Homologs in group_1135

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06495 FBDBKF_06495 96.2 Morganella morganii S1 dnaK molecular chaperone DnaK
EHELCC_09540 EHELCC_09540 96.2 Morganella morganii S2 dnaK molecular chaperone DnaK
NLDBIP_09920 NLDBIP_09920 96.2 Morganella morganii S4 dnaK molecular chaperone DnaK
LHKJJB_07835 LHKJJB_07835 96.2 Morganella morganii S3 dnaK molecular chaperone DnaK
HKOGLL_07385 HKOGLL_07385 96.2 Morganella morganii S5 dnaK molecular chaperone DnaK
PMI_RS00045 PMI_RS00045 89.0 Proteus mirabilis HI4320 dnaK molecular chaperone DnaK

Distribution of the homologs in the orthogroup group_1135

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1135

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A1JJD5 0 1135 87 1 637 3 dnaK Chaperone protein DnaK Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B4F2V5 0 1135 88 2 642 3 dnaK Chaperone protein DnaK Proteus mirabilis (strain HI4320)
Q7N8Y4 0 1130 88 1 637 3 dnaK Chaperone protein DnaK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8Z9R1 0 1125 86 1 638 3 dnaK Chaperone protein DnaK Salmonella typhi
B4TVZ5 0 1125 86 1 638 3 dnaK Chaperone protein DnaK Salmonella schwarzengrund (strain CVM19633)
B5BLH8 0 1125 86 1 638 3 dnaK Chaperone protein DnaK Salmonella paratyphi A (strain AKU_12601)
Q5PDJ5 0 1125 86 1 638 3 dnaK Chaperone protein DnaK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TIB4 0 1125 86 1 638 3 dnaK Chaperone protein DnaK Salmonella heidelberg (strain SL476)
B5F6Y8 0 1125 86 1 638 3 dnaK Chaperone protein DnaK Salmonella agona (strain SL483)
A7MIK5 0 1125 87 1 638 3 dnaK Chaperone protein DnaK Cronobacter sakazakii (strain ATCC BAA-894)
A8ALU3 0 1125 87 1 638 3 dnaK Chaperone protein DnaK Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q56073 0 1124 86 1 638 3 dnaK Chaperone protein DnaK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0Q4F3 0 1124 86 1 638 3 dnaK Chaperone protein DnaK Salmonella paratyphi C (strain RKS4594)
A9MXI2 0 1124 86 1 638 3 dnaK Chaperone protein DnaK Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T6D6 0 1124 86 1 638 3 dnaK Chaperone protein DnaK Salmonella newport (strain SL254)
B5RF08 0 1124 86 1 638 3 dnaK Chaperone protein DnaK Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FHA6 0 1124 86 1 638 3 dnaK Chaperone protein DnaK Salmonella dublin (strain CT_02021853)
B5R5I2 0 1122 86 1 638 3 dnaK Chaperone protein DnaK Salmonella enteritidis PT4 (strain P125109)
A9MR77 0 1122 86 1 638 3 dnaK Chaperone protein DnaK Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q57TP3 0 1122 86 1 638 3 dnaK Chaperone protein DnaK Salmonella choleraesuis (strain SC-B67)
B1JL04 0 1120 87 1 637 3 dnaK Chaperone protein DnaK Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66ET0 0 1120 87 1 637 3 dnaK Chaperone protein DnaK Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TQF9 0 1120 87 1 637 3 dnaK Chaperone protein DnaK Yersinia pestis (strain Pestoides F)
Q1CMV7 0 1120 87 1 637 3 dnaK Chaperone protein DnaK Yersinia pestis bv. Antiqua (strain Nepal516)
A9R015 0 1120 87 1 637 3 dnaK Chaperone protein DnaK Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIM7 0 1120 87 1 637 3 dnaK Chaperone protein DnaK Yersinia pestis
B2K3M0 0 1120 87 1 637 3 dnaK Chaperone protein DnaK Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0J9 0 1120 87 1 637 3 dnaK Chaperone protein DnaK Yersinia pestis bv. Antiqua (strain Antiqua)
A8G9K8 0 1119 87 0 637 3 dnaK Chaperone protein DnaK Serratia proteamaculans (strain 568)
A6T4F4 0 1118 86 1 638 3 dnaK Chaperone protein DnaK Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7FME3 0 1117 87 1 637 3 dnaK Chaperone protein DnaK Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5Y242 0 1117 86 1 638 3 dnaK Chaperone protein DnaK Klebsiella pneumoniae (strain 342)
A4W6D5 0 1116 87 1 640 3 dnaK Chaperone protein DnaK Enterobacter sp. (strain 638)
C5B7L7 0 1115 88 1 637 3 dnaK Chaperone protein DnaK Edwardsiella ictaluri (strain 93-146)
Q3Z601 0 1115 86 1 638 3 dnaK Chaperone protein DnaK Shigella sonnei (strain Ss046)
Q32KA5 0 1115 86 1 638 3 dnaK Chaperone protein DnaK Shigella dysenteriae serotype 1 (strain Sd197)
Q326K7 0 1115 86 1 638 3 dnaK Chaperone protein DnaK Shigella boydii serotype 4 (strain Sb227)
Q1RGI8 0 1115 86 1 638 3 dnaK Chaperone protein DnaK Escherichia coli (strain UTI89 / UPEC)
P0A6Y8 0 1115 86 1 638 1 dnaK Chaperone protein DnaK Escherichia coli (strain K12)
B1IRG0 0 1115 86 1 638 3 dnaK Chaperone protein DnaK Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6Y9 0 1115 86 1 638 3 dnaK Chaperone protein DnaK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLX5 0 1115 86 1 638 3 dnaK Chaperone protein DnaK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A766 0 1115 86 1 638 3 dnaK Chaperone protein DnaK Escherichia coli O1:K1 / APEC
P0A6Z0 0 1115 86 1 638 3 dnaK Chaperone protein DnaK Escherichia coli O157:H7
A7ZHA4 0 1115 86 1 638 3 dnaK Chaperone protein DnaK Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83MH5 0 1114 86 1 638 3 dnaK Chaperone protein DnaK Shigella flexneri
Q0T8H6 0 1114 86 1 638 3 dnaK Chaperone protein DnaK Shigella flexneri serotype 5b (strain 8401)
A7ZVV7 0 1114 86 1 638 3 dnaK Chaperone protein DnaK Escherichia coli O9:H4 (strain HS)
Q6D0B7 0 1102 85 1 637 3 dnaK Chaperone protein DnaK Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DF10 0 1101 85 1 637 3 dnaK Chaperone protein DnaK Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q2NVZ1 0 1097 85 1 637 3 dnaK Chaperone protein DnaK Sodalis glossinidius (strain morsitans)
B2VGR9 0 1095 86 1 637 3 dnaK Chaperone protein DnaK Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q1LST3 0 1060 80 1 637 3 dnaK Chaperone protein DnaK Baumannia cicadellinicola subsp. Homalodisca coagulata
P57870 0 1058 82 1 637 3 dnaK Chaperone protein DnaK Pasteurella multocida (strain Pm70)
Q65U55 0 1058 83 1 637 3 dnaK Chaperone protein DnaK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VNB1 0 1055 83 1 637 3 dnaK Chaperone protein DnaK Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
P71331 0 1052 80 2 642 3 dnaK Chaperone protein DnaK Aggregatibacter actinomycetemcomitans
C4K3I6 0 1051 80 1 637 3 dnaK Chaperone protein DnaK Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
C3LTA5 0 1050 82 2 637 3 dnaK Chaperone protein DnaK Vibrio cholerae serotype O1 (strain M66-2)
