06280 EHELCC_06280 87.6 Morganella morganii S2 tesA multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1
NLDBIP_06600 NLDBIP_06600 87.6 Morganella morganii S4 tesA multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1
LHKJJB_03480 LHKJJB_03480 87.6 Morganella morganii S3 tesA multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1
HKOGLL_06955 HKOGLL_06955 87.6 Morganella morganii S5 tesA multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1
PMI_RS10680 PMI_RS10680 63.3 Proteus mirabilis HI4320 tesA multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1

Distribution of the homologs in the orthogroup group_1816

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1816

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ADA1 3.29e-85 253 58 1 208 1 tesA Thioesterase 1/protease 1/lysophospholipase L1 Escherichia coli (strain K12)
P0ADA2 3.29e-85 253 58 1 208 3 tesA Thioesterase 1/protease 1/lysophospholipase L1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q07792 1.89e-66 206 48 0 198 1 None Arylesterase Vibrio mimicus
Q9HZY8 1.2e-49 163 46 1 195 1 tesA Esterase TesA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6GDN2 3.07e-05 47 27 5 141 3 oatA O-acetyltransferase OatA Staphylococcus aureus (strain MRSA252)
Q79ZY2 3.12e-05 47 27 5 141 3 oatA O-acetyltransferase OatA Staphylococcus aureus (strain MW2)
Q6G6A7 3.12e-05 47 27 5 141 3 oatA O-acetyltransferase OatA Staphylococcus aureus (strain MSSA476)
Q7A3D6 3.12e-05 47 27 5 141 1 oatA O-acetyltransferase OatA Staphylococcus aureus (strain N315)
Q99R71 3.12e-05 47 27 5 141 3 oatA O-acetyltransferase OatA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HCY3 3.12e-05 47 27 5 141 3 oatA O-acetyltransferase OatA Staphylococcus aureus (strain COL)
Q2FV54 3.12e-05 47 27 5 141 1 oatA O-acetyltransferase OatA Staphylococcus aureus (strain NCTC 8325 / PS 47)
P54451 8.33e-05 45 29 10 161 3 yqeF Uncharacterized lipoprotein YqeF Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16150
Feature type CDS
Gene tesA
Product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1
Location 33801 - 34427 (strand: 1)
Length 627 (nucleotides) / 208 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000006
Length 212134 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1816
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF13472 GDSL-like Lipase/Acylhydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2755 Cell cycle control, cell division, chromosome partitioning (D)
Lipid transport and metabolism (I)
DI Lysophospholipase L1 or related esterase. Includes spore coat protein LipC/YcsK

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K10804 acyl-CoA thioesterase I [EC:3.1.2.- 3.1.2.2 3.1.1.2 3.1.1.5] Biosynthesis of unsaturated fatty acids -

Protein Sequence

MMNFKNTLQRHLCFLFLLLFSGNVFAAGTLLILGDSLSAGYRLPAEQAWATQLGQRWQQAGNGITLINGSISGNTAAQGLARLPALLEQHKPQWVLIELGANDGLRGLPVAQTRDDLQTIINTVNASGAKPLLMQIRIPPNYGKRYTERFSAIYPALAADNAIPLIPFYMEAVVTNPQWIQDDGIHPNETAQPYITDWMDKTLLPYLH

Flanking regions ( +/- flanking 50bp)

CCCTGCAATATAGTGATCTCATTTTCATCCTGACCGACGCGCTTAATAAGATGATGAACTTCAAGAATACGCTCCAACGCCATCTCTGTTTCCTTTTTCTGCTGCTGTTCAGCGGGAATGTCTTTGCCGCCGGAACGTTACTGATTCTGGGTGACAGCCTGAGTGCCGGTTATCGTCTGCCCGCCGAACAGGCGTGGGCGACACAACTGGGGCAACGCTGGCAACAGGCCGGGAACGGCATCACACTGATAAACGGCAGTATCAGCGGCAATACCGCCGCACAGGGGCTTGCCCGCCTGCCCGCACTGCTGGAACAACACAAGCCGCAATGGGTATTGATTGAACTGGGTGCCAACGACGGTCTGCGCGGTCTGCCGGTCGCACAAACCCGTGACGACCTTCAGACCATTATTAATACTGTAAATGCCTCCGGGGCGAAACCGTTACTGATGCAGATCCGCATCCCGCCGAATTATGGCAAGCGCTACACCGAGCGGTTTTCGGCGATTTATCCGGCACTTGCCGCGGACAATGCCATCCCGCTTATCCCGTTTTATATGGAAGCCGTCGTGACAAATCCACAATGGATACAGGATGACGGCATACACCCGAATGAAACGGCGCAGCCCTATATTACAGACTGGATGGATAAAACATTACTGCCTTATTTACACTAGGGTTGCCGGATTATCCTAAATGATTTGTTTAGAGTATATAAGCAGTTAAG