O34241 0 1050 82 2 637 3 dnaK Chaperone protein DnaK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F361 0 1050 82 2 637 3 dnaK Chaperone protein DnaK Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8K9Y8 0 1050 78 0 637 3 dnaK Chaperone protein DnaK Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q7VQL4 0 1048 78 3 643 3 dnaK Chaperone protein DnaK Blochmanniella floridana
Q0I3V2 0 1046 82 1 635 3 dnaK Chaperone protein DnaK Histophilus somni (strain 129Pt)
A4SQ25 0 1044 81 1 640 3 dnaK Chaperone protein DnaK Aeromonas salmonicida (strain A449)
B0UWR4 0 1044 81 1 635 3 dnaK Chaperone protein DnaK Histophilus somni (strain 2336)
P48209 0 1043 80 2 637 3 dnaK Chaperone protein DnaK Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B8D758 0 1043 79 1 637 3 dnaK Chaperone protein DnaK Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
O32464 0 1043 79 1 637 3 dnaK Chaperone protein DnaK Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8V4 0 1043 79 1 637 3 dnaK Chaperone protein DnaK Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A0KMI6 0 1042 80 1 641 3 dnaK Chaperone protein DnaK Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7MN85 0 1041 81 2 637 3 dnaK Chaperone protein DnaK Vibrio vulnificus (strain YJ016)
Q8DF66 0 1041 81 2 637 3 dnaK Chaperone protein DnaK Vibrio vulnificus (strain CMCP6)
Q493S7 0 1037 79 2 638 3 dnaK Chaperone protein DnaK Blochmanniella pennsylvanica (strain BPEN)
A0KTS5 0 1035 79 2 639 3 dnaK Chaperone protein DnaK Shewanella sp. (strain ANA-3)
Q3IC08 0 1034 79 1 638 3 dnaK Chaperone protein DnaK Pseudoalteromonas translucida (strain TAC 125)
Q87RX3 0 1034 81 1 637 3 dnaK Chaperone protein DnaK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0HY11 0 1033 79 2 639 3 dnaK Chaperone protein DnaK Shewanella sp. (strain MR-7)
Q0HLN0 0 1033 79 2 639 3 dnaK Chaperone protein DnaK Shewanella sp. (strain MR-4)
Q8EHT7 0 1031 79 2 639 3 dnaK Chaperone protein DnaK Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B4S0U1 0 1028 80 3 643 3 dnaK Chaperone protein DnaK Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q6LUA7 0 1026 81 1 638 3 dnaK1 Chaperone protein DnaK 1 Photobacterium profundum (strain SS9)
Q9L7Z1 0 1025 80 3 639 3 dnaK Chaperone protein DnaK Vibrio proteolyticus
Q086J3 0 1025 78 3 640 3 dnaK Chaperone protein DnaK Shewanella frigidimarina (strain NCIMB 400)
C4L8Y5 0 1025 78 2 643 3 dnaK Chaperone protein DnaK Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
O52064 0 1024 80 5 638 3 dnaK Chaperone protein DnaK Mannheimia haemolytica
B7VJW9 0 1023 80 1 637 3 dnaK Chaperone protein DnaK Vibrio atlanticus (strain LGP32)
A1RGN1 0 1017 77 2 639 3 dnaK Chaperone protein DnaK Shewanella sp. (strain W3-18-1)
A4Y9Q3 0 1017 77 2 639 3 dnaK Chaperone protein DnaK Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q12Q08 0 1017 78 2 638 3 dnaK Chaperone protein DnaK Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A7MWW0 0 1016 79 2 638 3 dnaK Chaperone protein DnaK Vibrio campbellii (strain ATCC BAA-1116)
Q8D2Q5 0 1016 76 2 642 3 dnaK Chaperone protein DnaK Wigglesworthia glossinidia brevipalpis
P59565 0 1014 75 0 637 3 dnaK Chaperone protein DnaK Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A6WRU9 0 1014 78 3 639 3 dnaK Chaperone protein DnaK Shewanella baltica (strain OS185)
A3D7T4 0 1014 78 3 639 3 dnaK Chaperone protein DnaK Shewanella baltica (strain OS155 / ATCC BAA-1091)
A9L0R8 0 1013 78 3 639 3 dnaK Chaperone protein DnaK Shewanella baltica (strain OS195)
Q47XI6 0 1013 78 2 639 3 dnaK2 Chaperone protein DnaK 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A3QGW2 0 1013 77 1 637 3 dnaK Chaperone protein DnaK Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1STE4 0 1013 77 3 641 3 dnaK Chaperone protein DnaK Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B8E4S1 0 1013 78 3 639 3 dnaK Chaperone protein DnaK Shewanella baltica (strain OS223)
B8F7S6 0 1011 79 2 637 3 dnaK Chaperone protein DnaK Glaesserella parasuis serovar 5 (strain SH0165)
B8CKF3 0 1009 77 2 641 3 dnaK Chaperone protein DnaK Shewanella piezotolerans (strain WP3 / JCM 13877)
B5FA11 0 1009 79 2 635 3 dnaK Chaperone protein DnaK Aliivibrio fischeri (strain MJ11)
Q5E3A7 0 1008 79 2 635 3 dnaK2 Chaperone protein DnaK 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
B0TQC2 0 1008 77 2 638 3 dnaK Chaperone protein DnaK Shewanella halifaxensis (strain HAW-EB4)
A8FYU0 0 1007 77 2 640 3 dnaK Chaperone protein DnaK Shewanella sediminis (strain HAW-EB3)
A1S8K7 0 1007 79 1 637 3 dnaK Chaperone protein DnaK Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B1KRT2 0 1005 77 2 640 3 dnaK Chaperone protein DnaK Shewanella woodyi (strain ATCC 51908 / MS32)
A8H760 0 1004 78 2 638 3 dnaK Chaperone protein DnaK Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q15UD3 0 1004 77 2 640 3 dnaK Chaperone protein DnaK Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5E4T4 0 1001 79 2 633 3 dnaK1 Chaperone protein DnaK 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
A6VCL8 0 999 77 2 638 3 dnaK Chaperone protein DnaK Pseudomonas aeruginosa (strain PA7)
Q6LS31 0 998 78 1 640 3 dnaK2 Chaperone protein DnaK 2 Photobacterium profundum (strain SS9)
O87384 0 995 78 4 640 3 dnaK Chaperone protein DnaK Vibrio harveyi
A3N3K0 0 993 77 2 637 3 dnaK Chaperone protein DnaK Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B7V1H3 0 992 76 2 638 3 dnaK Chaperone protein DnaK Pseudomonas aeruginosa (strain LESB58)
B3H2X7 0 992 77 2 637 3 dnaK Chaperone protein DnaK Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q9HV43 0 991 76 2 638 3 dnaK Chaperone protein DnaK Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FR1 0 991 76 2 638 3 dnaK Chaperone protein DnaK Pseudomonas aeruginosa (strain UCBPP-PA14)
A4XYF6 0 991 75 2 639 3 dnaK Chaperone protein DnaK Pseudomonas mendocina (strain ymp)
B0BTI7 0 988 78 3 637 3 dnaK Chaperone protein DnaK Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A5UF68 0 984 77 2 637 3 dnaK Chaperone protein DnaK Haemophilus influenzae (strain PittGG)
A5UBQ1 0 983 77 2 637 3 dnaK Chaperone protein DnaK Haemophilus influenzae (strain PittEE)
P43736 0 980 77 2 637 3 dnaK Chaperone protein DnaK Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QJW4 0 980 77 2 637 3 dnaK Chaperone protein DnaK Haemophilus influenzae (strain 86-028NP)
A4VPQ5 0 977 76 2 638 3 dnaK Chaperone protein DnaK Stutzerimonas stutzeri (strain A1501)
Q5QXL1 0 969 77 2 643 3 dnaK Chaperone protein DnaK Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B8GNX1 0 967 75 1 640 3 dnaK Chaperone protein DnaK Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q4KIH1 0 961 74 1 638 3 dnaK Chaperone protein DnaK Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0VST6 0 961 75 2 641 3 dnaK Chaperone protein DnaK Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q3KIA0 0 960 74 1 638 3 dnaK Chaperone protein DnaK Pseudomonas fluorescens (strain Pf0-1)
Q1IF59 0 959 74 1 638 3 dnaK Chaperone protein DnaK Pseudomonas entomophila (strain L48)
A1U614 0 958 73 2 642 3 dnaK Chaperone protein DnaK Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q88DU2 0 957 73 1 638 3 dnaK Chaperone protein DnaK Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A6W2D2 0 956 72 1 637 3 dnaK Chaperone protein DnaK Marinomonas sp. (strain MWYL1)
Q2SMM8 0 954 74 5 644 3 dnaK Chaperone protein DnaK Hahella chejuensis (strain KCTC 2396)
Q5H186 0 948 73 2 640 3 dnaK Chaperone protein DnaK Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
C5BQ33 0 948 74 2 644 3 dnaK Chaperone protein DnaK Teredinibacter turnerae (strain ATCC 39867 / T7901)
B2SQU4 0 947 73 2 640 3 dnaK Chaperone protein DnaK Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P459 0 947 73 2 640 3 dnaK Chaperone protein DnaK Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PMB0 0 946 73 2 640 3 dnaK Chaperone protein DnaK Xanthomonas axonopodis pv. citri (strain 306)
Q3BVB8 0 944 73 2 640 3 dnaK Chaperone protein DnaK Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q1QSX0 0 944 72 3 644 3 dnaK Chaperone protein DnaK Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q9ZFC6 0 944 73 3 642 3 dnaK Chaperone protein DnaK Methylovorus sp. (strain SS1 / DSM 11726)
Q87WP0 0 944 72 1 638 3 dnaK Chaperone protein DnaK Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B1J254 0 942 73 3 642 3 dnaK Chaperone protein DnaK Pseudomonas putida (strain W619)
Q8PAK9 0 942 72 2 640 3 dnaK Chaperone protein DnaK Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RVU2 0 942 72 2 640 3 dnaK Chaperone protein DnaK Xanthomonas campestris pv. campestris (strain B100)
Q4UT11 0 942 72 2 640 3 dnaK Chaperone protein DnaK Xanthomonas campestris pv. campestris (strain 8004)
B2FMY5 0 942 72 3 639 3 dnaK Chaperone protein DnaK Stenotrophomonas maltophilia (strain K279a)
B0KIS5 0 941 73 2 641 3 dnaK Chaperone protein DnaK Pseudomonas putida (strain GB-1)
Q3J7D8 0 941 72 2 640 3 dnaK Chaperone protein DnaK Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B3PF33 0 941 73 1 635 3 dnaK Chaperone protein DnaK Cellvibrio japonicus (strain Ueda107)
Q3SIN4 0 937 72 2 638 3 dnaK Chaperone protein DnaK Thiobacillus denitrificans (strain ATCC 25259)
Q21H36 0 937 74 3 643 3 dnaK Chaperone protein DnaK Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q4ZNP7 0 936 72 1 638 3 dnaK Chaperone protein DnaK Pseudomonas syringae pv. syringae (strain B728a)
Q48E62 0 936 72 1 638 3 dnaK Chaperone protein DnaK Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5P1H5 0 934 71 1 645 3 dnaK Chaperone protein DnaK Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A5W9A3 0 934 75 1 609 3 dnaK Chaperone protein DnaK Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q5NFG7 0 934 72 3 641 3 dnaK Chaperone protein DnaK Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14GW9 0 934 72 3 641 3 dnaK Chaperone protein DnaK Francisella tularensis subsp. tularensis (strain FSC 198)
A4IX28 0 933 72 3 641 3 dnaK Chaperone protein DnaK Francisella tularensis subsp. tularensis (strain WY96-3418)
A5EYG3 0 933 71 5 646 3 dnaK Chaperone protein DnaK Dichelobacter nodosus (strain VCS1703A)
A1WX31 0 933 70 2 643 3 dnaK Chaperone protein DnaK Halorhodospira halophila (strain DSM 244 / SL1)
Q2Y6U0 0 931 71 2 645 3 dnaK Chaperone protein DnaK Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q0BLK4 0 931 72 3 641 3 dnaK Chaperone protein DnaK Francisella tularensis subsp. holarctica (strain OSU18)
Q2A328 0 931 72 3 641 3 dnaK Chaperone protein DnaK Francisella tularensis subsp. holarctica (strain LVS)
A7NCM9 0 931 72 3 641 3 dnaK Chaperone protein DnaK Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q87BS8 0 931 71 2 634 3 dnaK Chaperone protein DnaK Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6F6 0 931 71 2 634 3 dnaK Chaperone protein DnaK Xylella fastidiosa (strain M23)
Q1H3B8 0 930 74 1 639 3 dnaK Chaperone protein DnaK Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
C1DD88 0 930 71 4 644 3 dnaK Chaperone protein DnaK Laribacter hongkongensis (strain HLHK9)
A0Q7F0 0 929 72 3 641 3 dnaK Chaperone protein DnaK Francisella tularensis subsp. novicida (strain U112)
B0U3J8 0 929 71 2 638 3 dnaK Chaperone protein DnaK Xylella fastidiosa (strain M12)
Q9PB05 0 929 71 2 638 3 dnaK Chaperone protein DnaK Xylella fastidiosa (strain 9a5c)
P48205 0 929 72 3 641 3 dnaK Chaperone protein DnaK Francisella tularensis
B4SSQ6 0 928 72 2 639 3 dnaK Chaperone protein DnaK Stenotrophomonas maltophilia (strain R551-3)
B2SGV8 0 928 72 3 641 3 dnaK Chaperone protein DnaK Francisella tularensis subsp. mediasiatica (strain FSC147)
O32482 0 926 71 4 645 3 dnaK Chaperone protein DnaK Legionella pneumophila
Q5ZTY3 0 926 71 4 645 3 dnaK Chaperone protein DnaK Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IDK8 0 926 71 4 645 3 dnaK Chaperone protein DnaK Legionella pneumophila (strain Corby)
A1K4C5 0 925 71 2 645 3 dnaK Chaperone protein DnaK Azoarcus sp. (strain BH72)
Q5X3M7 0 925 71 4 645 3 dnaK Chaperone protein DnaK Legionella pneumophila (strain Paris)
B3R6G7 0 925 71 2 647 3 dnaK Chaperone protein DnaK Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q5WV15 0 924 71 4 645 3 dnaK Chaperone protein DnaK Legionella pneumophila (strain Lens)
A5CX56 0 924 70 2 638 3 dnaK Chaperone protein DnaK Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A1AW22 0 923 70 2 638 3 dnaK Chaperone protein DnaK Ruthia magnifica subsp. Calyptogena magnifica
B2UBP3 0 923 71 2 650 3 dnaK Chaperone protein DnaK Ralstonia pickettii (strain 12J)
O06430 0 921 72 1 644 3 dnaK Chaperone protein DnaK Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
C3K275 0 920 73 1 638 3 dnaK Chaperone protein DnaK Pseudomonas fluorescens (strain SBW25)
Q46XI7 0 920 70 2 647 3 dnaK Chaperone protein DnaK Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
O87712 0 919 70 2 641 1 dnaK Chaperone protein DnaK Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N8H2 0 919 70 2 641 3 dnaK Chaperone protein DnaK Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KG88 0 919 70 2 641 3 dnaK Chaperone protein DnaK Coxiella burnetii (strain Dugway 5J108-111)
B6J7U7 0 919 70 2 641 3 dnaK Chaperone protein DnaK Coxiella burnetii (strain CbuK_Q154)
Q0K757 0 919 70 2 650 3 dnaK Chaperone protein DnaK Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8XW40 0 917 70 2 652 3 dnaK Chaperone protein DnaK Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A9AGB8 0 917 71 3 645 3 dnaK Chaperone protein DnaK Burkholderia multivorans (strain ATCC 17616 / 249)
B6IZJ0 0 915 70 2 641 3 dnaK Chaperone protein DnaK Coxiella burnetii (strain CbuG_Q212)
Q2KWA2 0 914 70 3 640 3 dnaK Chaperone protein DnaK Bordetella avium (strain 197N)
O33522 0 913 70 2 648 3 dnaK Chaperone protein DnaK Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q607A5 0 912 70 3 641 3 dnaK Chaperone protein DnaK Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A9IGC3 0 911 70 2 636 3 dnaK Chaperone protein DnaK Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B2JGE2 0 910 70 3 650 3 dnaK Chaperone protein DnaK Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B1Y786 0 910 70 2 644 3 dnaK Chaperone protein DnaK Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q145F1 0 910 70 3 650 3 dnaK Chaperone protein DnaK Paraburkholderia xenovorans (strain LB400)
A1TLH9 0 910 74 1 601 3 dnaK Chaperone protein DnaK Paracidovorax citrulli (strain AAC00-1)
A4JBS1 0 910 70 3 647 3 dnaK Chaperone protein DnaK Burkholderia vietnamiensis (strain G4 / LMG 22486)
O68191 0 910 70 3 647 3 dnaK Chaperone protein DnaK Burkholderia pseudomallei (strain K96243)
A3ND68 0 910 70 3 647 3 dnaK Chaperone protein DnaK Burkholderia pseudomallei (strain 668)
Q3JP10 0 910 70 3 647 3 dnaK Chaperone protein DnaK Burkholderia pseudomallei (strain 1710b)
A3NYX7 0 910 70 3 647 3 dnaK Chaperone protein DnaK Burkholderia pseudomallei (strain 1106a)
A1V0U6 0 910 70 3 647 3 dnaK Chaperone protein DnaK Burkholderia mallei (strain SAVP1)
Q62HD5 0 910 70 3 647 3 dnaK Chaperone protein DnaK Burkholderia mallei (strain ATCC 23344)
A2S565 0 910 70 3 647 3 dnaK Chaperone protein DnaK Burkholderia mallei (strain NCTC 10229)
A3MN99 0 910 70 3 647 3 dnaK Chaperone protein DnaK Burkholderia mallei (strain NCTC 10247)
Q2SYZ4 0 909 70 3 647 3 dnaK Chaperone protein DnaK Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q7WGI4 0 908 70 3 639 3 dnaK Chaperone protein DnaK Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B2SXC6 0 907 69 3 647 3 dnaK Chaperone protein DnaK Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q7W519 0 907 70 3 639 3 dnaK Chaperone protein DnaK Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7VVY2 0 906 70 3 639 3 dnaK Chaperone protein DnaK Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A1WAR6 0 906 74 1 601 3 dnaK Chaperone protein DnaK Acidovorax sp. (strain JS42)
Q0BI18 0 905 70 3 647 3 dnaK Chaperone protein DnaK Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A2SIR4 0 905 69 3 655 3 dnaK Chaperone protein DnaK Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B1YTK0 0 904 69 3 647 3 dnaK Chaperone protein DnaK Burkholderia ambifaria (strain MC40-6)
Q7NXI3 0 904 69 2 644 3 dnaK Chaperone protein DnaK Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A9BNG5 0 903 73 1 601 3 dnaK Chaperone protein DnaK Delftia acidovorans (strain DSM 14801 / SPH-1)
B9MDJ7 0 902 73 1 601 3 dnaK Chaperone protein DnaK Acidovorax ebreus (strain TPSY)
Q39JC8 0 900 69 3 647 3 dnaK Chaperone protein DnaK Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A1VMG2 0 900 68 2 644 3 dnaK Chaperone protein DnaK Polaromonas naphthalenivorans (strain CJ2)
A4SZR8 0 900 70 3 644 3 dnaK Chaperone protein DnaK Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B0TYF2 0 899 74 2 595 3 dnaK Chaperone protein DnaK Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q47HK2 0 899 69 4 647 3 dnaK Chaperone protein DnaK Dechloromonas aromatica (strain RCB)
Q1BYX3 0 898 69 3 647 3 dnaK Chaperone protein DnaK Burkholderia orbicola (strain AU 1054)
B1JW19 0 898 69 3 647 3 dnaK Chaperone protein DnaK Burkholderia orbicola (strain MC0-3)
B4EDZ2 0 898 69 3 647 3 dnaK Chaperone protein DnaK Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K4S8 0 898 69 3 647 3 dnaK Chaperone protein DnaK Burkholderia cenocepacia (strain HI2424)
Q21X09 0 895 68 2 648 3 dnaK Chaperone protein DnaK Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B1XRU1 0 895 70 2 640 3 dnaK Chaperone protein DnaK Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A5WI20 0 894 69 4 644 3 dnaK Chaperone protein DnaK Psychrobacter sp. (strain PRwf-1)
Q9WWG9 0 892 69 3 639 3 dnaK Chaperone protein DnaK Pseudomonas savastanoi pv. glycinea
C5CU12 0 892 69 2 642 3 dnaK Chaperone protein DnaK Variovorax paradoxus (strain S110)
Q0AIY1 0 891 69 2 652 3 dnaK Chaperone protein DnaK Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q9JVQ9 0 891 70 2 641 3 dnaK Chaperone protein DnaK Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1WGJ9 0 889 71 1 601 3 dnaK Chaperone protein DnaK Verminephrobacter eiseniae (strain EF01-2)
A3M8W9 0 889 69 5 646 3 dnaK Chaperone protein DnaK Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HZZ7 0 889 69 5 646 3 dnaK Chaperone protein DnaK Acinetobacter baumannii (strain ACICU)
Q4FPS9 0 888 67 3 647 3 dnaK Chaperone protein DnaK Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1Q7X0 0 887 67 3 647 3 dnaK Chaperone protein DnaK Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B0V5U4 0 887 69 5 646 3 dnaK Chaperone protein DnaK Acinetobacter baumannii (strain AYE)
B7IBK5 0 887 69 5 646 3 dnaK Chaperone protein DnaK Acinetobacter baumannii (strain AB0057)
B7H317 0 887 69 5 646 3 dnaK Chaperone protein DnaK Acinetobacter baumannii (strain AB307-0294)
Q11KJ6 0 886 68 3 640 3 dnaK Chaperone protein DnaK Chelativorans sp. (strain BNC1)
Q6F6N3 0 882 67 3 650 3 dnaK Chaperone protein DnaK Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q5F6W5 0 881 72 1 602 3 dnaK Chaperone protein DnaK Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q31HA7 0 881 69 2 639 3 dnaK Chaperone protein DnaK Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
P42373 0 880 68 5 648 3 dnaK Chaperone protein DnaK Burkholderia cepacia
Q9K0N4 0 879 72 1 602 1 dnaK Chaperone protein DnaK Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1KSG3 0 877 71 1 602 3 dnaK Chaperone protein DnaK Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M296 0 876 71 1 602 3 dnaK Chaperone protein DnaK Neisseria meningitidis serogroup C (strain 053442)
B5ENA3 0 875 68 2 634 3 dnaK Chaperone protein DnaK Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J7X9 0 875 68 2 634 3 dnaK Chaperone protein DnaK Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A4G8D2 0 874 66 2 648 3 dnaK Chaperone protein DnaK Herminiimonas arsenicoxydans
Q128K2 0 872 68 2 644 3 dnaK Chaperone protein DnaK Polaromonas sp. (strain JS666 / ATCC BAA-500)
A6T226 0 862 67 2 649 3 dnaK Chaperone protein DnaK Janthinobacterium sp. (strain Marseille)
A9W6R7 0 857 67 4 642 3 dnaK Chaperone protein DnaK Methylorubrum extorquens (strain PA1)
B7KSZ4 0 857 67 4 642 3 dnaK Chaperone protein DnaK Methylorubrum extorquens (strain CM4 / NCIMB 13688)
B6IVA4 0 855 65 3 643 3 dnaK Chaperone protein DnaK Rhodospirillum centenum (strain ATCC 51521 / SW)
Q05981 0 853 66 3 639 2 dnaK Chaperone protein DnaK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57AD7 0 853 66 3 639 3 dnaK Chaperone protein DnaK Brucella abortus biovar 1 (strain 9-941)
A8IPT1 0 853 66 4 639 3 dnaK Chaperone protein DnaK Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q8FXX2 0 853 66 3 639 3 dnaK Chaperone protein DnaK Brucella suis biovar 1 (strain 1330)
Q8YE76 0 853 66 3 639 3 dnaK Chaperone protein DnaK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2RNE6 0 851 65 3 642 3 dnaK Chaperone protein DnaK Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A7IC65 0 849 66 3 639 3 dnaK Chaperone protein DnaK Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B1ZGR1 0 849 66 3 642 3 dnaK Chaperone protein DnaK Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B1LZ51 0 845 65 4 642 3 dnaK Chaperone protein DnaK Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
P42374 0 843 66 5 645 3 dnaK Chaperone protein DnaK Rhizobium meliloti (strain 1021)
A9ILH7 0 843 65 3 637 3 dnaK Chaperone protein DnaK Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q486F9 0 843 65 4 637 3 dnaK1 Chaperone protein DnaK 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q0BW82 0 842 66 5 638 3 dnaK Chaperone protein DnaK Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A6UEY0 0 841 66 5 645 3 dnaK Chaperone protein DnaK Sinorhizobium medicae (strain WSM419)
Q6G1F9 0 839 64 3 637 3 dnaK Chaperone protein DnaK Bartonella quintana (strain Toulouse)
B8IHL3 0 838 65 4 642 3 dnaK Chaperone protein DnaK Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A1UUC3 0 838 64 4 637 3 dnaK Chaperone protein DnaK Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q05FS8 0 838 65 0 600 3 dnaK Chaperone protein DnaK Carsonella ruddii (strain PV)
Q6G554 0 838 64 3 637 3 dnaK Chaperone protein DnaK Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q1MN11 0 837 65 6 644 3 dnaK Chaperone protein DnaK Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2VYT1 0 837 65 4 648 3 dnaK Chaperone protein DnaK Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q3A8C2 0 835 63 3 636 3 dnaK Chaperone protein DnaK Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q98DD1 0 835 66 2 607 3 dnaK Chaperone protein DnaK Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B6JCI3 0 835 66 3 640 3 dnaK Chaperone protein DnaK Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q2J320 0 835 65 5 641 3 dnaK Chaperone protein DnaK Rhodopseudomonas palustris (strain HaA2)
Q13E60 0 833 65 5 641 3 dnaK Chaperone protein DnaK Rhodopseudomonas palustris (strain BisB5)
Q4FNP9 0 833 64 3 633 3 dnaK Chaperone protein DnaK Pelagibacter ubique (strain HTCC1062)
O05700 0 832 66 3 639 3 dnaK Chaperone protein DnaK Rhodopseudomonas sp. (strain No.7)
B3Q972 0 832 65 3 639 3 dnaK Chaperone protein DnaK Rhodopseudomonas palustris (strain TIE-1)
Q6NCY4 0 832 65 3 639 3 dnaK Chaperone protein DnaK Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P50019 0 830 64 5 641 2 dnaK Chaperone protein DnaK Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1RHH0 0 830 65 4 635 3 dnaK Chaperone protein DnaK Rickettsia bellii (strain RML369-C)
A1B4E9 0 829 65 6 644 3 dnaK Chaperone protein DnaK Paracoccus denitrificans (strain Pd 1222)
A0L4Z2 0 828 63 4 658 3 dnaK Chaperone protein DnaK Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q39PT7 0 828 64 5 642 3 dnaK Chaperone protein DnaK Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q0AKB1 0 828 66 2 639 3 dnaK Chaperone protein DnaK Maricaulis maris (strain MCS10)
Q74H59 0 828 64 4 640 3 dnaK Chaperone protein DnaK Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B0UR84 0 828 65 4 642 3 dnaK Chaperone protein DnaK Methylobacterium sp. (strain 4-46)
B9JZ87 0 827 63 5 644 3 dnaK Chaperone protein DnaK Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A5GDC8 0 827 64 3 639 3 dnaK Chaperone protein DnaK Geotalea uraniireducens (strain Rf4)
P94317 0 827 65 4 641 3 dnaK Chaperone protein DnaK Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B9M357 0 825 65 3 640 3 dnaK Chaperone protein DnaK Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A8GMF9 0 825 66 5 634 3 dnaK Chaperone protein DnaK Rickettsia akari (strain Hartford)
B5ZWQ2 0 825 64 3 642 3 dnaK Chaperone protein DnaK Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q3SW76 0 823 65 4 638 3 dnaK Chaperone protein DnaK Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
C6E643 0 822 63 5 644 3 dnaK Chaperone protein DnaK Geobacter sp. (strain M21)
B5EC42 0 821 63 5 644 3 dnaK Chaperone protein DnaK Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B3PXH3 0 820 64 5 643 3 dnaK Chaperone protein DnaK Rhizobium etli (strain CIAT 652)
A8GR22 0 820 65 6 637 3 dnaK Chaperone protein DnaK Rickettsia rickettsii (strain Sheila Smith)
B0BWH1 0 820 65 6 637 3 dnaK Chaperone protein DnaK Rickettsia rickettsii (strain Iowa)
Q2KDW6 0 820 64 5 643 3 dnaK Chaperone protein DnaK Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B2IBR4 0 819 63 5 639 3 dnaK Chaperone protein DnaK Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q1QRU1 0 818 65 4 641 3 dnaK Chaperone protein DnaK Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A9HEA3 0 818 64 4 641 3 dnaK Chaperone protein DnaK Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q3IYM7 0 817 64 6 642 3 dnaK Chaperone protein DnaK Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PNM1 0 817 64 6 642 3 dnaK Chaperone protein DnaK Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
C3PMM7 0 816 65 6 637 3 dnaK Chaperone protein DnaK Rickettsia africae (strain ESF-5)
Q5NPS6 0 816 64 4 641 3 dnaK Chaperone protein DnaK Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B8EIP9 0 815 63 5 642 3 dnaK Chaperone protein DnaK Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
C4K110 0 814 64 6 637 3 dnaK Chaperone protein DnaK Rickettsia peacockii (strain Rustic)
Q2LUH6 0 813 63 3 641 3 dnaK Chaperone protein DnaK Syntrophus aciditrophicus (strain SB)
Q9ZDX9 0 813 64 6 635 3 dnaK Chaperone protein DnaK Rickettsia prowazekii (strain Madrid E)
A4WW89 0 813 64 7 643 3 dnaK Chaperone protein DnaK Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
P20442 0 811 63 3 637 2 dnaK Chaperone protein DnaK Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A7HZ39 0 810 64 2 633 3 dnaK Chaperone protein DnaK Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
B0T138 0 810 63 4 640 3 dnaK Chaperone protein DnaK Caulobacter sp. (strain K31)
Q68XI2 0 809 64 6 635 3 dnaK Chaperone protein DnaK Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4UJK7 0 809 64 6 635 3 dnaK Chaperone protein DnaK Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q52701 0 809 63 6 643 3 dnaK Chaperone protein DnaK Rhodobacter capsulatus
Q07US6 0 808 64 4 641 3 dnaK Chaperone protein DnaK Rhodopseudomonas palustris (strain BisA53)
A1ANV0 0 808 62 4 639 3 dnaK Chaperone protein DnaK Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q21CI2 0 806 64 4 641 3 dnaK Chaperone protein DnaK Rhodopseudomonas palustris (strain BisB18)
B8FGS3 0 805 65 2 608 3 dnaK Chaperone protein DnaK Desulfatibacillum aliphaticivorans
Q1GKS3 0 805 64 9 648 3 dnaK Chaperone protein DnaK Ruegeria sp. (strain TM1040)
A5FZ19 0 804 64 4 638 3 dnaK Chaperone protein DnaK Acidiphilium cryptum (strain JF-5)
Q92J36 0 804 64 6 637 3 dnaK Chaperone protein DnaK Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q5LWJ6 0 801 63 7 643 3 dnaK Chaperone protein DnaK Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
O33528 0 801 62 6 644 3 dnaK Chaperone protein DnaK Rhizobium leguminosarum
B3E7W9 0 801 61 5 643 3 dnaK Chaperone protein DnaK Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
C0QGP6 0 797 63 4 641 3 dnaK Chaperone protein DnaK Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q0BWZ9 0 796 64 5 639 3 dnaK Chaperone protein DnaK Hyphomonas neptunium (strain ATCC 15444)
B3CNB5 0 793 60 6 644 3 dnaK Chaperone protein DnaK Wolbachia pipientis subsp. Culex pipiens (strain wPip)
B5YH59 0 788 61 5 640 3 dnaK Chaperone protein DnaK Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
C0R3W7 0 785 60 7 647 3 dnaK Chaperone protein DnaK Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q73GL7 0 785 60 7 647 3 dnaK Chaperone protein DnaK Wolbachia pipientis wMel
C4XQ63 0 783 64 3 605 3 dnaK Chaperone protein DnaK Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q5GSE1 0 783 60 8 646 3 dnaK Chaperone protein DnaK Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q5FSL5 0 783 62 6 642 3 dnaK Chaperone protein DnaK Gluconobacter oxydans (strain 621H)
A5V5P9 0 782 62 3 637 3 dnaK Chaperone protein DnaK Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q16D45 0 781 61 8 642 3 dnaK Chaperone protein DnaK Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q2GF34 0 780 62 4 638 3 dnaK Chaperone protein DnaK Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q6AMQ3 0 780 63 2 606 3 dnaK Chaperone protein DnaK Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A8ZRW3 0 778 61 6 644 3 dnaK Chaperone protein DnaK Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
O85282 0 777 61 4 638 3 dnaK Chaperone protein DnaK Neorickettsia sennetsu
Q313S2 0 776 61 4 641 3 dnaK Chaperone protein DnaK Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A1VFG6 0 775 62 7 640 3 dnaK Chaperone protein DnaK Nitratidesulfovibrio vulgaris (strain DP4)
Q72DW8 0 775 62 7 640 3 dnaK Chaperone protein DnaK Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q28VY3 0 775 64 5 601 3 dnaK Chaperone protein DnaK Jannaschia sp. (strain CCS1)
Q1MPW1 0 771 61 5 638 3 dnaK Chaperone protein DnaK Lawsonia intracellularis (strain PHE/MN1-00)
Q2G6N0 0 768 62 6 646 3 dnaK Chaperone protein DnaK Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
P38647 0 767 60 3 626 1 Hspa9 Stress-70 protein, mitochondrial Mus musculus
Q5HAY1 0 767 60 8 639 3 dnaK Chaperone protein DnaK Ehrlichia ruminantium (strain Welgevonden)
C6BSF2 0 766 61 3 617 3 dnaK Chaperone protein DnaK Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B8J402 0 766 62 5 642 3 dnaK Chaperone protein DnaK Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q5FFM4 0 765 59 8 639 3 dnaK Chaperone protein DnaK Ehrlichia ruminantium (strain Gardel)
Q6MNF8 0 765 60 9 647 3 dnaK Chaperone protein DnaK Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
O35501 0 764 60 4 626 2 HSPA9 Stress-70 protein, mitochondrial Cricetulus griseus
Q3ZCH0 0 764 60 4 626 2 HSPA9 Stress-70 protein, mitochondrial Bos taurus
P38646 0 763 60 4 626 1 HSPA9 Stress-70 protein, mitochondrial Homo sapiens
B8DRD6 0 763 61 5 643 3 dnaK Chaperone protein DnaK Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
P11141 0 762 60 2 617 1 hsp-6 Heat shock protein hsp-6 Caenorhabditis elegans
Q5R511 0 762 60 4 626 2 HSPA9 Stress-70 protein, mitochondrial Pongo abelii
Q5ZM98 0 761 61 4 607 1 HSPA9 Stress-70 protein, mitochondrial Gallus gallus
Q9XCB1 0 761 59 7 649 3 dnaK Chaperone protein DnaK Rhodothermus marinus
P48721 0 758 61 4 607 1 Hspa9 Stress-70 protein, mitochondrial Rattus norvegicus
P29845 0 755 60 4 611 1 Hsc70-5 Heat shock 70 kDa protein cognate 5 Drosophila melanogaster
A5FGL1 0 755 61 6 637 3 dnaK Chaperone protein DnaK Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B2S0M0 0 755 60 6 640 3 dnaK Chaperone protein DnaK Borrelia hermsii (strain HS1 / DAH)
Q01899 0 753 59 3 630 2 None Heat shock 70 kDa protein, mitochondrial Phaseolus vulgaris
P37900 0 753 58 3 630 2 HSP1 Heat shock 70 kDa protein, mitochondrial Pisum sativum
A4SFB1 0 753 58 7 646 3 dnaK Chaperone protein DnaK Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q9LDZ0 0 752 59 3 630 1 HSP70-10 Heat shock 70 kDa protein 10, mitochondrial Arabidopsis thaliana
A6GXZ1 0 751 61 4 635 3 dnaK Chaperone protein DnaK Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
P0C937 0 747 59 5 645 3 dnaK Chaperone protein DnaK Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RJ90 0 745 59 5 645 3 dnaK Chaperone protein DnaK Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q6MB26 0 745 58 7 650 3 dnaK Chaperone protein DnaK Protochlamydia amoebophila (strain UWE25)
B3QMB2 0 745 58 6 647 3 dnaK Chaperone protein DnaK Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B4S6P7 0 744 58 6 650 3 dnaK Chaperone protein DnaK Prosthecochloris aestuarii (strain DSM 271 / SK 413)
A6Q421 0 744 58 5 637 3 dnaK Chaperone protein DnaK Nitratiruptor sp. (strain SB155-2)
B5RM75 0 744 60 6 640 3 dnaK Chaperone protein DnaK Borrelia duttonii (strain Ly)
Q3APD2 0 744 57 5 646 3 dnaK Chaperone protein DnaK Chlorobium chlorochromatii (strain CaD3)
B5RPM1 0 743 59 6 640 3 dnaK Chaperone protein DnaK Borrelia recurrentis (strain A1)
Q3B577 0 743 58 6 643 3 dnaK Chaperone protein DnaK Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q5PAB8 0 742 59 10 646 3 dnaK Chaperone protein DnaK Anaplasma marginale (strain St. Maries)
Q3YRR6 0 742 58 7 636 3 dnaK Chaperone protein DnaK Ehrlichia canis (strain Jake)
B3EKT9 0 740 57 6 649 3 dnaK Chaperone protein DnaK Chlorobium phaeobacteroides (strain BS1)
P96133 0 739 57 5 639 3 dnaK Chaperone protein DnaK Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q01PM8 0 738 58 5 643 3 dnaK Chaperone protein DnaK Solibacter usitatus (strain Ellin6076)
A1BET8 0 738 57 5 643 3 dnaK Chaperone protein DnaK Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B7J282 0 738 58 6 643 2 dnaK Chaperone protein DnaK Borreliella burgdorferi (strain ZS7)
P0C922 0 738 58 6 643 2 dnaK Chaperone protein DnaK Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q0SMZ0 0 738 59 6 642 3 dnaK Chaperone protein DnaK Borreliella afzelii (strain PKo)
Q661A3 0 737 58 5 641 3 dnaK Chaperone protein DnaK Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q8GUM2 0 736 59 2 634 1 HSP70-9 Heat shock 70 kDa protein 9, mitochondrial Arabidopsis thaliana
Q64X01 0 735 60 7 646 3 dnaK Chaperone protein DnaK Bacteroides fragilis (strain YCH46)
Q5LG30 0 735 60 7 646 3 dnaK Chaperone protein DnaK Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A0M353 0 734 60 5 646 3 dnaK Chaperone protein DnaK Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
P95334 0 734 60 4 611 3 dnaK Chaperone protein DnaK Myxococcus xanthus (strain DK1622)
Q8KEP3 0 733 58 5 638 3 dnaK Chaperone protein DnaK Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B3QZ38 0 733 59 5 643 3 dnaK Chaperone protein DnaK Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q73Q16 0 733 58 6 653 3 dnaK Chaperone protein DnaK Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
B4SDA0 0 732 56 5 643 3 dnaK Chaperone protein DnaK Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A0RPW7 0 731 59 5 633 3 dnaK Chaperone protein DnaK Campylobacter fetus subsp. fetus (strain 82-40)
B2S2G4 0 731 60 5 607 3 dnaK Chaperone protein DnaK Treponema pallidum subsp. pallidum (strain SS14)
O83246 0 731 60 5 607 3 dnaK Chaperone protein DnaK Treponema pallidum (strain Nichols)
P50021 0 731 57 7 639 3 dnaK2 Chaperone protein dnaK2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B3EHR1 0 730 56 4 642 3 dnaK Chaperone protein DnaK Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q89YW6 0 730 60 5 643 3 dnaK Chaperone protein DnaK Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q5B0C0 0 728 60 5 606 1 AN6010 Iron-sulfur cluster biogenesis chaperone, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q11QH3 0 727 58 4 638 3 dnaK Chaperone protein DnaK Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
P0CS90 0 726 60 5 605 1 SSC1 Import motor subunit, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0CS91 0 726 60 5 605 1 SSC1 Import motor subunit, mitochondrial Saccharomyces cerevisiae
Q3Z6P1 0 724 57 5 642 3 dnaK Chaperone protein DnaK Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q5N1J4 0 724 57 7 639 3 dnaK2 Chaperone protein DnaK 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A5FPU4 0 723 57 4 641 3 dnaK Chaperone protein DnaK Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q3ZYV1 0 723 57 4 641 3 dnaK Chaperone protein DnaK Dehalococcoides mccartyi (strain CBDB1)
B3ERN8 0 723 61 3 587 3 dnaK Chaperone protein DnaK Amoebophilus asiaticus (strain 5a2)
A6LDG8 0 723 62 2 585 3 dnaK Chaperone protein DnaK Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
P22358 0 723 56 6 640 2 dnaK2 Chaperone protein DnaK2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1IT15 0 721 55 6 652 3 dnaK Chaperone protein DnaK Koribacter versatilis (strain Ellin345)
P83784 0 720 61 2 571 1 SSC1 Heat shock protein SSC1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9ZMW4 0 719 57 5 633 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain J99 / ATCC 700824)
P56836 0 719 62 4 575 3 dnaK Chaperone protein DnaK Chlamydia muridarum (strain MoPn / Nigg)
Q8DI58 0 718 56 8 647 3 dnaK2 Chaperone protein dnaK2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q17VY4 0 717 57 5 633 3 dnaK Chaperone protein DnaK Helicobacter acinonychis (strain Sheeba)
C1F2D2 0 717 56 8 648 3 dnaK Chaperone protein DnaK Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
A6L2X7 0 717 59 5 643 3 dnaK Chaperone protein DnaK Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q1CV46 0 716 57 5 633 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain HPAG1)
A7ZEB5 0 716 58 6 634 3 dnaK Chaperone protein DnaK Campylobacter concisus (strain 13826)
P55994 0 716 57 5 633 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain ATCC 700392 / 26695)
B2URT8 0 714 57 5 633 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain Shi470)
B6JPL0 0 714 57 5 633 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain P12)
Q253K1 0 714 60 6 606 3 dnaK Chaperone protein DnaK Chlamydia felis (strain Fe/C-56)
A8Z5V5 0 714 57 3 635 3 dnaK Chaperone protein DnaK Karelsulcia muelleri (strain GWSS)
A0Q1R4 0 714 57 4 644 3 dnaK Chaperone protein DnaK Clostridium novyi (strain NT)
P17821 0 713 61 4 575 3 dnaK Chaperone protein DnaK Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BC31 0 713 61 4 575 3 dnaK Chaperone protein DnaK Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
Q3KLV7 0 713 61 4 575 3 dnaK Chaperone protein DnaK Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0B7W6 0 713 61 4 575 3 dnaK Chaperone protein DnaK Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q93GF1 0 712 57 6 648 3 dnaK Chaperone protein DnaK Hoylesella loescheii
B2V2I5 0 712 57 6 645 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Alaska E43 / Type E3)
B5Z9P0 0 712 57 5 633 3 dnaK Chaperone protein DnaK Helicobacter pylori (strain G27)
Q5KWZ7 0 712 58 7 641 1 dnaK Chaperone protein DnaK Geobacillus kaustophilus (strain HTA426)
P30721 0 711 56 6 644 2 dnaK Chaperone protein DnaK Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A3DF25 0 711 56 3 637 3 dnaK Chaperone protein DnaK Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q08276 0 711 59 3 599 2 HSP68 Heat shock 70 kDa protein, mitochondrial Solanum tuberosum
Q1AXX6 0 711 59 4 602 3 dnaK Chaperone protein DnaK Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q7VIE3 0 710 57 6 634 3 dnaK Chaperone protein DnaK Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B2TLZ7 0 709 57 6 645 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Eklund 17B / Type B)
Q824B2 0 709 61 4 577 3 dnaK Chaperone protein DnaK Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q8YW74 0 709 56 8 641 3 dnaK2 Chaperone protein dnaK2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7MA35 0 709 56 5 637 3 dnaK Chaperone protein DnaK Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A5N6M2 0 709 56 6 647 3 dnaK Chaperone protein DnaK Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E041 0 709 56 6 647 3 dnaK Chaperone protein DnaK Clostridium kluyveri (strain NBRC 12016)
B8CXL1 0 708 59 4 604 3 dnaK Chaperone protein DnaK Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A7GXU4 0 707 57 7 635 3 dnaK Chaperone protein DnaK Campylobacter curvus (strain 525.92)
B0K3Y0 0 706 56 4 638 3 dnaK Chaperone protein DnaK Thermoanaerobacter sp. (strain X514)
A2BZ91 0 705 56 7 642 3 dnaK Chaperone protein DnaK Prochlorococcus marinus (strain MIT 9515)
P86233 0 705 56 5 626 1 HSPA9 Stress-70 protein, mitochondrial Mesocricetus auratus
B0KA81 0 705 56 4 638 3 dnaK Chaperone protein DnaK Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B9KCH0 0 705 58 4 602 3 dnaK Chaperone protein DnaK Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
B1ILM3 0 704 55 4 650 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Okra / Type B1)
P27542 0 704 60 6 598 3 dnaK Chaperone protein DnaK Chlamydia pneumoniae
Q892R0 0 704 55 4 646 3 dnaK Chaperone protein DnaK Clostridium tetani (strain Massachusetts / E88)
A7GHH6 0 704 55 4 650 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
C1FVU0 0 704 55 4 650 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Kyoto / Type A2)
A5I640 0 704 55 4 650 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXL5 0 704 55 4 650 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain ATCC 19397 / Type A)
B1KZN7 0 702 55 5 650 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain Loch Maree / Type A3)
B2UKV6 0 702 60 5 589 3 dnaK Chaperone protein DnaK Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q8RB68 0 702 56 5 637 3 dnaK Chaperone protein DnaK Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A6QBG0 0 701 57 4 633 3 dnaK Chaperone protein DnaK Sulfurovum sp. (strain NBC37-1)
P61443 0 701 57 6 647 3 dnaK Chaperone protein DnaK Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
C3L3G7 0 701 55 4 650 3 dnaK Chaperone protein DnaK Clostridium botulinum (strain 657 / Type Ba4)
Q7V9G2 0 701 54 7 641 3 dnaK2 Chaperone protein dnaK2 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q7UZG3 0 700 55 6 641 3 dnaK2 Chaperone protein dnaK2 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B0TAD7 0 698 55 5 644 3 dnaK Chaperone protein DnaK Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q8GH79 0 698 60 7 602 3 dnaK Chaperone protein DnaK Chlamydia abortus (strain DSM 27085 / S26/3)
P61442 0 697 56 4 647 3 dnaK Chaperone protein DnaK Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q04Y47 0 697 57 5 646 3 dnaK Chaperone protein DnaK Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04VC8 0 697 57 5 646 3 dnaK Chaperone protein DnaK Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A7I2D4 0 697 56 5 642 3 dnaK Chaperone protein DnaK Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15440
Feature type CDS
Gene dnaK
Product molecular chaperone DnaK
Location 74930 - 76852 (strand: 1)
Length 1923 (nucleotides) / 640 (amino acids)

Contig

Accession term accessions NZ_VXKB01000005 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1135
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00012 Hsp70 protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0443 Posttranslational modification, protein turnover, chaperones (O) O Molecular chaperone DnaK (HSP70)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04043 molecular chaperone DnaK RNA degradation
Longevity regulating pathway - worm
Tuberculosis		 -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG043573 chaperone protein DnaK VF0713 Adherence

Protein Sequence

MGKIIGIDLGTTNSCVAVMDGNKARVLENAEGDRTTPSIIAYTADGEILVGQPAKRQAVTNPQNTLFAIKRLIGRRFNEEEVSRDMNIMPYKIVGADNGDAWVEAKGQKMAPPQISAEVLKKMKKTAEDYLGEPVTEAVITVPAYFNDAQRQATKDAGRIAGLDVKRIINEPTAAALAYGLDREVGNRTIAVFDLGGGTFDISIIEIDEVDGEKTYEVLATNGDTHLGGEDFDSRMINYLVEEFKKEQGIDLRNDPLAMQRLKEAAEKAKIELSSAQQTDVNLPYITADASGPKHMNIKVTRAKLESLVEDLVKRCMEPVKVALKDAGLSVGDIQDVILVGGQTRMPMVQKTVADFFGKEPRKDVNPDEAVAVGAAVQGGVLGGEVKDVLLLDVTPLSLGIETMGGVMTALIAKNTTIPTKHSQVFSTAEDNQSAVTIHVLQGERKRSGDNKSLGQFNLDGIQPAPRGMPQVEVTFDIDADGILHVSAKDKNSGREQNITIKASSGLNEEEIQQMVRDAEANAEADRKFEELVQVRNQADQLVHATRKQIEEAGDKLPGDDKVKIEQAVSELEIASKGEDKAAIEEKTKALIEASAKLMEMAQQQAQAGAAGADAAQDAGQNDDVVDAEFEEVDDSKDKK

Flanking regions ( +/- flanking 50bp)

TCATATATATCGTAACGTAAGACAGAACAGAATTATTCGGAGGCGTTTAAATGGGTAAAATTATTGGTATCGACTTAGGTACAACTAACTCTTGTGTTGCTGTTATGGATGGCAACAAAGCGCGTGTACTGGAGAATGCGGAAGGCGATCGCACAACACCGTCAATCATTGCGTATACCGCCGATGGCGAAATTTTAGTCGGACAGCCGGCAAAACGCCAGGCCGTGACTAACCCGCAAAATACACTGTTTGCTATCAAACGACTGATCGGTCGTCGCTTTAATGAAGAAGAAGTCAGCCGTGACATGAATATCATGCCGTACAAAATTGTCGGCGCAGATAACGGTGACGCATGGGTGGAAGCGAAAGGCCAGAAAATGGCACCACCACAGATTTCAGCTGAAGTGCTGAAAAAAATGAAGAAAACCGCTGAAGACTATCTCGGCGAGCCGGTAACTGAAGCAGTTATCACCGTTCCTGCCTACTTTAATGATGCGCAGCGTCAGGCAACAAAAGACGCAGGGCGAATTGCAGGTCTGGATGTAAAACGTATCATCAACGAACCAACTGCGGCAGCGCTGGCTTATGGCCTTGACCGTGAAGTCGGTAACCGCACTATCGCGGTATTTGACCTTGGTGGTGGTACATTCGATATCTCTATCATCGAAATCGATGAAGTTGATGGCGAAAAAACCTATGAAGTGCTGGCAACGAACGGCGACACTCACTTAGGTGGTGAAGACTTCGACAGCCGCATGATCAACTATCTGGTTGAAGAATTTAAGAAAGAGCAGGGTATCGACCTGCGTAATGACCCGCTGGCAATGCAGCGTCTGAAAGAAGCTGCCGAGAAAGCAAAAATTGAGCTTTCTTCCGCTCAGCAGACCGACGTTAACCTGCCATACATCACGGCGGACGCGTCTGGTCCTAAACACATGAACATTAAAGTGACCCGTGCAAAACTGGAGTCACTGGTTGAAGACCTGGTTAAGCGCTGCATGGAGCCGGTCAAAGTTGCATTGAAGGATGCCGGACTGTCTGTTGGTGACATCCAGGATGTTATCCTGGTTGGTGGTCAGACCCGTATGCCGATGGTTCAGAAAACCGTAGCAGATTTCTTCGGTAAAGAGCCACGTAAAGACGTGAACCCGGACGAAGCTGTTGCTGTTGGTGCGGCAGTTCAGGGTGGTGTGTTAGGCGGCGAAGTGAAAGATGTTCTGCTGCTGGATGTCACCCCGCTGTCACTGGGTATCGAAACTATGGGTGGTGTGATGACGGCGCTTATAGCCAAAAATACCACTATCCCGACCAAACACAGCCAGGTGTTCTCCACAGCGGAAGACAACCAGTCTGCGGTGACTATCCATGTGTTGCAGGGTGAGCGTAAACGTTCCGGTGACAACAAATCACTGGGTCAGTTTAACTTAGACGGTATTCAGCCGGCACCACGCGGTATGCCGCAGGTTGAAGTTACATTTGATATTGATGCGGATGGTATCCTGCATGTGTCTGCTAAAGATAAAAACAGCGGACGTGAGCAGAACATCACCATCAAAGCCTCTTCCGGTCTGAATGAAGAAGAGATCCAGCAAATGGTTCGTGATGCTGAAGCTAACGCAGAAGCTGACCGTAAGTTTGAAGAGCTGGTACAGGTTCGCAACCAGGCAGATCAACTGGTTCACGCAACCCGTAAACAGATTGAAGAAGCAGGCGACAAACTGCCGGGCGACGATAAAGTAAAAATCGAGCAGGCAGTGAGTGAGCTGGAAATCGCAAGCAAAGGCGAAGATAAAGCGGCTATCGAAGAGAAAACGAAAGCGCTGATCGAGGCTTCTGCCAAGCTGATGGAAATGGCTCAGCAGCAGGCTCAGGCAGGTGCAGCTGGTGCTGATGCTGCGCAGGATGCCGGTCAGAATGATGATGTTGTCGACGCTGAATTCGAAGAAGTTGATGATAGCAAAGACAAAAAATAAGGCCCTTAGCGGGCGCGGTGATGGACAAGATTAATCACTGAAAACCCACA